Given
f
(
x
)
=

5
x
+
2
f(x)=−5x+2, find
f
(

4
)
f(−4).

Answers

Answer 1

Answer: 22

Step-by-step explanation:

f(x) = -5x + 2

Substitute the x for -4

f(-4) = -5(-4) + 2

f(-4) = 20+2

f(-4) = 22


Related Questions

please help me!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

EP = GP

GP = HP

angle EFH = 45

Think these 3 are the right answers, hope it helps.

Segment AB has point A located at (8, 9). If the distance from A to B is 10 units, which of the following could be used to calculate the coordinates for point B
O 10 √(x+8)2+(y+9)²
O10-√√(x+9)²+(y+8)²
O10-√√(x-8)2+(y-9)²
O10-√(x-9)2+(y-8)²

Answers

In order to find out the coordinates of B, we know that d=sqrt((x2-x1)^2+(y2-y1)^2
Thus, we get that 10= sqrt((x-8)^2+(y-9)^2

HELP MEEEEE PLEASEEEEEE

Answers

The bus is covering a distance of 42 miles in 1 hour 30 minutes then the speed of the bus will be 28 mph.

What is Average speed?

The overall distance the object covers in a given amount of time is its average speed. The scalar quantity represents the average speed. It does not have direction; it is represented by magnitude.

As per the given data provided in the question,

Total distance traveled by bus = 42 miles

Total time is taken by the bus = 1 hour 30 minutes = 1.5 hours.

Then the average speed of the bus will be,

[tex]Average\ Speed(S) = Total\ Distance/Total\ Time[/tex]

S = 42/1.5

S = 28 mph.

To know more about Average Speed:

https://brainly.com/question/12322912

#SPJ1


The surface area of this cylinder is 118.378 square yards. What is the height?
Use ≈ 3.14 and round your answer to the nearest hundredth.
r = 2.9 yd

Answers

The surface area of this cylinder is 118.378 square yards. 3.6 yard is the height.

What is surface area?

The quantity of space enclosing a three-dimensional shape's exterior is its surface area.

For instance, the surface area of a cube is its surface area if we need to determine how much paint is needed to paint it. Square units are used to measure it at all times.

The terms "lateral surface area," "curved surface area," and "total surface area" refer to three different forms of surface area.

Surface area and volume are the cylinder's two main characteristics because it is a three-dimensional form. The area of the two circular bases combined with the cylinder's curved surface area equals the cylinder's overall surface area. Its volume is the three-dimensional area that a cylinder takes up.

Given that,

Surface area (A) of the cylinder = 118.378 square yards.

radius (r) = 2.9 yard

As we know, A = 2πrh + 2πr²

putting the values we get -

or, 118.378 = 2πr (h + r)

or, 118.378 = 2 × 3.14 ×2.9 × (h + 2.9)

or, 118.378 = 18.212 × (h + 2.9)

or, 6.5 = h + 2.9

or, h = 6.5 - 2.9

or, h = 3.6 yard

Thus, 3.6 yard is the height of the cylinder.

To know more about surface area of cylinder refer to:

https://brainly.com/question/27440983

#SPJ1

a project has the following projected outcomes in dollars: $210, $320, and $540. the probabilities of their outcomes are 25%, 55%, and 20% respectively. what is the expected value of these outcomes?

Answers

The expected value of these outcomes are  $262.5, $496 and $648 respectively

How to calculate expected values?

You should know that the expected value are the proportion of the values when valued with the percentages

The given values are $210, $320 and $540

The given percentages are 25%, 55% and 20%

The expected values are

0.25*210 = $52.5+210=$262.5

0.55*320=176+320=$496

0.20*540=108+540=$648

Therefore the projected values of the project are  $262.5, $496 and $648 respectively

Learn more about projected value on  https://brainly.com/question/17199492

#SPJ1

f(x) = 3x - 2 and g(x) = 2x
Find g(f(3))

Answers

Answer:

14

Step-by-step explanation:

To find g(f(3)), you will need to first find f(3) and then substitute that value into the function g(x).

