Write whether each is an expression, equation, or an inequality.
5. 3+5-7 = 1
6.3x-5t+4
7.9r+ 10_>14
8. 10+s≠4

Answers

Answer 1
5. Equation
6. Expression
7. Inequality
8. Equation

Related Questions

im kinda confused of a question right now, i have to find the median and there are 2 numbers in the middle, and i think you add the 2 numbers in the middle and turn it into a fraction right? but do you always put the denominator as 2?

Answers

Answer:

Yes, you take the average value of the two numbers in the middle.

Step-by-step explanation:

Since there are TWO middle values, you always put 2 as a denominator.

8. Larissa plans to bake at
most 10 loaves of bread.
She makes x loaves of banana bread that sell for
$1.25 each and y loaves of nut bread that sell for
$1.50 each. She hopes to make at least $24 in sales.
Write and graph a system of inequalities for this
situation. What does the
graph show?

Answers

The system of inequalities is:

x + y ≤ 10

x*$1.25 + y*$1.50 ≥ $24

And the graph can be seen below, on the graph, we can see that there are no solutions.

How to write and graph a system of inequalities?

So we need to start by defining the variables we will be using, these are:

x = number of loaves of banana bread.y = number of loaves of nut bread.

First, we know that Larissa wants to make at most 10 loaves of bread, then we can start with the inequality:

x + y ≤ 10

We also know that each banana bread sells for $1.25 and each but bread sells for $1.50, and she wants to make at least $24, then:

x*$1.25 + y*$1.50 ≥ $24

So the system of inequalities is:

x + y ≤ 10

x*$1.25 + y*$1.50 ≥ $24

So to graph these inequalities, we need to shade the region abovce the first line:

x + y = 10

and below the second line:

1.25*x + 1.50*x = 24

The graph of that system of inequalities can be seen below. The graph shows that the system has no real solutions (only has solutions for negative values of x).

Learn more about system of inequalities:

https://brainly.com/question/9774970

#SPJ1

Help Pleaseee ONLY CORRECT ANSWERSS> I WILL GIVE BRAINIEST.

Answers

Answer:

16[tex]\pi[/tex]

Step-by-step explanation:

Area = [tex]\frac{\pi r^{2} }{4}[/tex]  It is only 1/4 of a circle so we have to divide by 4

a = [tex]\frac{8^{2}\pi }{4}[/tex]

a = 16[tex]\pi[/tex]

Five times a number decreased by 2 is 4, find the number.

Answers

Answer: x= 6/5

Step-by-step explanation:

Let an unknown number be x

5x - 2 = 4

5x = 6

x= 6/5

If you can, please give me a Brainliest; thank you!

Reduce -15/-3 to the standard form

Answers

Answer:

5 x 10⁰

Step-by-step explanation:

-15 / -3 = 5

5 in standard form is 5 x 10⁰

Answer: 5

Step-by-step explanation:

-15/-3

negative signs cancel out each other to make positive

⇒15/3

⇒5/1

⇒5 answer.

hope that helps...

It takes one machine 25 minutes to pick a bale of cotton, and another machine takes 30 minutes to compete the same job. If both machines are used, how long will it take them to pick a bale of cotton?

Answers

Answer:

Hi i'm wondering how to find the answer the answer is 3 over 2 (2k-8) > 1 over 3(k-9)

Sam had 1 whole 1/2 m 5/8 m used it for a project. how much rope does San have left.​

Answers

Sam has 7/8 m of rope left.

What is fraction ?

Any number of equal parts is represented by a fraction, which also represents a portion of a whole. A fraction, such as one-half, eight-fifths, or three-quarters, indicates how many components of a particular size there are when stated in ordinary English.

In mathematics, a fraction is used to denote a portion or component of the whole. It stands for the proportionate pieces of the whole. Numerator and denominator are the two components that make up a fraction. The numerator is the number at the top, and the denominator is the number at the bottom.

To derive a solution, you have to subtract the meter of rope that Sam has from the meter of rope he cut for a project.  

