Terry has $5.79 to go shopping Which mixed number below is the fraction equivalent to $5.79? 500 a 5 79/100 b. 5 79/1000 57 9/100 d 57 9/10​

Answers

Answer 1

Answer:

579/100 is the same if u turned it into a decimal it would be 5.79

Step-by-step explanation:

you would do 579 divided by 100 and that will give you 5.79  

Answer 2

Answer:

the answer is 579/100

Step-by-step explanation:


Related Questions

Please sum1 help? I don’t understand this it would mean the wrld thx

Answers

Answer:

20 pages per hour

Step-by-step explanation:

Answer:

35

Step-by-step explanation:

What is 33.765 rounded to the nearest hundredth?

Answers

Answer:

33.77

Step-by-step explanation:

$1500 at 4% for 5 years

show your work please.

Answers

Answer:

$12825

Step-by-step explanation:

If the amount is 1.500 and intrest rate 4.00% and we have 5 years to invenst then that gives us $12.825

-5 2/3 + -3 1/9
need the answer
a. 2 1/6
b. -8 7/9
c. -8 1/4
d. 8 1/4​

Answers

Answer:

-8/7/9

Step-by-step explanation:

Hope this helps and have a great day :)

Answer:

Step-by-step explanation:

-5 2/3 +-3 1/9

-79/9 or - 8 7/9

Jerry left his house and walked l.5 miles directly west. Then he walked 1.5 miles directly east. At this point, how many miles was Jerry from his house?

Answers

Answer: he should be at home im sure

Step-by-step explanation:

74. Seven workers are hired to seed a field by hand. Each is given a plot 7 x 7
feet in size. What is the total area of the field?

Answers

Answer:

The total area of the field is 343 square feet

Step-by-step explanation:

Let us solve the question

∵ There are 7 workers hired to seed a field by hand

∵ Each is given a plot 7 x 7  feet in size

→ The plot has shaped a square because its two dimensions equal

The side of the plot = 7 feet

∵ The area of the square = side × side

∴ The area of each plot = 7 × 7

The area of each plot = 49 square feet

→ To find the total area multiply the area of 1 plot by the number

   of the workers

∵ The total area = 49 × 7

∴ The total area = 343 square feet

The total area of the field is 343 square feet

What is the factored form of x°-1?
(x2-1)(x2+x+1)
o (x-1)(x2-x+1)
o (x-1)(x2+x+1)
o (p-1)(x2+2x+1)

Answers

Answer:

o (x-1)(x2-x+1)

Step-by-step explanation:

i think hopefully it's right

Anna wants to bake 2 1/2 dozen cookies for a party. However, the recipe she has only makes a dozen cookies. If the original recipe calls for 1 1/4 cups of sugar, how many cups of sugar does she need to make the cookies for her party? Express your answer as a mixed number.

Answers

Given :

Sugar required for 2 1/2 = 5/2 dozen of cookies is 1 1/4 = 5/4 cups.

To Find :

How many cups of sugar does she need to make the cookies for her party.

Solution :

Let, cups of sugar required to make cookies for her party is x.

So,

[tex]x = \dfrac{\dfrac{5}{4}}{\dfrac{5}{2}}\\\\\\x = \dfrac{1}{2}[/tex]

Therefore, 1/2 cup of cookies is required to make 1 dozen cookies.

Hence, this is the required solution.

Answer: 25/8

Step-by-step explanation:  

We would first turn 2 1/2 and 1 1/4 into an improper fraction.

That leaves us with 5/2 and 5/4.

Then, because she needs to make 5/2 dozen cookies and needs 5/4 cups of sugar for every batch, we would multiply 5/2 and 5/4 together.

Therefore x, or the amount of sugar she needs, is 25/8

At night, the temperature in the fall in lowa is 35°F. During the day, the temperature rises 23°F.
What is the temperature in lowa during the day?