To find f(3), substitute 3 for x in the equation for f(x):

f(3) = 3(3) - 2 = 9 - 2 = 7

Now substitute the value of f(3) into the equation for g(x):

g(f(3)) = g(7) = 2(7) = 14

Therefore, g(f(3)) = 14

Answer:

f(3)=7  g(3)=6

Step-by-step explanation:

f(x)=3x-2

f(3)=3(3)-2

f(3)=9-2

f(3)=7

g(x)=2x

g(3)=2(3)

g(3)=6

The perpendicular biector of ide AB of triangle ABC interect ide AB at point D and BC at point E. If angle CAB = 82 degree and angle C = 68 degree, what i angle CAE

Answers

The angle of CAE is 22

What is perpendicular bisector ?

A line known as a perpendicular bisector cuts a specified line segment precisely in half, creating a 90° angle at the junction. The intersection of a line segment's midpoint with a perpendicular bisector. It can be built with a compass and a ruler. On both sides of the line segment being divided, it forms a 90° angle.

Perpendicular bisector of ABC's side AB crosses BC at point E and side AB at point D. Additionally, m CAB = 82 and m C = 68.

Adopt A E.

In ABC, the triangle's angle sum property is A+B+C=180°.

82°+∠B+68°=180°

∠B= 180°-150°

∠B=30°

AD=B DDE is a perpendicular bisector in A DE and B DE.

If ADE=BDE=90°

DE is common.

Δ A DE ≅ Δ E DB→→[S AS]

∠DEB=∠D A E→→[CPCT]----(1)

In Δ DBE

∠EDB + ∠DBE+∠BED=180°→→Angle sum property of Triangle.

90° +30°+∠BED=180°

∠BED=180°-120°

∠BED=60°

So, ∠BAE=∠BED=60°------[using (1)]

∠CAE=∠CAB - ∠BAE

= 82°-60°

= 22°

Therefore the angle CAE is 22

To know more about perpendicular bisector click the link:

brainly.com/question/24753075

#SPJ4

pls help due tomm!! super easyy

Answers

Answer:see below

Step-by-step explanation:

a+4<b+4

A new club sent out 250 coupons to boost sales for next year's memberships. They provided 4 times as many to potential members than to existing members. How many coupons did they send to existing members?
A.
4
B.
50
C.
5
D.
54

Answers

Answer: 50 existing members

If If you can help that would be great
3n < 3

Answers

Answer:

n<1

Step-by-step explanation:

3n<3
/3. /3

n<1
hopes this helps

Answer:

n < 1

Step-by-step explanation:

3/3 n < 3/3

n < 1

The congruency theorem can be used to prove that △wut ≅ △vtu.

Answers

As per the congruency theorem, the two triangles are congruent.

Congruency theorem:

Congruency theorem states that "if all the three sides of one triangle are equal to all the three sides of another triangle, then both the triangles are congruent to each other."

Given,

Here we need to prove that  congruency theorem can be used to prove that △wut ≅ △vtu.

Let us consider triangles WUT and VTU.

And in these triangles:

=> WU≅VT

And in those one, ∠T≅∠U,

Therefore, m∠T = m∠U = 90°

Here the side TU is common.

Now, we have to note that triangles WUT and VTU are right triangles, because m∠T = m∠U = 90°.

Then the side TU is common leg and sides WU and VT are hypotenuses.

Therefore, the HL theorem states: if the hypotenuse (WU) and one leg  (TU) of a right triangle (ΔWUT) are congruent to the hypotenuse (VT) and one leg (TU) of another right triangle (ΔVTU), then the triangles are congruent.

To know more about Congruency theorem here.

https://brainly.com/question/19258025

#SPJ4

Answer: HL

Step-by-step explanation:

Solve for x

Note drawn to scale

Geometry

Answers

Answer:

x=2

Step-by-step explanation:

1. Set the proportions equal: 5/2x-3 = 15/27

2. Butterfly method: 27x5 = 3x-3 x 15

3. Continue solving: 135 = 45x-45

4. Break it down: 45x = 90

5. Solution: 2 because 45 x 2 is equal to 90

Answer:

x=4

Step-by-step explanation:

[tex]\frac{3x-3}{5}=\frac{24+3x}{20}[/tex]          Original equation. A proportion can be set up so that

                              you can find x. One proportion can be one side over the

                              other side of one of the smaller triangle set equal

                              to the total length of the larger triangle. 27 and -3 can

                              combine forming 24, which continues to be added to 3x.

