original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?​

Answers

Answer 1

Original DNA Sequence: TACTTTAATCCCAAATTTACT

Mutated DNA Sequence: TACTATAATCCCAAATTTACT

mRNA Sequence: ATGGAACCGCTGGTGA

Amino acid sequence: UACCUUGGCGACCACU

The type of mutation is Frameshift mutation.

What is frameshift mutation?

The disruption of a DNA sequence's triplet reading frame due to an insertion or deletion involving base pairs that are not multiples of three.  A frameshift mutation causes the codons read after the mutation to code for alternative amino acids. The first stop codon (UAA, UGA, or UAG) that is met in the sequence will likewise be altered by the frameshift mutation.

What is mutation?

A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell division, exposure to mutagens, or viral infection can all cause mutations.

To know more about mutation visit

brainly.com/question/17130462

#SPJ1


Related Questions

NEED HELP ASAP!!!!!!!

Cacti can survive with very little water.
Which statement describes why cacti have this ability?
(choose only one answer)

A. Cacti have a homeostatic system to control water loss.
B. Cacti do not have pores through which they can release excess water.
C. Cacti require a large amount of water.
D. Water is poisonous to cacti.

Answers

Statement cacti have a homeostatic system to control water loss describes why cacti have this ability.

What are the features of homeostatic system?

Homeostasis is the state of steady internal, physical, and chemical conditions maintained by living systems. This is the condition of optimal functioning for the organism and includes many variables.

Moreover, body temperature control in humans is one of the most familiar examples of homeostasis. Normal body temperature hovers around 37 °C (98.6 °F), but a number of factors can affect this value.

The homeostatic pathway controls energy balance by increasing the motivation to eat following depletion of energy stores.

Learn more about homeostasis system:

https://brainly.com/question/21324446

#SPJ1

What is the name of the scientist that developed the classification system we use today?.

Answers

Answer:

Carl Linnaeus

Explanation:

Carl Linnaeus, born 312 years ago today, was a Swedish biologist and physician who is known for the invention of Latin binomial nomenclature.

Answer:

Carl Linnaeus

Explanation:

Linnaeus was the first scientist to develop a hierarchal naming structure that conveyed information both about what the species was (its name) and also its closest relatives.

in the human ear, how do different hair cells respond to different frequencies of sound?

Answers

The basilar membrane vibrates in specific locations in response to particular frequencies because its stiffness varies.

What are cells referred to as?

All living things are constructed mostly from cells. They provide the body structure, absorb nutrients from meals, transform those to energy, and perform certain tasks.

What are cells and why are they important?

All living creatures, from bacteria to people, depend on their cells for structure and functionality. They are viewed as the tiniest form of life by scientists. The biological machinery needed to produce the proteins, chemicals, & signals vital to every bodily function is housed within cells.

To know more about Cells visit:

https://brainly.com/question/12129097

#SPJ4

a population is . question 38 options: a group of individuals of several interacting species that live in one area a group of individuals of a single species that live and interact in one area the sum of all individuals of a species in all locations a group of individuals of several interacting species that interact in multiple ecosystems a group of cells that have similar function

Answers

A population is a group of individuals from the same species who live and interact in the same area.

A population's health and behaviour are determined by how individuals interact with one another and with their surroundings. The community is made up of many such populations that interact with one another.

The ecosystem is made up of the biotic community and the abiotic environment. And a biome develops as a result of similar climatic conditions in a region; these regions are typically large, encompassing many continents. It can be thought of as a collection of various ecosystems. An ecosystem is a geographical area in which plants, animals, and other organisms, as well as weather and landscapes, coexist to form a life bubble.

To know more about the Species, here

https://brainly.com/question/13258090

#SPJ4


For which traits is the plant heterozygous? Select one or more pairs of alleles as your answer.
E
d
FI
D
flower location
plant height
seed pod shape

Answers

When an organism is heterozygous, it has two distinct alleles of the same gene.For instance, pea plants can have either homozygous dominant (red-red) or heterozygous red blooms (red-white).They were homozygous recessive if they have white blooms (white-white).Heterozygous carriers are always present.

