Biology

On what structures are genes located and what is their primary function?
1 Answer
You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross: a. recombination is never observed because coral and cherry are in the same complementation group b. recombination is impossible because they are in the same gene (white) c. recombination is never observed because coral and cherry display the same phenotype d. recombination is possible and can generate a wild-type allele and a double mutant allele
1 Answer
fill in the blank "blank are the structure and functional units common to all living organisms the cell is the basic unit of blank .organisms having only one cell are called blank organisms with more than one cell are called blank "
1 Answer
Slow cycles release nutrients back into rapid eyeles through mechanisms, suchasweathering
1 Answer
Help me pls!! (I will give brainliest)
2 Answers
How can a small mutation provide a small advantage to an organism?
1 Answer
the specialised cells of the testes that secrete the male hormone are?A Sertoli cellsB AcrosomesC Leydig cellsD Seminal vesicles
1 Answer
help!!! will give brainlyest
2 Answers
please help lol.... condon chart amino acid mRNA
1 Answer
Base your answer to this question on the following information: You have isolated a primary signal factor from the blood of a space alien, which you name XFF (for X-files factor). You also have Isolated various types of alien cells which appear to Interact with XFF. Based on preliminar data, you think that XFF could be similar to one of three compounds normally found in human blood: epidermal growth factor (EGF), epinephrine, or estrogen. Which of the following would best be used to demorstrate XFF is most like EGF? A. exposure of cells to tyrosine kinase inhibitors B. microinjection into cells of nonhydrolyzable GTP analogues C. exposure of cells to ryanodine D. exposure of cells to radioactive XFF E. receptor binding assays
1 Answer
Please help, A, B,C, or D?
1 Answer
3. If seismographs showed a specific region as earthquake prone, what proposed solutionscould lessen the damage of potential earthquakes? (Describe at least two.)4. What are some costs and benefits of one of your proposed solutions?
1 Answer
Any substance that is acted upon by an enzyme is called: A. CoenzymeB. VitaminC. SubstrateD. Polypeptide
1 Answer
How do invasive species usually affect the availability of natural resources in an ecosystem? PLEASE HELP ME
1 Answer
The purpose of mitosis is to ___, while the purpose of meiosis is to ____. a) make new cells, and only germ-line cells do it; b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it; c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it; d) make new cells, and all body cells do it make new cells, and all body cells do it; e) make eggs or sperm, and only germ-line cells do it
1 Answer
Different species often have structures that are used differently but are verysimilar in form. Which of the following hypotheses is supported by thisevidence?HELP PLEASE
1 Answer
In pea plants, tall plants are dominant to short plants. If two heterozygous tall plants are crossed, what percent of the offspring will be short?del TTTTtTttt25%75%0%50%
1 Answer
what does the tilde symbol mean in biology
1 Answer
What is the major distinction scientists use to divide the animal kingdom?
1 Answer
help. no links or spam.
2 Answers
A married couple plans to have children. The wife has blue eyes (a recessive trait) and her husband has brown eyes (a dominant trait). The husbands mother had blue eyes. What percentage of their children could possibly have blue eyes?
1 Answer
Teniendo en cuenta problemticas de la biologa o de su aprendizaje ,pensar un tema investigar desde el enfoque cualita tivo y otro desde el enfoque cuantitativo
1 Answer
I need help ASAP!!A.DB.BC.CD.A
1 Answer
Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA
1 Answer