                              15 and 5 can be combined to become 20.

20(3x-3)=5(24+3x) Now, cross multiply. This involves the distribution of one

                               term to the terms it's multiplied by. 20*3x=60x and

                               20*-3=-60. 5*24=120 and 5*3x=15x.

60x-60=120+15x     Now, the goal is to get x alone on one side. You can do

                                this by combining like terms. Subtract 15x from both

                                sides and add 60 to both sides.

45x=180                   Then, divide by 45 to get x by itself.

x=4                            This is your answer.

What is the value of cosine (startfraction x over 2 endfraction) if tangent x = one-half and x is in quadrant iii? negative startstartroot startfraction 5 minus 2 startroot 5 endroot over 10 endfraction endendroot negative startstartroot startfraction 5 + 2 startroot 5 endroot over 10 endfraction endendroot startstartroot startfraction 5 minus 2 startroot 5 endroot over 10 endfraction endendroot startstartroot startfraction 5 + 2 startroot 5 endroot over 10 endfraction endendroot.

Answers

Given that x is in quadrant 3, its value for tan x=1/2 will be 206.565°, and its value for cos(206.565°) will be -0.894.

What is trigonometry?

Trigonometry is the study of angles and the angular relationships between planar and three-dimensional shapes. The cosecant, cosine, cotangent, secant, sine, and tangent are among the trigonometric functions (also known as the circle functions) that make up trigonometry. The sine, cosine, and tangent are the three fundamental trigonometric operations. The cotangent, secant, and cosecant functions are derived from these three basic functions. On these functions, all trigonometrical concepts are built.

Here,

Tan x=1/2

π<x<3π/2

x=tan⁻¹/²(1/2)

x=26.565°

As the x is in quadrant 3,

=180+26.565°

=206.565°

cos(206.565°)=-0.894

The value of x for tan x=1/2 will be 206.565° as x is in quadrant 3 and for the same value of x, cos(206.565°) will be -0.894.

To know more about trigonometry,

https://brainly.com/question/26719838

#SPJ4

Answer:

-sqrt 5 - 2 sqrt 5/10

Step-by-step explanation:

Edge 2023

Find the value of each variable

I’ve figured out Z, but need help with Y.

Answers

Answer: Y=112

Step-by-step explanation: Add all of the interior angles you have to get 248 and subtract 248 from 360.

67+80+101 = 248.

360-248 = 112

How do you simplify 5+5x-3x+1

Answers

Answer:

6 + 2x

Step-by-step explanation:

5 + 5x - 3x + 1

add 5 + 1

6 + 5x - 3x

collect like terms 5x -3x

6 + 2x

Step-by-step explanation:

Please follow me the answer is 6+2x

or 2x+6

in a survey conducted on an srs of 200 american adults, 72% of them said they believed in aliens. give a 95% confidence interval for percent of american adults who believe in aliens.

Answers

American adults believes in alien for the  given 95% confidence interval and sample surveyed is in the interval range of ( 0.66 , 0.78 ).

As given in the question,

Sample of American adults surveyed 'n' = 200

Percent of people believes in aliens are success  'p'= 72%

                                                                                      = 0.72

Percent of people who don't believes (failure) in aliens ' 1 - p'  = 1 - 0.72

                                                                                          = 0.28                                                                                    

95% Confidence interval that represents Americans adults who believes in aliens

value of z - score for 95% confidence interval = ± 1.96

Margin of error 'MOE'= (z-score)√p ( 1- p) /n

                                   = ( 1.96)√(0.72 × ( 1 - 0.72 )/ 200

                                   = 1.96 ( √0.2016 / 200)

                                   = 1.96 ×√0.001008

                                   = 0.063

Lower limit = p - MOE

                 = 0.72 - 0.063

                 = 0.66

Upper limit =  p + Margin of error

                 = 0.72 + 0.063

                 = 0.78

Therefore, 95% confidence interval with sample size of the Americans adults who believes in alien are in the interval of ( 0.66 , 0.78 ).