What characteristic is heterozygous?

When an organism has two identical copies of the same gene, it is said to be homozygous for that trait; when an organism has two different copies of the same gene, it is said to be heterozygous for the that trait.

How can you tell whether a plant is heterozygous?

One gene is present in hemizygous plants in just one copy.A single gene is present in two identical copies in homozygous plants.Heterozygous plants have different alleles, or distinct versions of the same gene, rather than two copies of the a single gene.

To know more about heterozygous visit:

https://brainly.com/question/3712307

#SPJ1

The modern phrasing of Beadle and Tatum's hypothesis about relationships between genes and their products is "one gene-one ______."
a) RNA
b) protein
c) enzyme
d) polypeptide

Answers

The modern version of Beadle and Tatum's hypothesis about gene-product relationships is "one gene-one polypeptide."

What is Beadle and Tatum's hypothesis?According to Beadle and Tatum, each gene directs the formation of one (and only one) enzyme. Beadle and Tatum shared the 1958 Nobel Prize in Physiology or Medicine with J. Lederberg.Beadle and Tatum used genetic and biochemical studies of the bread mold Neurospora to confirm Garrod's hypothesis. Beadle and Tatum discovered bread mold mutants that were unable to produce certain amino acids. A mutation had "broken" an enzyme required to build a specific amino acid in each of them.The one gene-one enzyme hypothesis proposes that genes act by producing enzymes, with each gene producing a single enzyme that affects a single step in a metabolic pathway.

To learn more about Beadle and Tatum's hypothesis refer to :

https://brainly.com/question/7994685

#SPJ4

8. What do the arrows represent in the food chain?

Answers

Answer: where energy is being passed

Explanation:

The synthesis of cholesterol is a process that involves over 30 different steps. Which step is the rate-determining step of cholesterol synthesis?.

Answers

The rate-determining step of cholesterol synthesis is the conversion of HMG-CoA to mevalonate by HMG-CoA reductase.

Cholesterol is the wax-like substance which is produced by the liver in animal body. It is essential for plasma membrane fluidity. Blood cholesterol is also good for health at certain levels. However, excess of blood cholesterol can cause serious diseases as well.

Mevalonate is a key compound for the synthesis of cholesterol and also other sterols. The pathway for this synthesis is called the mevalonate pathway. It occurs in the cytosol of the animals cells. HMG-CoA reductase is a key enzyme for the synthesis of mevalonate.

To know more about cholesterol, here

brainly.com/question/29661052

#SPJ4

Identify the organisms on which human technology has had an evolutionary impact.

a. houseflies
b. the bald eagle
c. mosquitoes
d. fish
e. bacteria

Answers

Bacteria is the organisms on which human technology has had an evolutionary impact.

Bacteria are single-celled organisms that are small in size. Bacteria can be found almost anywhere on the planet and are essential to the planet's ecosystems. Some species can survive in extreme temperatures and pressures. The human body is teeming with bacteria, and it is estimated that bacterial cells outnumber human cells. Bacteria are microorganisms that can take various forms. They can take the form of spheres, rods, or spirals.

There are bad bacteria, which we call pathogenic, and they cause diseases, but there are also good bacteria. The majority of bacteria in the body are harmless, and some are even beneficial. Disease is caused by a small number of species. They are also important because, once again, they will assist the body in maintaining a healthy state.

To know more about the  Bacteria, here

https://brainly.com/question/27574047

#SPJ4

A Picture Says It!
18. Explain what this image represents regarding where your entire DNA code can be found.

Answers

Answer:

This picture implies that your DNA is in every nucleus in every cell in your body.

Explanation:

That is why there are lines pointing to every cell nucleus from the picture of DNA. Hope this was helpful! ;D

Name 2 tructure ,viible with a light microcope, which ditinguih plant cell from animal cell

Answers

The cell wall and the vacuoles are the two features that can be seen under a "light microscope."