Therefore,

1½ - 5/8,  

Since the meter of rope Sam had is represent with a mixed fraction, we have to convert it to an improper fraction, and therefore 1½ can also be written as 3/2

Therefore, we have

3/2 – 5/8

To solve this fraction, you need to find the smallest number that can divide the denominator (2 and 8), which is 8.  

Now divide the denominators with 8 and multiply the answers you get by the numerators.

Therefore, we have

3/2 -5/8

= 12/8 – 5/8

= 7/8 m.

Therefore, Sam has 7/8 m of rope left.

The smallest number used to divide the denominators is also known as the lowest common denominator (LCD).

A fraction has 2 parts, which are numerator and denominator. The numerator is the number at the top in a fraction while the denominator is the number below in a fraction.  

To learn more about fraction from the given link

https://brainly.com/question/78672

#SPJ1  

Workers install 480 chairs at a constant rate. After 3 days, the workers still have to install 120 chairs. How much time does it take to install the chairs from start to finish?

Answers

The 480 chairs were all finished by the employees in 4 days while maintaining a steady pace.

What is time and work?

Time and work deals with the time taken by an individual or a group of individuals to complete a piece of work and the efficiency of the work done by each of them.

Work Done = Time Taken × Rate of Work.

Rate of Work = 1 / Time Taken.

Time Taken = 1 / Rate of Work.

If a piece of work is done in x number of days, then the work done in one day = 1/x.

Total Work Done = Number of Days × Efficiency.

Here,

Total number of chairs=480

Chairs left to work on=120

It took them 3 days to install 360 chairs which means if they were working at a constant rate they got 120 chairs installed daily.

With 120 chairs left that means in 1 days they will finish.

So overall, it took the workers 4 days to finish.

The workers took 4 days to complete all the 480 chairs from start to finish at a constant rate.

To know more about time and work,

https://brainly.com/question/3854047

#SPJ4

for both anorexia and bulimia, the rate of occurrence in females compared to in males is about: group of answer choices equal 10 to 1 5 to 1 2 to 1

Answers

Both Anorexia and Bulimia the rate of occurrence is high in females as compare to males so the choice is female to male ratio is 12  to 1.

Eating disorder of Anorexia nervosa and Bulimia nervosa is more common in women as compare to men due to dieting habits.Patient suffering from Bulimia nervosa  eat in such a way  that it implies to lose weight and prevent him ' her from weight gain.Anorexia nervosa patients used to follow restrictive diets and apply lots of restrictions in consumption of their food. Males are more into muscles making so they consume food in good quantity very less percent of males are into diet restriction .Rate of occurrence in both the case anorexia and bulimia in females sufferer is more compare to males.Correct option is ratio female to male is 12 to 1.

Therefore, the rate of occurrence in females is much more than the males. Correct option is 12 to 1.

Learn more about rate of occurrence here

brainly.com/question/29991817

#SPJ4

Tyshawn has a quarters and y dimes, having at most 22 coins worth no less than
$3.40 combined. At most 16 of the coins are quarters and a maximum of 6 of the
coins are dimes. Solve this system of inequalities graphically and determine one
possible solution.

Answers

Answer: To solve this system of inequalities graphically, we can plot the two inequalities on the same coordinate plane and find the region where they overlap.

First, let's consider the inequality that states that Tyshawn has at most 22 coins worth no less than $3.40 combined. We can represent this inequality as follows:

Quarters * $0.25 + Dimes * $0.10 ≥ $3.40

Next, we can consider the inequality that states that at most 16 of the coins are quarters. We can represent this inequality as follows:

Quarters ≤ 16

Finally, we can consider the inequality that states that a maximum of 6 of the coins are dimes. We can represent this inequality as follows:

Dimes ≤ 6

To solve the system of inequalities graphically, we can plot the three inequalities on the same coordinate plane and find the region where they overlap. The region where the three inequalities overlap represents all of the possible values of Quarters and Dimes that satisfy all three inequalities.

One possible solution to the system of inequalities is (Quarters = 12, Dimes = 10). This solution satisfies all three inequalities and is represented by a point within the region where the three inequalities overlap on the coordinate plane.