Learn more about sample here

brainly.com/question/11045407

#SPJ4

1 A, B and C are points on a circle with centre O.
8 cm A-B

15 cm B-C

B
AOC is a diameter of the circle.
AB= 8 cm
BC= 15 cm
Angle ABC = 90°
Work out the total area of the regions shown shaded in the diagram.
Give your answer correct to 3 significant figures.
Diagram NOT
accurately drawn

Answers

The total area of the shaded region is solved to be 154.93 cm²

How to find the total area of the shaded region

The diameter is solved using Pythagoras theorem given by the  the formula

hypotenuse² = opposite² + adjacent²

plugging the values as in the problem

let x be the required distance

x² = 8² + 15²

x² = 289

x = √289

x = 17

Work out the area of the triangle using the formula

= 1/2 *  base * height

base = hypotenuse or diameter

height = radius = diameter/2

= 0.5 * 17 * 8.5

= 72.25 cm²

Area of the circle

= Π * radius²

= 22/7 * 8.5²

= 226.98 cm²

shaded portion

= Area of the circle - area of the triangle

= 226.98 - 72.25

= 154.93 cm²

the area of the shaded portion is 154.93 cm²

Learn more on area of shaded portion here:

https://brainly.com/question/27947205

#SPJ1

help me with this please !!!!

Answers

Answer: 2 times!

Step-by-step explanation:

(-1,0)

(4/3, 0)

Answer:

C.2

Step-by-step explanation:

See attached: the graph of your function

The ribbon on a spool is 13 yards long. How many 4 inch pieces of ribbon can be cut from the spool?

Answers

Answer:

117

Step-by-step explanation:

13 yards = 468 inches

468 ÷ 4 = 117

Hello I can help you with this! The answer would be 117. Since 13 yards is 468 inches. Then divide 468 by 4 and you’ll get 117! Hope this helped and have good day!

Multiply (-8.328)(15.99)

Answers

Answer:

-133.16472

Step-by-step explanation:

N/A

Answer:

-133.16472

Step-by-step explanation:

f(x) = 2x³x² - 29x

What is the greatest possible number of turning points?

Answers

Answer:

4

Step-by-step explanation:

First we need to get some definitions out of the way

Definition of a turning point

A turning point is a point of the graph where the graph changes from increasing to decreasing (rising to falling) or decreasing to increasing (falling to rising). A polynomial of degree  n  will have at most  n−1  turning points.

Definition of degree of polynomial

The degree of a polynomial is the degree of the term having the highest degree.

The given polynomial is
[tex]f(x) = 2x^3x^2-29x[/tex]

The highest degree of [tex]x[/tex] is the degree of the polynomial
We know that when we multiply same terms with different exponents, the exponents get added. Therefore
[tex]x^3x^2 = x^{3 + 2} = x^5[/tex]

So the polynomial can be re-written as:
[tex]2x^5 -29x[/tex]The highest degree of [tex]x[/tex] is [tex]5[/tex] and this is the degree of the polynomial
So the maximum number of turning points [tex]= 5-1 = 4[/tex]

Ohdhhdhdhdgdueyehehehhegehehehgegr

Answers

Answer:

JSHKAKSBKSBAK?

Step-by-step explanation:

I NEED HELP ASAP

FIRST TI ANSWER GET BRAINLEST

Answers

Answer:

4.

y = -1/6 * x - 7/3

Step-by-step explanation:

We can just check:

1.

y =  -1/6 * x

this doesn't work for x = -2 and y = -2 (first point) because we get

-2 = -1/6 * -2 = 1/3

this is nonsense

2.

y = -6x - 3/7

this doesn't work for x = -2 and y = -2 (first point) because we get

-2 = -6 * -2 - 3/7 = 12 - 3/7 = 11 + 4/7

this is nonsense

3.

y = -6x

this doesn't work for x = -2 and y = -2 (first point) because we get

-2 = -6 * -2 = 12

this is nonsense

4.