The cell membrane is present underneath the cellulose-based cell wall in plant cells, but only the cell membrane is present in animal cells. The plant cell is larger than the animal cell because it has more vacuoles than the animal cell does, which makes them different in size. Additionally, the vacuoles occupy a "large volume" of the cell.

To learn more about cell click here:

https://brainly.com/question/14957605

#SPJ4

Pls help me with this question asap !!!

Give an example of a disease caused by cells that have “gone wrong” or become dysfunctional. Explain how this disease is caused.

Answers

Answer:

Disturbances in cell death pathways at the molecular level can be linked to the pathogenesis not only of cancer, but also other diseases of enormous social importance, such as HIV, atherosclerosis, ischemia, reperfusion injury, infection, inflammation, autoimmune, and neurological disorders

Explanation:

you find an animal with a bilateral larval form but what appears to be a radial adult form. which taxa would you presume it to belong to?

Answers

The animal would be presumed to belong to Cnidaria if they have a bilateral larval form and radial adult form.

In the Cnidaria larvae, bilateral symmetry is a characteristic feature. In the field of biology, bilateral symmetry can be described as a type of symmetry in which when an organism is cut into half, both the right and the left side appear to be exactly similar.

However, after growth from the larval stage, the Cnidaria adults develop to have radial symmetry. In the field of biology, radial symmetry can be described as a type of symmetry in which the body has a central axis where all the lines or planes of the body of the organism can unite. A radial symmetry has a central axis.

To learn more about Cnidaria, click here:

https://brainly.com/question/23031195

#SPJ4

What are the common types of mutations that occur to convert proto-oncogenes to oncogenes?.

Answers

Missense and amplifications are the common types of mutations that occur to convert proto-oncogenes to oncogenes.

Missense mutation is a mutation in a gene's DNA sequence that causes an amino acid (a protein building block) to be swapped out for one that is not normally present at that location in the gene.

Amplification mutation is a rise in the gene's copy number. Additionally, there can be an increase in the RNA and protein produced by that gene. Cancer cells frequently experience gene amplification, and some of these amplified genes may enable cancer cells to proliferate or develop therapeutic resistance.

Hence, missense and amplication transform normal cell into cancer cell.

To know more about Cancer.

https://brainly.com/question/14945792

#SPJ4

which term applies to egg development within the female with nourishment derived from a yolk? group of answer choices ovoviparity oviparity viviparity ovovoparity

Answers

In oviparity, fertilized eggs are kept inside the female, but the embryo receives nutrition from the yolk of the egg, and the offspring are fully formed when they hatch.

Which phrase best describes the growth of eggs within a female?

Oogenesis is the name for this process of egg development. Once she reaches adolescence and begins to mature, her reproductive cycle will begin. One egg from this supply of eggs in her ovaries will then mature or become activated each month, allowing it to be fertilized by sperm.

What is the name of the egg formation process?

Oogenesis is the name given to the process of egg production. The parietal peritoneum folds that divide the pelvic cavity into two halves are where the uterus is suspended.

To knw more about egg development visit:-

https://brainly.com/question/9294117

#SPJ4

using what you have learned regarding genetics and crime, choose the best answer as to why dna analysis sometimes land the wrong people in jail?

Answers

The courts may require a suspect to submit a DNA sample if there is a substantial amount of evidence against them.

Explain about the DNA?

The information molecule is DNA. It holds the blueprints needed to create proteins, which are other big molecules. Each of your cells contains these instructions, which are dispersed throughout 46 lengthy structures known as chromosomes. Numerous smaller DNA fragments known as genes make up each of these chromosomes.

The molecule found inside cells that carries the genetic code essential to an organism's growth and operation. This information is transmitted from one generation to the next thanks to DNA molecules.

For heredity, protein coding, and supplying guidelines for life and its processes, DNA is crucial in all living organisms. The way a person or animal develops, reproduces, and eventually dies is determined by their DNA. 23 pairs of chromosomes, or a total of 46 chromosomes, are typically present in human cells.

