Are the following two functions inverse of one another ? If so tell why.

Are The Following Two Functions Inverse Of One Another ? If So Tell Why.

Answers

Answer 1

Answer: No, they are not inverses of one another.

=======================================================

Explanation:

There are at least 3 methods we can use to prove the functions aren't inverses of each other.

------------------------------------

Method 1

Let's say we plugged x = 0 into f(x).

[tex]f(\text{x}) = 2\text{x}+1\\\\f(0) = 2*0+1\\\\f(0) = 1\\\\[/tex]

The input x = 0 leads to the output y = 1.

Then let's treat y = 1 as the input of the g(x) function, so we'll plug x = 1 into here.

[tex]g(\text{x}) = -2\text{x}-1\\\\g(1) = -2*1-1\\\\g(1) = -3\\\\[/tex]

If g(x) was the inverse of f(x), then the g(1) output value should be 0 to get us back where we started. However, we get an output of -3 instead.

This is sufficient evidence to conclude that f(x) and g(x) are not inverses of each other. We only need one counter-example to disprove this claim.

------------------------------------

Method 2

Recall that if f(x) and g(x) are inverses of each other, then we have the following two properties

f(g(x)) = xg(f(x)) = x

The left hand side of each equation involves the concept of "function composition".

Let's see what f(g(x)) is equal to in this case.

[tex]f(\text{x}) = 2\text{x}+1\\\\f(g(\text{x})) = 2(g(\text{x}))+1\\\\f(g(\text{x})) = 2(-2\text{x}-1)+1\\\\f(g(\text{x})) = -4\text{x}-2+1\\\\f(g(\text{x})) = -4\text{x}-1\\\\[/tex]

We do not get an output of simply x only, so this is another way to see how we don't have inverses.

Through similar steps, you should find that [tex]g(f(\text{x})) = -4\text{x}-3[/tex] which is further confirmation that f(x) and g(x) are not inverses of each other.

------------------------------------

Method 3

Let's ignore g(x) for now. We'll start with f(x) and find the inverse of it.

The process involves this basic outline:

Replace f(x) with ySwap x and ySolve for y

So,

[tex]f(\text{x}) = 2\text{x}+1\\\\\text{y} = 2\text{x}+1\\\\\text{x} = 2\text{y}+1\\\\\text{x}-1 = 2\text{y}\\\\\text{y} = \frac{\text{x}-1}{2}\\\\f^{-1}(x) = \frac{\text{x}-1}{2}\\\\[/tex]

Unfortunately we do not end up with -2x-1 as the actual inverse.

So if [tex]g(\text{x}) = \frac{\text{x}-1}{2}[/tex] was the case, then f(x) and g(x) would be inverses of each other.

Through similar steps, the inverse of [tex]g(\text{x}) = -2\text{x}-1\\\\[/tex] is [tex]g^{-1}(\text{x}) = -\frac{\text{x}+1}{2}\\\\[/tex]


Related Questions

Lester bought 8 t-shirts. The shirts came in p packages. Write an expression that shows how many t-shirts were in each package.

Answers

Expression for Number of t shirts in each package = [tex]\frac{8}{p}[/tex]

What is Unitary Method ?

The unitary approach involves calculating the value of a single unit, from which we can calculate the values of the necessary number of units.

Total number of shirts bought = 8 T- shirts

Total number of packages  = p

So,

According to unitary method

In p packages we have t shirts = 8

In one package number of t shirts we will have = [tex]\frac{8}{p}[/tex]

Expression for Number of t shirts in each package = [tex]\frac{8}{p}[/tex]

To know more about Unitary method

https://brainly.com/question/28276953

#SPJ4

There are 4 chocolate chip cookies and 3 oatmeal cookies in a cookie jar. If a child randomly takes 2 cookies, what is the probability that both are chocolate chip?

Answers

5%

hope you have a great day!

What is the equation of the blue line

Answers

Answer:

y = -1/2 x + 2

Step-by-step explanation:

A (0,2)

B (4,0)

(y-2)/(0-2) = (x-0)/(4-0)

(y-2)/-2 = x/4

(-y+2)/2 = x/4

4 * (-y+2)/2 = x/4 * 4

-2y+4 = x

-2y = x -4

2y = -x + 4

y = - 1/2 x + 4/2

y = -1/2 x + 2

Cindy had $660 in a savings account when Erika opened a savings account with zero dollars.
Cindy deposited $60 into her account each month for x months.
Erika deposited $100 into her account each month for x months.
• The accounts did not earn interest.
Which inequality represents this situation when the amount of money in Cindy's account was greater than the amount of money in Erika's accour