PLEASE HELP ILL GIVE BRAINLIEST use the similar triangles as a guild to find the slope of the line

Answers

Answer:

Slope is 1, since we use rise over run which is expressed as 1/1

2. (6) The probability distribution below is for the random variable X = number of mice
caught in traps during a single night in small apartment building.
a. Find P(X = 2)
0
X
P(X) 0.12
1
0.20
2
h
3
4
0.14 0.16
b. Describe P(X ≥ 2)in words and find its value.
5
0.07
c. Find μx and ox. Show work. You may use your calculator to check solutions.

Answers

The probabilities are P(X = 2) = 0.14 and P(X ≥ 2) = 0.30

The mean and the standard deviation are 0.96 and 0.90

How to determine the probabilities

P(x = 2)

From the question, we have the following parameters that can be used in our computation:

X       0         1         2       3

P(X)   0.12    0.20   0.14  0.16

From the above table, we have

P(X = 2) = 0.14

P(x ≥  2)

From the question, we have the following parameters that can be used in our computation:

X       0         1         2       3

P(X)   0.12    0.20   0.14  0.16

From the above table, we have

P(X ≥ 2) = P(2) + P(3)

Substitute the known values in the above equation, so, we have the following representation

P(X ≥ 2) = 0.14 + 0.16

Evaluate the sum

P(X ≥ 2) = 0.30

The mean and the standard deviation

The mean is calculated as

μx = sum of the products of x and P(x)

So, we have

μx = 0 * 0.12 + 1 *0.20 + 2 * 0.14 + 3 * 0.16

Evaluate

μx = 0.96

The standard deviation is calculated as

ox = the square root of sum of the products of x and P(x) * (1 - P(x)

So, we have

ox = √[(0 * 0.12 * 0.88) + (1 * 0.20 * 0.80) + (2 * 0.14 * 0.86) + (3 * 0.16 * 0.84)]

Evaluate

ox = 0.90

Hence, the standard deviation is 0.90

Read more about probability at

https://brainly.com/question/251701

#SPJ1

statistical measures that communicate the most information should be used with scales that contain the most information. true false

Answers

True , statistical measures that communicate the most information should be used with scales that contain the most information.

Given :

statistical measures that communicate the most information should be used with scales that contain the most information. true  or false .

we know that ,

What is statistical measures ?

The mean, median, mode, percentiles, range, variance, and standard deviation are the most commonly used numerical measures for quantitative data.

So the statistical measures that must communicate the most information should be used with scales that contain the most information for knowing the details of the given data .

Learn more about the measures here:

https://brainly.com/question/12020266

#SPJ4

help pretty please :)

Answers

Answer: B

Step-by-step explanation:

A laptop computer i purchaed for. Each year, it value i $1500 of it value 75% the year before. After how many year will the laptop computer be worth $200 or le

Answers

After 7 years  the laptop computer will be worth $200 or less.

In this question, we have been given a laptop computer is purchased for $1500 . Each year, its value is 75%  of its value the year before.

We need to find the number of years when laptop computer be worth $200  or less.

We can see that given situation represents exponential decay function with initial value 1500, decay rate = 0.75 and the final value = 200

We need to find period t.

For given situation we get an exponential function as,

1500 * (0.75)^t ≤  200

(0.75)^t  ≤ 2/15

t * ln(0.75) ≤ ln(2/15)

t * (-0.2877) ≤ -2.0149

t ≥ (-2.0149)/(-0.2877)

t ≥ 7

Therefore, the laptop computer will be worth $200 or less after 7 years.

Learn more about exponential function here:

https://brainly.com/question/14355665

#SPJ4

A line has a slope of –20/11 and passes through the point (0, –2) What is its equation in slope intercept form?

Answers

Answer:
-20/11 is your slope.
So far y=-20/11x
0,-2 shows 0 is x and -2 is y
This means it passes not through the origin but through -2 on the y axis.
-2 is the intercept.
Your equation is y= - 20/11x - 2

Tom has a total of $220 and he spent $35 on a baseball ticket. What percent of his money did he have left

Answers

Answer:

He has $185 left

Step-by-step explanation:

Subtract $220 from how much he spent

he has 84.09 % of his money left. which is, $185 as a percentage

Cameron has papayas and bananas in a ratio of 6:19. How many bananas does he have if he has 36 papayas?