To learn more about  DNA refer to:

https://brainly.com/question/16099437

#SPJ4

neanderthals and denisovans never mated with each other because they lived in such large communities where a lot of genetic admixture likely occurred. true false

Answers

How much DNA a person inherited from early humans is disclosed by genetic admixture several direct-to-consumer genetic testing businesses.

Do Denisovans and Neanderthals exhibit signs of interbreeding?

Neanderthals and Denisovans interbred with modern humans on multiple occasions in Eurasia. Neanderthal introgression events are thought to have occurred between 47,000 and 65,000 years ago, and Denisovan introgression events are thought to have occurred between 44,000 and 54,000 years ago.

What kind of evolutionary connection exists between Neanderthals and Denisovans and modern humans?

It is still being researched how exactly modern humans, Neanderthals, and Denisovans are connected to one another. However, studies have revealed that modern humans and Neanderthal and Denisovan populations coexisted for a time and produced children together (interbred).

To know more about genetic admixture visit :-

https://brainly.com/question/28269701

#SPJ4

The pedigree below shows several generations of a family in which cystic fibrosis runs. A healthy phenotype is dominant (C), and cystic fibrosis is recessive (c). Shaded individuals have cystic fibrosis. Symbols with question marks have unknown genotypes and phenotypes. 11. Individual 4 was found to have a genotype of Cc, which means individual 4’s phenotype is

A. healthy male
B. male with cystic fibrosis
C. healthy female
D. female with cystic fibrosis

The answer is B, right?

Answers

Answer:

The correct answer should be A

Explanation

Since we know the genotype of individual 4 to be Cc (heterozygous), and C indicates a healthy person. In contrast, c indicates having cystic fibrosis. We can conclude that this person is healthy. C is dominant over c; therefore, this person does not have cystic fibrosis. If this person did have cystic fibrosis, they would need to be homozygous recessive (cc). This does mean, however, that since the person has the recessive allele (c) for cystic fibrosis, they are a carrier of it. That means that if they were to have children with someone who had cystic fibrosis (cc) or was a carrier of the recessive allele (Cc), their children could possibly have cystic fibrosis.

If a scientist wanted to determine if a forest environment had been polluted, which group of organisms typically would be the best indicator for the presence of pollutants?.

Answers

Amphibians would have been the best indicator of pollutants if a scientists wanted to determine if a forest environment had been polluted.

Amphibians are the vertebrates animals belonging to the phylum Chordata. These are ectothermic and four-limbed animals. These organisms need water or moist environment to complete their life cycle. They are good indicators of pollutants because they are highly sensitive to chemical changes in the environment.

Pollutants are the agents that cause disturbing effects in the environment called pollution. The pollution causes harmful effects upon the living organisms. The examples of pollutants are: Ozone, particulate matter, sulfur dioxide, etc.

To know more about pollutants, here

brainly.com/question/29594757

#SPJ4

inorganic nutrients are typically low where? group of answer choices in the euphotic zone in the aphotic zone in the disphotic zone in the abyssal zone

Answers

inorganic nutrients are typically low in euphotic zone

What is euphotic zone?

The ocean's euphotic zone is where enough light reaches the water to support photosynthesis. Light is essential for the survival of many creatures, and they are restricted to this region. The depth at which light from the surface enters the water determines the upper limit of the euphotic zone. a layer near the surface that receives sufficient light for photosynthesis to take place.

According to the question:

The euphotic zone is the highest 80 m (260 feet) or more of the ocean, which is sufficiently light to allow phytoplankton and plants to engage in photosynthesis. The disphotic zone, which stretches from the base of the euphotic zone to about 200 m, is illuminated by sunlight insufficient for photosynthesis.

To know more about euphotic zone:

https://brainly.com/question/2468538

#SPJ4

The sodium-potassium pump requires ATP in order to create a change in the shape of the carrier protein.
True
False

Answers

Answer: True

Explanation:

It is true sodium potassium pumps require ATP in order to create a change in the shape of the carrier protein.