Answers

Answer:

58˚F

Step-by-step explanation:

35 + 23 = 58

I hope this helps, have a nice day! :)

Find the value of X

PLEASE

Answers

Answer:

x ≈ 18

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDASEquality Properties

Trigonometry

Law of Cosines: a^2 = b^2 + c^2 - 2(b)(c)cosA

a is a side lengthb is a side lengthc is a side lengthA is an angle corresponding with side a

Step-by-step explanation:

Step 1: Define

a = x

A = 30°

b = 16

c = 30

Step 2: Solve for x

Substitute:                    x² = 16² + 30² - 2(16)(30)cos30°Exponents:                   x² = 256 + 900 -2(16)(30)cos30°Evaluate:                       x² = 256 + 900 -2(16)(30)(√3/2)Multiply:                        x² = 256 + 900 - 480√3Add:                              x² = 1156 - 480√3Subtract:                       x² = 324.616Isolate x:                       x = √324.616Evaluate:                       x = 18.0171Round:                          x ≈ 18

quick i need hellppppp!!!!

Answers

Answer:

D

Step-by-step explanation:

Answer:

C

Step-by-step explanation:

find answer in terms of pi

Answers

Answer: V= 169.56 cubic squared

Explanation: V= πr2h
V= π (3)^2 (6)
V= 3.14 (9) (6)
V= 169.56 cubic squared

Answer:

Step-by-step explanation:

V = π r² h

V = π 3² × 6

V = π 9 × 6

V = π 54 units³

or 54 π units³

Please help
Hello,

I will mark brainliest to the one who answers
my question right and who does not copy what
someone else answered No cussing and
or Inappropriate words to get marked brainliest
Also say HAPPY THANKSGIVING

Thanks,
brownarietta8

Answers

Answer:

3/n - 10

Step-by-step explanation:

Subtracted from means it comes after

Quotient means divide

3/n - 10

For which equation is a = 4 not the solution?

9 a = 36
5 a = 54
8 a = 32
6 a = 24

Answers

9x4=36 X

8x4=32 X

6x4=24 X

5x4=20, not 54.

So 5xA=54 is the correct answer

hope it helps!

What is the slope of the line in the graph?

Answers

Answer:

My answer would be y=2x+1

Step-by-step explanation:

rules of a formal debate

Answers

Answer:

Step-by-step explanation:

be formal and dont yell

Answer:

Each of the six speakers (three affirmative and three negative) speak in succession to each other, beginning with the Affirmative Team. The speaking order is as follows: First Affirmative, First Negative, Second Affirmative, Second Negative, Third Affirmative, and finally Third Negative.

Step-by-step explanation:

Silvio is putting his books on a shelf. The shelf is 12 inches long. If each book Is LaTeX: 1\frac{1}{2}1 1 2inches wide, how many books can he put side-by-side on the shelf?

Answers

Answer:

8 books

Step-by-step explanation:

1 book = 1 1/2 inches

Length of the shelf = 12 inches

Hence,

3/2 inches = 1 book

12 inches = x

3/2 × x = 12 × 1

x = 12 ÷ 3/2

12 × 2/3

4 × 2

= 8 books

Hence, he can put 8 books side-by-side on the shelf.

Factoring Polynomials Completely

Answers

The answer would be

(x+2)

The first option

Factoring [tex]6x^2+7x-10[/tex]

gives us:

[tex]\left(6x-5\right)\left(x+2\right)[/tex]

so we know that the first option,

one of the factors is (x+2) is correct.

Can someone graph this

Answers

Answer:

Here its graphed for u!!

Step-by-step explanation:

what number is 2e+204

Answers

e is equal to 2.71828
2(2.71828) + 204 = 209.44

What is the value of x?

Enter your answer, as a decimal, in the box.

cm
Triangle M N P with segment A B parallel to segment N P and A is between M and N and B is between M and P. M N equals 46.2 centimeters, A N equals 14 centimeters, M P equals 72.6 centimeters, and M B equals x.

Answers

52.18cm I think is your answer

Pls who knows how to do this

Answers

Answer:

I think 31° is the answer

A tiny aeroplane accelerates at 35 m/s2 with a force of 20 N. What is the mass of the aeroplane?

Answers

Answer:

17/2

Step-by-step explanation:

James runs 8 laps in 14 minutes. How many laps can he run in one hour and ten minutes?

Answers

Answer: Don't come at me if I'm wrong, but I believe it's 40 laps.