Answers

Answer: To represent the situation where the amount of money in Cindy's account is greater than the amount of money in Erika's account, you can set up the inequality as follows:

Cindy's account balance + (Cindy's monthly deposit * number of months) > Erika's account balance + (Erika's monthly deposit * number of months)

Substituting the known values, we get:

660 + (60 * x) > 0 + (100 * x)

Combining like terms, we get:

660 + 60x > 100x

Subtracting 60x from both sides, we get:

660 > 40x

Dividing both sides by 40, we get:

16.5 > x

Therefore, the inequality that represents the situation when the amount of money in Cindy's account is greater than the amount of money in Erika's account is 16.5 > x. This means that for the number of months (x) to be greater than 16.5, the amount of money in Cindy's account must be greater than the amount of money in Erika's account.

(10)
Write the equation
of the line in
Slope-Intercept
Form.

Answers

Answer:

y = -x

Step-by-step explanation:

The slope of this line is -1 (rise/run = -1/1 = -1). We can plug this value into the slope-intercept form equation:

y = mx + b

y = -1x + 0

and simplify.

y = -x

PLEASE I NEED HELP!!!!!!!!

Answers

Answer:

161 square inches.

Step-by-step explanation:

The surface area of a pyramid is the sum of the areas of all of its faces. Since the base of the pyramid is a square with an edge length of 7 inches, the area of the base is 49 square inches (7 inches x 7 inches).

To find the surface area of the pyramid, you also need to find the area of the lateral faces of the pyramid. The lateral faces of a pyramid are the triangular faces that are not the base. The lateral faces of a pyramid are all congruent, meaning that they are all the same size and shape.

To find the area of a lateral face of the pyramid, you can use the formula for the area of a triangle: A = 1/2bh, where A is the area of the triangle, b is the base of the triangle, and h is the height of the triangle.

In this case, the base of the triangle is 7 inches (the edge length of the base of the pyramid) and the height of the triangle is 8 inches (the slant height of the pyramid). The area of each lateral face of the pyramid is therefore 1/2 x 7 inches x 8 inches = 28 square inches.

Since there are 4 lateral faces on the pyramid, the total area of the lateral faces is 4 x 28 square inches = 112 square inches.

To find the surface area of the pyramid, add the area of the base to the area of the lateral faces: 49 square inches + 112 square inches = 161 square inches. Therefore, the surface area of the pyramid is 161 square inches.

help due tomm!!! suppppper easyy!!

Answers

Answer:   b/-3<a/-3

Step-by-step explanation:

a/-3<b/-3

b/-3<a/-3

Average employee salary?

Answers

Answer:

$67,680

Step-by-step explanation:

average is calculated as

average = [tex]\frac{sum}{count}[/tex]

Denver

[tex]\frac{sum}{137}[/tex] = 67,013 ( multiply both sides by 137 )

sum = 9,180,781

Anchorage

[tex]\frac{sum}{25}[/tex] = 71,332 ( multiply both sides by 25 )

sum = 1,783,300

total sum for both = $9,180,781 + $1,783,300 = $10,964,081

then average salary across both companies is

average = [tex]\frac{10,964,081}{162}[/tex] = $67,680 ( to the nearest dollar )

Two piece of metal meaure one and one fifth yard and three tenth yard each. Three time the amount of metal i needed for a project. How many total yard of metal i needed? one and one half yard one and nine fifteenth yard four and one half yard four and one fifth yard

Answers

As per the area of the rectangle, the amount of metal need for the total yard is 4.68

Area of rectangle

In geometry, the area of rectangle is written as,

A = l x b

where l refers the length and b refers the breadth of the rectangle.

Given,

Here we have given that the 1 1/5 and 3 1/10 is the measure of yard.

While we looking into the given question, we have identified that,

3 time of metal is need for the project,

So, as per the area of the rectangle formula, it can be written as,

=> 3 x 1 1/5 x 3 1/10

=> 3 x 6/5 x 13/10

=> 234/50

=> 4.86

To know more about Area of rectangle here.

https://brainly.com/question/20693059

#SPJ4

Answer:

4 1/2

Step-by-step explanation:

add 1 1/5 and 3/10 and then multiply your answr by 3

How much compound interest will $50,000 have earned in 10 years at
6.4% annual interest compounded quarterly?

Answers

The compound interest earned on $50,000 in 10 years at 6.4% annual interest compounded quarterly would be $28,167.50.

What is Compound interest?

Compound interest is a method of calculating the interest charge. In other words, it is the addition of interest on interest.