Major geological and biological events of the past are used by scientists to describe the.

Answers

Scientists use historical major geological and biological events to characterise the geological time scale.

Paleontologists, archaeologists, and geologists use the fossil record to put significant occurrences and species in the right geological epoch. The geologic time scale is fundamentally based on fossils. Because these time periods are frequently identified based on the presence of animal life, the names of the majority of the aeons and eras end in zoic. Fossil remains of relatively simple organisms, like bacteria, algae, and worm-like animals, have been found in rocks formed during the Proterozoic Eon.

To learn more about fossil click here:

https://brainly.com/question/12334063

#SPJ4

what is the primary difference between the innate and adaptive immune responses?

Answers

The body's initial line of defence against infections is innate immunity. It is broad and non-specific, which means it does not distinguish between pathogen kinds. Adaptive immunity is a form of immunity that develops as a result of disease exposure or vaccination.

What cells participate in innate and adaptive immunity?

There are several cell types that each play a unique function in immunity. These comprise macrophages, neutrophils, eosinophils, basophils, mast cells, and dendritic cells generated from myeloid progenitors in the innate immune response. Natural killer cells are also part of the innate immune system, but unlike the other cells, they are produced from lymphoid stem cells.

learn more about adaptive immune responses refer

https://brainly.com/question/15446299

#SPJ4

organism a is eukaryotic, unicellular, and lacks a cell wall. organism b is eukaryotic, multicellular, has cell walls, and is autotrophic. in which kingdoms should these organisms be classified?
a. Organism A in Protista and Organism B in Fungi
b. Organism A in Protista and Organism B in Plantae
c. Organism A in Animalia and Organism B in Fungi
d. Organism A in Animalia and Organism B in Plantae

Answers

Due to the existence of multicellular bodies, a heterotrophic source of food, eukaryotic cells, and cells without a cell wall, the Kingdom Animalia stands apart among them.

All animals have been divided into these five groups using the five Kingdoms concept. Due to the existence of multicellular organisms, a heterotrophic mode of nourishment, eukaryotic cells, and cells without a cell wall, the Kingdom Animalia stands out among them.

participants in the kingdom Monera include bacteria and unicellular prokaryotic BGA. The Protista kingdom encompasses all types of algae, protozoa, and eukaryotic unicellular creatures. Multicellular heterotrophic eukaryotes with chitinous cell walls are part of the kingdom fungus. Kingdom Plantae contains cellulose-based autotrophs, while Kingdom Animalia contains heterotrophs.

To know more about multicellular visit:-

https://brainly.com/question/11495349

#SPJ4

The operation of modern sewage plants helps to decrease

Answers

The operation of modern sewage plants helps to decrease: the wastewater as thoroughly as practically possible

What is modern sewage plants?

Water is poured into a tank holding a sand and charcoal filter bed at this facility. The filter strains out the remaining suspended particulates and absorbs additional dissolved compounds such as heavy metal ions and phosphates. Chlorine or other compounds are used to destroy bacteria.

By eliminating dangerous compounds from wastewater, sewage treatment facilities significantly lower the risk of disease. However, the treatment procedure is dependent on a consistent, dependable electrical source, which many impoverished nations lack.

Thus, sewage treatment plants are built with the intention of treating wastewater as extensively as is practically practicable.

To know more about modern sewage plants refer to:

https://brainly.com/question/16028433

#SPJ1

in the respiratory system, what type of epithelium is most common in the respiratory zone and why?

Answers

From the nasal cavity to the bronchi, the majority of the respiratory tree is lined by pseudostratified columnar ciliated epithelium.

What kind of respiratory epithelium is most prevalent?

pseudostratified goblet cells scattered within a columnar epithelium. A connective tissue having lots of elastic fibers, seromucous and mucous glands, and the epithelium and basement membrane are what are underneath the tissue. the most prevalent kind.