Answers

Answer: 113 bananas

Step-by-step explanation:

The ratio is 6:19, with 6 papayas for every 19 bananas.

We have 36 papayas, which is 6 times, so we just need to get 19 times 6 = 113 bananas

Find each percentage of 75. Explain your reasoning.
1. What is 10% of 75?
2. What is 1% of 75?
3. What is 0.1% of 75?
4. What is 0.5% of 75?

Answers

Answer:

1. 7.5

2. 0.75

3. 0.075

4. 0.375

Step-by-step explanation:

Yw, and have a good day to everyone who reads this <3 :)

for fixed population standard deviation and level of significance, the minimum sample size needed to guarantee a given margin of error ......... as the margin of error increases.

Answers

As per the concept of margin of error, the standard deviation increases as the margin of error increases.

The term margin of error is referred as the estimate of a small sample drawn from a relatively large population data.

Here the margin of error is usually governed by parameters such as standard deviation of population, sample size and desired confidence level.

Here we have given that for fixed population standard deviation and level of significance, the minimum sample size needed to guarantee a given margin of error ......... as the margin of error increases.

And we need to find the missing term in the statement.

Here let us consider that the following values are represented the given situation,

=> σ = Standard deviation for population

=> m = Margin of error

=> Z = Empirical value of Z-score at a given confidence level

Then the minimum sample size for a given confidence level is written as

=> (Z x σ)²/m²

Here from the above given formula it can be inferred that the minimum sample size is directly related to the population standard deviation. Therefore, the minimum sample size required would increase with the increase in population standard deviation.

To know more about Margin of error here.

https://brainly.com/question/29101642

#SPJ4

Consider a circle whose equation is x2 + y2 – 2x – 8 = 0. Which statements are true? Select three options.

The radius of the circle is 3 units.

The center of the circle lies on the x-axis.

The center of the circle lies on the y-axis. The standard form of the equation is (x – 1)² + y² = 3.

The radius of this circle is the same as the radius of the circle whose equation is x² + y² = 9.

Answers

The three (3) statements which are true include the following:

A. The radius of the circle is 3 units.

B. The center of the circle lies on the x-axis.

D. The radius of this circle is the same as the radius of the circle whose equation is x² + y² = 9.

What is the equation of a circle?

Mathematically, the standard form of the equation of a circle is represented by this mathematical expression;

(x - h)² + (y - k)² = r²   ....equation 1.

Where:

h and k represents the coordinates at the center of a circle.

r represents the radius of a circle.

From the information provided, we have the following equation of a circle:

x² + y² – 2x – 8 = 0      ......equation 2.

In order to determine the true statements, we would rewrite the equation in standard form and then factorize by using completing the square method:

x² – 2x + y² = 8 = 0

x² – 2x + (2/2)² + y² = 8 + (2/2)²

x² – 2x + 1 + y² = 8 + 1

(x – 1)² + (y - 0)² = 9         .......equation 3.

Comparing equation 1 and equation 3, we have the following:

Center (h, k) = (1, 0)

Radius, r = 3

Additionally, this line and the circle's center lies on the x-axis because the y-value is equal to zero (0).

(x – 0)² + (y - 0)² = 3²

x² + y² = 9.

Read more on equation of a circle here: brainly.com/question/17028215

#SPJ1

Which statements are not true and true?

statement 1: the sum of two negative integers is positive

Statement 2: the product of two negative integers is positive

Statement 3: the difference of two negative integers is positive

Statement 4: the quotient of two negative integers is positive


For both statements that are not true at all, provide one counter example for each statement that proves the statement can be false.

Answers

Answer: Statements 1, 3, and 4 are not true. The sum, difference, and quotient of two negative integers can be positive, negative, or zero, depending on the values of the two integers. For example, the sum of -5 and -7 is -12, which is a negative number. The difference of -5 and -7 is 2, which is a positive number. The quotient of -5 and -7 is -0.7142857142857143, which is a negative number.