y = -1/6 * x - 7/3

this works for x = -2 and y = -2 because

-2 = -1/6 * -2 - 7/3 = 2/6 - 7/3 = 1/3 - 7/3 = -6/3 = -2

it also works for x = 4 and y = -3 because

-3 = -1/6 * 4 - 7/3 = -4/6 - 7/3 = -2/3 - 7/3 = -9/3 = -3

Solve over the complex number x^2+16=0

Answers

Move constant
X^2=-16

Take square root of both side
X=+4, x=-4

X1=-4i, x2=4i

May I get Brainly

what value of k does the equation k + 4/x +3/x^2 =0. (I) two real and different roots. (Ii)coincident and real root. (iii) no roots​

Answers

The value of k will be equal to 4/3 and there will be two real and different roots.

What is a quadratic equation?

It is a polynomial with a degree of 2 or the maximum power of the variable is 2 in quadratic equations. It has two solutions as its maximum power is 2.

Given that the equation is k + 4/x +3/x² =0. The value of k will be calculated as,

k + 4/x +3/x² =0.

kx² + 4x + 3 = 0

b² - 4ac =0

4² = 4 x k x 3

16 = 12k

k = 4/3

Therefore, the value of k will be equal to 4/3 and there will be two real and different roots.

To know more about quadratic equations follow

https://brainly.com/question/1214333

#SPJ1

Pls help on my math question and for part c it’s 48 since the teacher gave us answer only for tht part and show work pls :)

Answers

a) Equation for length and width of the rectangular rug be [tex]x^{2}[/tex] + 8x - 42 = 0

b) Width of the rectangular rug be 3.5 feet

c) Diagonal of the rectangle is 12.5 feet

What is the area of the rectangle?

The area of ​​a rectangle is the area occupied by the rectangle within its four sides or boundaries.

The area of ​​a rectangle depends on its sides. Basically, the formula for area is equal to the product of the length and width of a rectangle. The perimeter of a rectangle is equal to the sum of all its four sides

It is given that area of a rectangular rug id 42 square feet. The rug is 8 feet longer than its wide

a) Let the width of the rectangular rug be x feet

Length of the rectangular rug = (x+8) feet

area of rectangular rug = Length × width = x × (x + 8) = [tex]x^{2}[/tex] + 8x

area of rectangular rug = 42

[tex]x^{2}[/tex] + 8x = 42

[tex]x^{2}[/tex] + 8x - 42 = 0

Therefore, equation for length and width of the rectangular rug be [tex]x^{2}[/tex] + 8x - 42 = 0

b) If the length of the rectangle is 12 feet

Area of rectangle = 42 square feet

length × width = 42 square feet

12 × width = 42 square feet

width = 42/12 = 3.5

Therefore, width of the rectangular rug be 3.5 feet

c) Length of the diagonal of the rectangle = [tex]\sqrt{length^2+width^2}[/tex]

= [tex]\sqrt{12^2+3.5^2}=\sqrt{144+12.25}=\sqrt{156.25}= 12.5[/tex]

Therefore, diagonal of the rectangle is 12.5 feet

To learn more about the area of rectangle from the given link.

https://brainly.com/question/2607596

#SPJ1

A full pond containing 625 gallons of water begins losing its water at a rate of 20% per week. If the pond now contains 320 gallons of water, how many weeks has it been since the pond was at full capacity?

(Use the digits 0 – 9 to enter a number. Use a decimal point only if necessary.)

Answers

If the pond now contains 320 gallons of water, number of weeks it has been since the pond was at full capacity is 5 week.

Given that, a full pond containing 625 gallons of water begins losing its water at a rate of 20% per week.

What is percentage?

Percentage is defined as a given part or amount in every hundred. It is a fraction with 100 as the denominator and is represented by the symbol "%".

Here, number of gallons water being used for x weeks is

625-320=305 gallons

Now, number of gallons of water used in a week= 20% of 305

= 20/100 ×305

= 0.2 ×305

= 61 gallons

So, number of weeks = x=305/61

= 5

Therefore, if the pond now contains 320 gallons of water, number of weeks it has been since the pond was at full capacity is 5 week.

To learn more about the percentage visit:

brainly.com/question/24159063.

#SPJ1

Answer:

5

Step-by-step explanation:

Look that guys answer is better

Simplify the expression |ab^3| if a>0 and b>0

Answers

The expression |ab^3| if a>0 and b>0 is even.

What is Parity Definition?

Even Function: A function is even if f(-x)=f(x) for all [tex]$x \in \mathbb{R}$[/tex] Odd Function: A function is odd if f(-x)=-f(x) for all [tex]$x \in \mathbb{R}$[/tex]

[tex]f(a): \quad|a|\left|b^3\right|[/tex]

[tex]f(-a): \quad|a|\left|b^3\right|[/tex]

[tex]-f(a):-|a|\left|b^3\right|[/tex]

Check parity of [tex]$|a|\left|b^3\right|$[/tex]

Check if Even: True

Check if Odd: False

Even

The expression |ab^3| if  b>0

[tex]$$\begin{aligned}& f(a): \quad|a| b^3 \mid \\& f(-a): \quad|a|\left|b^3\right| \\& -f(a): \quad-|a| b^3 \mid\end{aligned}$$[/tex]

Check parity of [tex]$|a|\left|b^3\right|$[/tex]

Check if Even: True

Check if Odd: False

Even

Learn more about Parity Definition visit:https://brainly.com/question/10762605

#SPJ1

0.4x+6.1forx= -5
show work

Answers

0.4x + 6.1
0.4(-5) + 6.1 = 4.1
0.4x + 6.1
0.4(-5) + 6.1
-2 + 6.1 = 4.1
0.4x + 6.1 = 4.1

3x + 4y =8 write equation in slope intercept

Answers

the answer would be y=-3/4x+2

Answer:

[tex]y=2-\frac{3}{4} y[/tex]

Step-by-step explanation:

Slope intercept form is y=mx+b

m is the slope; b is the y-intercept

Therefore, we need to isolate the y variable first

3x + 4y = 8

-3x          -3x

4y=8-3x                Divide both sides by 4 to leave y by itself.

/4    /4

[tex]y=2-\frac{3}{4} y[/tex]

Other Questions
original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D For the following data set, calculate the percentage of data points that fall within one standard deviation of the mean and compare the result to the expected percentage of a normal distribution.{8, 12, 27, 32, 45, 57, 61, 73, 82, 94} Literal Equations help asap !! Which statement best evaluates this response to the writing prompt?Prompt:Write an essay for your history teacher. In this essay, Identify what you believe is the most important reason the American Revolutionary War was fought. Support your claim with reasons and evidence.-Associated Passage:The revolutionary War period was a dark and difficult time for the United States. The war was violent. It was expensive. Independence was never certain. Still, I believe it was the right decision to fight it.A. It is weak because it does not discuss the reasons for war B. It Is strong because it suggests its position rather than stating it directly C. It Is strong because the author uses his or her personal voice D. It Is weak because its language is not appropriate for a teacher when assessing a client, what finding would the nurse interpret as indicating stimulation of the parasympathetic nervous system? (select all that apply.) How did the role of the Interstate Commerce Commission change by 1920? Which of the following choices best reflects the interrelationships of the four categories of balanced Scorecard performance measures? A) Learning and growth Customer Internal business process FinancialB) Learning and growth Internal business process Financial CustomerC) Financial Learning and growth Internal business process Customer D) Learning and growth Internal business process Customer Financial Multiple choiceA. Choice B B. Choice D C. Choice C D. Choice A What are the "posterior poles of the eyes"? The more predictable policy decisions by the Federal Reserve are, the more effective they are in the long run. A surveyor is 980 feet from the base of the world's tallest fountain at Fountain Hills, Arizona. The angle of elevation to the top of the column of water is 29.7 degrees. His angle measuring device is at the same level as the base of the fountain. Find the height of the column of water to the nearest 10 feet. x can be 1,2,3,4If x = 1, x?=-150If x = 2, x?=-50If x = 3, x?=50If x = 4, x?=150(x? Has to be the same in all questions) Which description are features of ancient indus cities?