What is the respiratory tract epithelium?

The majority of the respiratory system is lined by respiratory mucosa, which is a form of ciliated columnar epithelium that acts to lubricate and shield the airways.

To know more about epithelium visit:-

https://brainly.com/question/14834974

#SPJ4

deforestation of japan’s pine woodlands by the timber industry allowed the matsutake mushroom to grow excessively, to the detriment of other species. true or false?

Answers

This is false because matsutake grows under trees, usually hiding under garbage on the forest floor, and forms symbiotic relationships with the roots of many different types of trees.

Matsutake, which is famous for being called "matsutake", is a mycorrhizal fungus that has a symbiotic relationship with trees, especially in many of its habitats, preferring pine trees. They are found in ponderosa pine, lodgepole pine, Maritime pine, Douglas fir, Norway fir, hemlock, tanoak, and Pacific madron. For years, China was the one of the world's largest suppliers of the rare to the delicacy Matsutake. This year, however, prolonged drought and heatwaves in the South severely impacted harvests and pushed up prices. If you dig underneath allotropa, you'll find matsutake mycelium, whether it's fresh red-and-white striped or brown and wilted. This mycelium is white or bluish in color and has the same distinctive odor as the mushroom itself.

To know more about symbiotic relationships visit:

https://brainly.com/question/28743202?referrer=searchResults

#SPJ4

Experiments with genetically altered mice showed that the mice would consume abnormally high amounts of bitter-tasting compounds in water after their _____.

Answers

Sweet taste cells were modified to express bitter taste receptors, suggesting that the sensation of sweetness depends solely on which taste cell is competent.

we investigated the effect of prolonged exposure to a bitter substance on recognition and aversion behavior in mice. Combined measures of rejection thresholds (RjT) and apparent recognition thresholds (aRcT) were performed using short-access two-bottle choice tests before and after taste aversion conditioning, respectively. First, RjT was higher than aRcT for the bitter amino acids L-tryptophan and L-isoleucine, which mice measure daily in their diet, indicating strong acceptance of these familiar stimuli within the concentration range between RjT and aRcT.

To know morw about amino acids please click on the link brainly.com/question/14583479

#SPJ4

you can just say the answer

Answers

Photosynthetic rate incrases steadiky as light level increse

What is photosynthesis?

Photosynthesis is defined as a process in which solar energy is captured and organic molecules are produced. This process is fundamental for the survival of life on the planet and is the main way in which energy enters the biosphere.

Where does photosynthesis take place?

Photosynthesis takes place in chloroplasts. Chlorophyll and carotenoids are arranged in the thylakoids of chloroplasts in units called photosystems. Two steps can be observed in photosynthesis: light reactions and carbon fixation reactions. At the end of photosynthesis, carbohydrates are produced.

How is ATP produced in the cell?

The breakdown of glucose occurs to generate ATP. In organisms without mitochondria, such as bacteria, respiration takes place in a structure called a mesosome. This process uses glucose and oxygen and produces ATP, carbon dioxide and water.

Learn more about Photosynthesis in brainly.com/question/1388366

#SPJ1

which statement is false about the usual causes of hypercalciuria? hypercalciuria is usually attributable to:

Answers

False statement regarding the typical causes of hypercalciuria: "Hypercalciuria is typically attributable to hyperthyroidism."

Which of the following pyelonephritis clinical symptoms differs from cystitis symptoms?

When systemic symptoms such a fever, chills, or sepsis are absent, cystitis can be distinguished from pyelonephritis. Upper UTI or pyelonephritis is indicated by symptoms such as flank discomfort, tenderness at the costovertebral angle, nausea, and vomiting.

Which drugs are regarded as the main offenders in nephrotoxic acute tubular necrosis ATN?

NSAIDs, antibiotics including amphotericin B, aminoglycosides, vancomycin, piperacillin/tazobactam, and radiocontrast agents are nephrotoxic drugs that should be avoided since they might cause acute tubular necrosis.