Step-by-step explanation:

First, you need to figure out how many laps James runs in 1 minute and you can do this by dividing the number of laps and minutes (8 laps/14 minutes). This should give you 4/7 laps/minute.

Next, you figure out how many minutes 1 hour and 10 minutes is (just to make things easier) 1 hour and 10 minutes = 70 minutes

Then, you multiple 4/7 and 70 and you get 40 laps.

Answer:

40 laps

Step-by-step explanation:

I just put this into a proportion

so basically i just did 8/14 = ?/70

Then i just worked it like any other problem

8 x 70 then divide 14 and i got 40.

so James ran 40 laps in one hour and tens minutes

NOTE that i turned one hour and ten minutes into minutes

pls mark brainleist

The sum of the two shorter sides of a triangle must be greater than the longer side. the shorter side of a triangle is 8 inches and the longest side is 18 inches. how long must the third side of a triangle be?

Answers

Anything above 10 inches I believe

To add or subtract fractions, what must you have?

Answers

Answer:

You need a common denominator.

Step-by-step explanation:

3/4+2/3

9/12+8/12

Answer:

Equal denominators/common denominators

Step-by-step explanation:

You need to have equal denominators. If you do not, then you have to multiply the denominators against each other as well as multiplying the same number to the numerator. If a number is a factor of one of the numbers then multiply the number by its other factor so as to get the same number.

Ex. 1

First one explained:

2/3 + 4/5

1/3 * 5/5 = 5/15

2/5 * 3/3 = 6/15

5/15 + 6/15 = 11/15

Common denominator = 15

Ex. 2

Second one explained:

2/8 + 1/4

2/8 + 1/4*2/2 = 2/8 + 2/8

= 4/8

Common Denominator = 8

Hope this helped,

Kavitha Banarjee

Mr Roman drove from his hometown to another city. He used 12 1/4 gallons of gas for 318 1/2 mile trip. On average, how many miles did Mr. Roman travel per gallon of gas

Answers

Answer: 26 miles

Step-by-step explanation:

Gallons of gas used = 12 1/4 = 12.25

Distance of the trip = 318 1/2 = 318.5 miles

The miles that Mr. Roman travel per gallon of gas will be:

= Distance of the trip / Gallons of gas used

= 318.5/12.25

= 26 miles

Mr Roman travelled 26 miles per gallon of gas

one exterior angle of a regular polygon measures 22.5 degrees. How many sides does the polygon have?

Answers

Answer:

16

Step-by-step explanation:

The sum of the exterior angles of a polygon = 360°

Divide by 22.5 to find the number of sides n

n = [tex]\frac{360}{22.5}[/tex] = 16

It an be concluded tat the regular polygon has 16 sides

A regular polygon is a polygon with equal angles and equal sides.

The sum of exterior angles of a regular polygon is 360°

According to the given data

One exterior angle of a regular polygon measures 22.5 °

Let us consider that the regular polygon has "n" sides

So from the exterior angle sum property of the regular polygon we can write that

[tex]\rm n \times 22.5\textdegree = 360 \textdegree\\ n = 360\textdegree /22.5\textdegree \\n = 16[/tex]

So it an be concluded tat the regular polygon has 16 sides

For more information please refer to the link given below

https://brainly.com/question/22831826

.

x+2=18
3(x+2)=18
How can we get Equation B from Equation A?

Answers

Answer:

x+2 = 18  

x = 18-2

x=16

3(x+2) =18

3x + 6 =18

3x = 18 -6

3x = 12

x = 12/3 = 4

Step-by-step explanation:

Which situation CANNOT be represented by the equation x + 12 = 30?

Total snowfall for the winter was 30 inches. In January, it snowed 12 inches. What is x, the amount of snow that fell during
the other winter months?

Maria had $12. When she combined her money with Sarah, they had $30. What is x, the amount of money Sarah had?

Juanita spent $30 at the store buying a shirt and shorts. She bought a shirt for $12. What is the cost, x, of the shorts?

James 12 miles on Monday and 30 miles on Tuesday. What is, x, the total number of miles James ran all together?

Answers

Answer: D IS THE CORRECT ANSWER

Step-by-step explanation: MARK BRAINLIEST PLS

Answer:

I took the test ._.

Other Questions
what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz