GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answer:

ubalanced chemical equation for photosynthesis

Answer:

A) the ability to remember the antigen it encounters

Adaptative immunity reacts in a more general way producing nonspecific antibodies against the foreign antigen when the organism is first attacked by that foreign antigen. The second time around, when the organism is faced again with the same foreign antigen, it produces a much stronger response because it memorised the antigen and is not strange anymore so the response can be more specific, quicker, and effective.

Explanation:

Answer:

Explanation:

memory T cells plays an important role in fighting against microbe which encounter the body for second time

hi!! the water cycle goes:

evaporation, condensation, precipitation

hope this helps!!

Answer:

Explanation:

First of all you need to have ss because this is recessive.

Secondly there is 2 option for Dominant one

It could be Ss or SS so if you wanna know what is what you need to use recessive gen

S- ss if all genes are hybrid dominant one would be SS if some genes aren’t hybrid dominant one would be Ss

Answer:

B

Explanation:

They use echolocation (sound waves) because they cannot see the bottom of the ocean.

Good luck!

Answer:

sensory neuron

Explanation:

Answer:

I shouldn''t put your full name on there

Explanation:

you should have cropped your image we can see your full screen

Answer:

b.

Explanation:

This is incorrect, because, "water is a powerful accelerator of chemical reactions."

Credit to www.astronno.com

Answer:

The individual carrying this beneficial mutation will be selected through natural selection.

Explanation:

Mutations are genetic changes in the DNA sequence. When mutations occur in the germline, these genetic modifications can pass from one generation to the next. In general, mutations are deleterious, but there are exceptions where they may be beneficial for the individual and provide the raw material for evolutionary change. An individual carrying one beneficial mutation will have more chances to survive and reproduce than individuals without this mutation, and thereby such genetic change will increase its frequency in the population.

Answer:

it depends on the type of injury people usually stop feeling pain long before the broken bone has healed such as a fractured bone can take up to 6-8 weeks

Explanation:

Answer:

Repairing or reparative phrase begins within the 1st few days after the bone fracture last for about 6 to 8 weeks. During this time, the body develops cartilage tissue in and around the fracture site. Children's bones normally heal faster than adults.

hope this helps

Answer:

c

Explanation:

Answer:

I can tell you some difference but I cant find similarities

Explanation:

they each have thier own heat area

they are each a different breed

they each have thier own cold area

they each come from a different family tree

this all I can really see I hope this helped at least a bit

Answer:

All the embryos have a similar wormlike shape, but they have different features. For example, the amphibian has a large bubble shape in the middle and the fish has a smaller bubble shape. The others don’t have a bubble shape.

Explanation:

Got it off of Edmentum :)

Answer:

The survival and proper functioning of an organism depends on a finely tuned interface between genome and environment, nature and nurture. The interface that regulates gene expression through environmental feedback is called the epigenome.

Explanation:

Answer:

A chromosome is a single, long molecule of DNA. These highly organized structures store genetic information in living organisms. Small sections of the chromosome, called genes, code for the RNA and protein molecules required by an organism.

Answer:

Explanation:

Cell biology (also cellular biology or cytology) is a branch of biology studying the structure and function of the cell, also known as the basic unit of life. Cell biology encompasses both prokaryotic and eukaryotic cells and can be divided into many sub-topics which may include the study of cell metabolism, cell communication, cell cycle, biochemistry, and cell composition.

Genetics, study of heredity in general and of genes in particular. Genetics forms one of the central pillars of biology and overlaps with many other areas, such as agriculture, medicine, and biotechnology. Learn more about the history, biology, areas of study, and methods of genetics.

Molecular biology, field of science concerned with studying the chemical structures and processes of biological phenomena involving molecules. In particular, researchers focus on DNA, RNA, and proteins and their interactions. As a result, the field is closely related to genetics and biochemistry

The study of heredity is a field of genetics and cell biology. The DNA itself (molecular genetics), entire populations, or whole creatures are investigated at various levels of genetics (population and evolutionary genetics).

Two branches of biology are cell biology and molecular biology. The study of cellular mechanisms is a focus of the subject of cell biology.

As a result, it primarily concerns the functions and architecture of the cell. The study of molecular level mechanisms is a focus of the science of molecular biology.

Therefore, cell biology, genetics, and molecular biology are interconnected.

Learn more about cell biology and molecular biology here:

https://brainly.com/question/28782190

#SPJ2

Answer: 1. CCGTAAGCGCTAGTAC

2.GCAATCGTACGAAGTA

3. TGATTGCCATCGATCG

Explanation: you just flip the letters with their corresponding ones

Answer:

it was 500

Explanation:

i was confused at first, lol

Answer:

500

Explanation:

Answer:

it will contaminate the water, choice C

Explanation:

i took the quiz

Answer:

Credit goes to: wikipedia

I hope this helps!

Answer:

Explanation:

Black dwarf

Letter X represents the Mitochondria which marks the location where carbon dioxide is produced during respiration. So, the correct option is B.

A mitochondrion is defined as an organelle which is found in the cells of most eukaryotes, such as animals, plants, and fungi that have a double membrane structure. It uses aerobic respiration to generate adenosine triphosphate, which is used throughout the cell as a source of chemical energy.

The main role of mitochondria is oxidative phosphorylation which utilizes the energy released during the oxidation of the food we eat to generate ATP which is used as the primary energy source for most biochemical and physiological processes such as growth, movement and homeostasis.

So, the correct option is B.

Learn more about Mitochondria, here:

https://brainly.com/question/29763308

#SPJ7

Answer:

After intense activity, your muscles feel sore because of _____. a) the accumulation of NAD+ b) the accumulation of lactic acid c) the accumulation of ATP d) the accumulation of carbon dioxide. B. ... ATPc "carbon planet," because carbon is the central element in organic compounds. ... After intense activity, your muscles feel sore because of a. the accumulation of NAD+. b. the accumulation of lactic acid. c. the accumulation of ATP. d. the accumulation of carbon dioxide. b. the accumulation of lactic acid.

Explanation:

srry if this dosent help

Answer:

gk, gK

Explanation:

GK, Gk, gk, gK are the possible gametes can the plant produce. So, the correct option is A.

Male and female germ cells are created in the anther and ovule of flowering plants, respectively. Pollen grains, which are discharged from the anthers at anthesis, contain male gametes.

The generative cell relocates through the pollen tube formed by the tube cell during pollen germination to reach the ovary's base where it will be fertilized. The generative cell splits into two male gametes as it moves through the pollen tube.

In the given example, the following gametes could be created while creating a Punnett square:

=> GK (Green and long) (Green and long)

=> Gk (Green and short) (Green and short)

=> gK (Yellow and long) (Yellow and long)

=> gk (Yellow and short) (Yellow and short)

Therefore, the correct option is A.

Learn more about Gametes, here:

https://brainly.com/question/29882202

#SPJ7

Your question is incomplete, most probably the complete question is :

A plant can have green (G) or yellow (g) leaves. It can also have a long (K) or short (k) stem. A scientist is preparing a Punnett square for a dihybrid cross of a plant with a genotype GGKk. What possible gametes can the plant produce?

A) GK, Gk, gk, gK

B) GG, Kk

C) GK, Gk

D) GK, gk

Answer:

Nope, it dissolved before reaching the final stages.

I hope that helps :D

The moon moon moon moon

Explanation:

moon

A Tsunami is a huge tide or a series of killer waves that have the ability to move a large quantity of water.

Hence the correct option is C.

brainly.com/question/19162159.

Answer:

troposphere

This is the lowest part of the atmosphere - the part we live in. It contains most of our weather - clouds, rain, snow.

Answer:

C is the answer to the question

Answer:

1) Crest

2) Trough

3) Wavelength