Only statement 2 is true. The product of two negative integers is always a positive number. For example, the product of -5 and -7 is 35, which is a positive number. This is because the two negative signs "cancel out" when multiplying two numbers, resulting in a positive product.

The parabola y=x^2 i reflected acro the x-axi and then caled vertically by a factor of 1/8. What i the equation of the new parabola?

Answers

The equation of  the parabola will be y = -1/8[tex]x^{2}[/tex].

What is parabola?

A right circular cone and a plane perpendicular to one of the cone's elements cross to form a parabola, also known as an open curve.

Y = a(x - h)2 + k or x = a(y - k)2 + h is the general equation of a parabola. The vertex is shown here as (h, k).

The parabola's y= value is provided to us.

When we mirror this parabola along the x-axis, we scale the resulting image vertically by a factor of 1/8.

Then we get y = -1/8[tex]x^{2}[/tex]

To know more about parabola check the link:

brainly.com/question/21685473

#SPJ4

x+10=y, then 45 is equal to

Answers

Don’t know wish I could help

A line passes through (−1, 5) and (1, 3).

Which answer is the equation of the line? PLEASE HELP

Answers

The answer is y=1x+6

Sarah pent 30 minute practicing her pelling word. She pent 3 time a much time reading. How many minute did Sarah pend reading?

Answers

Sarah completed reading for x = 18 minutes.

What is unitary method ?

Area is the total amount of space that an object's shape or a flat (2-D) surface occupy.

Create a square on paper by using a pencil. Two dimensions make it up. A shape's area on paper is the space it takes up.

Imagine that your square is made up of smaller unit squares.

The area of a figure is equal to the number of unit squares required to completely cover the surface area of a particular 2-D shape. Square cms, square feet, square inches, square meters, etc. are a few common units for measuring area.

To get the area of the square figures presented below, draw unit squares with 1-centimeter sides. Therefore, the shape will be measured.

According to our question

The number of pages Sarah will read in an hour is x. (this is "pages per hour" rate).

(10 minutes) / (3 pages) = (x pages) / (60 minutes)

cross-multiply:

10x = 3*60

x = 18

Hence, Sarah completed reading for x = 18 minutes.

learn more about unitary method click here:

brainly.com/question/24587372

#SPJ4

how do i comeplete this equation using substitution?

Answers

The solution to the equations using the substitution method is x = - 2 and y = 0

What are the solutions?

The two equations given are known as system of equations. The equations have to be solved simultaneously to determine the required values.

y = 6x + 12 equation 1

y = 4x + 8 equation 2

Equate equation 1 and equation 2 together

6x + 12 = 4x + 8

6x - 4x = 8 - 12

2x = -4

x = -4 / 2

x = -2

Substitute for x in equation 1:

y = 4(-2) + 8

y = -8 + 8

Y = 0

To learn more about system of equations, please check: https://brainly.com/question/25875552

#SPJ1

A company has 30 employees 20 female 10 male, the board of directors decides to ask a group of 10 people, half of which are male, about expanding the company. Determine how many possible groups are there?

Answers

Answer:

M=960

F=480

Step-by-step explanation:

look at the work I did

Find the 3 smallest positive x-intercepts of the graph of
y = cos(12x) + cos(16x) and list them in increasing order.

Submit your answer as a list of x-coordinates from least to greatest.

Answers

To find the 3 smallest positive x-intercepts of the graph of y = cos(12x) + cos(16x), you can use the following steps:

Set y equal to 0 and solve for x to find the x-intercepts of the graph.

Since the graph of y = cos(12x) + cos(16x) is periodic with period 2π/12 = π/6 and 2π/16 = π/8, respectively, you only need to consider x-intercepts in the interval [0,π/6).

Use the identity cos(a+b) = cos(a)cos(b) - sin(a)sin(b) to rewrite the equation y = cos(12x) + cos(16x) as:

y = 2cos(4x)cos(8x) - sin(4x)sin(8x)

Set y equal to 0 and solve for x to find the x-intercepts. This will give you the x-coordinates of all the x-intercepts of the graph.

Sort the x-coordinates in increasing order and take the first three smallest positive values to find the 3 smallest positive x-intercepts.

For example, if you set y equal to 0 and solve for x, you get:

0 = 2cos(4x)cos(8x) - sin(4x)sin(8x)

This equation can be rewritten as:

cos(4x)cos(8x) = sin(4x)sin(8x)

Using the identity cos(a) = sin(π/2 - a) and substituting this into the equation above, we get:

sin(4x)sin(8x) = sin(4x + π/2)sin(8x)

This equation simplifies to:

sin(4x)sin(8x) = sin(4x)cos(8x)

Dividing both sides by sin(4x) and rearranging, we get:

sin(8x) = cos(8x)

This equation holds for all values of x that satisfy sin(8x) = cos(8x), so we can find the x-intercepts by setting these two functions equal to each other and solving for x:

sin(8x) = cos(8x)

sin^2(8x) = cos^2(8x)

sin^2(8x) - cos^2(8x) = 0

1 - cos(16x) = 0

cos(16x) = 1

Thus, the x-intercepts of the graph are at x = 0, x = π/16, x = π/8, x = 3π/16, and so on. Since we are only interested in the 3 smallest positive x-intercepts, we can take the first three values in this list: x = 0, x = π/16, and x = π/8.

Therefore, the 3 smallest positive x-intercepts of the graph of y = cos(12x) + cos(16x) are [0, π/16, π/8].

a pianist plans to play 3 pieces at a recital from her repertoire of 23 pieces, and is carefully considering which song to play first, second, etc. to create a good flow. how many different recital programs are possible?

Answers

Answer:

10626 different recital programs possible

Step-by-step explanation:

Since  there is no repetition we can tackle this problem in the following manner.

Out of the 23 pieces, the pianist can choose the first one in 23 ways

Out of the remaining 22 pieces she can choose the second one in 22 different ways

Out of the remaining 21 pieces she can choose the third one in 21 different ways

So total number of ways in which 3 pieces can be played without repetition is 23 x 22 x 21 = 10,626 ways

There is a formula for this kind of situation
If there are a total of n items and you want to choose r items from this, the number of possible ways to do this without repetition is given by the formula

[tex]_{n}P_{r} = \dfrac{n!}{(n-r)!}[/tex]

In this case, n = 23, r = 3 so we get
[tex]_{23}P_{3} = \dfrac{23!}{(23-3)!} = \dfrac{23!}{20!} = 23 \times 22 \times 21 = 10626[/tex]

Same as the above

Other Questions
Plot the image of point A under a dilation about point P with a scale factor of 3. Below is a list of inventions that came out during the Industrial Revolution, describe the impactof each oneIndoor plumbingToiletsToilet paper Electricity Cars Trains Radio Steam Engine Dynamite Cameras I have a triangle with c as hypotenuse, b as opposite, and nothing for adjacent. Bottom left corner is 62 degrees and the right bottom corner is 90 degrees. Round answer to nearest 16th of an inch SolvingThe product of 5 and the differencebetween a number and 7 is 75. What isthe number? a pregnant woman in the second trimester of pregnancy complains of constipation and describes the home care measures she is taking to relieve the problem. which would the nurse determine is a harmful measure in preventing constipation? Which statement accurately describes how toproperly use a semicolon to join independentclauses? An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D For the following data set, calculate the percentage of data points that fall within one standard deviation of the mean and compare the result to the expected percentage of a normal distribution.{8, 12, 27, 32, 45, 57, 61, 73, 82, 94} Literal Equations help asap !! Which statement best evaluates this response to the writing prompt?Prompt:Write an essay for your history teacher. In this essay, Identify what you believe is the most important reason the American Revolutionary War was fought. Support your claim with reasons and evidence.-Associated Passage:The revolutionary War period was a dark and difficult time for the United States. The war was violent. It was expensive. Independence was never certain. Still, I believe it was the right decision to fight it.A. It is weak because it does not discuss the reasons for war B. It Is strong because it suggests its position rather than stating it directly C. It Is strong because the author uses his or her personal voice D. It Is weak because its language is not appropriate for a teacher when assessing a client, what finding would the nurse interpret as indicating stimulation of the parasympathetic nervous system? (select all that apply.)