To know more about  amphotericin B visit:-

https://brainly.com/question/4652591

#SPJ4

Other Questions
the overall goal of dietary management for acute renal failure is provision of adequate energy, protein, and micronutrients to maintain homeostasis in patients who may be extremely catabolic. the preferred caloric intake would be: Q: Your favorite television pundit starts a comment with, 'Findings suggest that the economy has been in contraction for two, straight quarters.' What can you MOST likely predict based on this information?A. The economy is at full employment GDPB. The economy is adding a substantial amount of new jobsC. The economy is in an expansionD. The economy is in a recession Examine the following political cartoon. Identify and relate three elements that give you a clue to the historical content. A compact car has a maximum acceleration of 5.0 m/s2 when it carries only the driver and has a total mass of 1300 kg .What is its maximum acceleration after picking up four passengers and their luggage, adding an additional 400 kg of mass? You are offered a job in sales where you can choose toeither make a salary $500 (constant) every week orcommission of $20 per sale. Write 2 equations thatrepresent this scenario and solve the systemDollars600400--300-200--100-(0, 500)(1,500)(0, 0) (1, 20)20Sales20 Which two words are the closest synonyms, as they're used in theArticle?A. Refugee and prisonerB. Oppressor and tormentorC. Persecution and shameD. Indifference and love It has been observed (using an electron microscope) that when the red blood cells are sickled there are little spikes that puncture the plasma membrane. Predict how this will affect the functioning of sickled cells and their life span i have no clue how to do this please help me out :)) Is 3 : 9 and 6 : 36 equivalent ratios? for a spacecraft operations for a several year long mission to the outer solar system, i should use: rank the following ionic compounds based on increasing lattice energy. mgo, cacl2, nacl, nabr There were 700 colonies of bacteria on day 1 of culturing. With a growth rate of 2.3, determine how many days it will take the bacteria to multiply to 10 000 000 colonies.Round your answer to four decimal places.Use A = Pert The scatterplot shows x, the high temperature in degrees Fahrenheit (F), and y, the aquifer level in feet, for ten days in the same area.Based on the scatterplot, which equation best represents these data?y = 656 0.1 xy=6610.1xy = 656 0.5 xy=6610.5x Some ancient Egyptian statues portray pharaohs as sphinxes,what does this fact imply about ancient Egyptian culture? The equation for line s can be written as y+9=9(x8). Perpendicular to line s is line t, which passes through the point (9,9). What is the equation of line t?Write the equation in slope-intercept form. Write the numbers in the equation as simplified proper fractions, improper fractions, or integers. what do natural killer cells do and why are they considered a bridge between the innate and acquired immune response john and andrew plan to participate in the market for many months and decide to collude in order to maximize joint profits. what will be the outcome? class name: department problem description: 1. create a class for department 2. implement all the below listed concepts in your class. read lecture slides for reference.Note: The purpose of this assignment is to get the output using the following concepts of Object-Oriented programming - Data fields (0.5%) a. id b. name c. emailld d. dept You can add additional data fields if you want. Select proper datatypes for these variables Constructor (0.5%) a. No parameter b. With parameter Set id and name using the constructor with parameters. - - Methods (0.5%) To print the details of the employee. - - Invoke a method of an object (0.5%) Object to invoke setter-getter or print method - Static variable (0.5%)To keep the count of employee objects - Visibility Modifier for variables and methods (0.5%) Select proper modifiers for variables and methods. - Getter and Setter methods (0.5%) Create getter and setter methods for all variables. Steps to follow for main method (0.5%) 1. Create 3 or more employee objects using the constructor with parameters. 2. Increment the static variable count on each object creation 3. Set email id and dept variables value using setter methods of each object. 4. Print the Total employee count and all employee details (Try to use this keyword for printing data of employee object) There are 28 right-handed students in a class of 3 1. What is the probability that a studentchosen at random will be left-handed?31/2828/313/283/31 a farm has separate quality assurance employees that check the quality of the food product before distribution. this is an example of what type of control?