If the initial amount (also called as principal amount) is P, and the interest rate is R% per unit time, and it is left for T unit of time for that compound interest, then the interest amount earned is given by:

Compound Interest =P(1+r/n)^rt

We are given that

Principal amount = $50,000

Time = 10 year

Rate = 6.4%

Determine the compound interest earned on $50,000 in 10 years at 6.4% annual interest compounded quarterly, we can use the formula:

Plugging in the given values, we get:

compound interest = $50,000 (1 + 0.064/4)^(4 x 10) - $50,000

= $50,000 (1.016)^40 - $50,000

= $50,000 x 2.6335 - $50,000

= $78,167.50 - $50,000

= $28,167.50

Therefore, the compound interest is $28,167.50.

Learn more about interest here;

https://brainly.com/question/1548909

#SPJ1

8. Graph the function
f(x)=-5/4x+6.
Label the point on the graph that is the
solution to f(x) = -4 by writing
solution" next to it. Then, write the
solution below.


Solution

Show your work


Answers

The graph for the given function f(x)=-5/4x+6. is obtained.

What is meant by the term function?A function, according to a technical definition, is a relationship between a set of inputs and a set of potential outputs, where each input is connected to precisely one output.

For the stated question, the function is defined as;

f(x) = -5/4x + 6.

Put x = 0,

f(0) = -5/4(0) + 6.

f(0) = 6

Coordinate (0, 6)

For, the solution of f(x) = -4, put f(x) = -4

-4 = -5/4x + 6

x = 8

Coordinate (8, -4)

Plot the graph using the obtained points for the function.

Thus, the graph for the given function is obtained.

To know more about the function, here

https://brainly.com/question/25638609

#SPJ1

What is the distance from the origin to pint A graphed on the complex plane below

Answers

Answer: it's [tex]\sqrt{5}[/tex]

Step-by-step explanation:

when the philies play the dodgers, the tickets for three adults and three children are $75. for two adults and four children the total admission cost is $62. find the cost of each adult and each child ticket.

Answers

when the philies play the dodgers, the tickets for three adults and three children are $75. for two adults and four children the total admission cost is $62. So, by using equation formula:

the cost of each adult is $19

and each child ticket is $6

What is an equation?

An equation is a mathematical statement that proves two mathematical expressions are equal in algebra, and this is how it is most commonly used.

The relationship between the two expressions on each side of the sign is represented by a mathematical equation. One variable and an equal sign are often present.

Let us assume,

tickets for adults = a

tickets for children = c

Now,

3a + 3c = $75 ........ (i)

2a + 4c = $62 ......... (ii)

Multiply the equation (i) ×2 and equation (ii) × 3, we get -

6a + 6c =  $150 ........ (iii)

6a + 12c = $186 .........(iv)

Now, subtract equation (iv) from (iii) we get -

or, 6c = $36

or, c = $6

Now, putting the value of c in equation (iii) we get -

6a + 6×6 = $150

6a = $114

a = $19

Thus, the cost of each adult is $19

and each child ticket is $6

To know more about equation formula refer to:

https://brainly.com/question/22688504

#SPJ4

7 divided by 1 over 2

Answers

Answer: 3.5

Step-by-step explanation: hope it helps :)

Answer: 14

Step-by-step explanation: using cross multiplication, 7 times 2=14 and 1 time 1=1. so it would be 14/1 which can be simplified to 14.

Rewrite 15x^4y^3 − 45x^3y^4 using a common factor

Answers

15x^4y^3 − 45x^3y^4 Can be rewritten using a common factor as 15x^3y^3(x - 3y)

What is a common factor?

common factors are defined as factors that are common to two or more numbers. In other words, a common factor is a number with which a set of two or more numbers will be divided exactly.

In the algebraic expression 15x^4y^3 − 45x^3y^4,

15x^4y^3 is a term and 45x^3y^4, is another term.

if we take each variable and constant and compare

15 is common factor between 15 and 45

x^3 is a common factor between x^4 and x^3

y^3 is a common factor between y^3 and y^4

so multiplying the common factors together we have 15x^3y^3

what is left in the first term is x and second term is 3y

so that the rewritten form becomes 15x^3y^3(x - 3y)

In conclusion the other form of 15x^4y^3 − 45x^3y^4 is 15x^3y^3(x - 3y)

Learn more about common factors: https;//brainly.com/question/219464

#SPJ1

The diameter of a circle is 15 cm. Find its area to the nearest whole number.

Answers

Answer:

177

Step-by-step explanation:

A=3.14r^2

A=3.14(7.5)

A=~177

Dylan has $14.00 to spend at the book fair. He decides to buy two paperbacks for $4.50 each. Then, he sees some sticker books. At most, how much can he spend on sticker books?
A $5.50
B $6.00
C $5.01
D $5.00

Answers

Answer:

B because I had learned this at school.

Find the measure of angle f given the information below. please help !!

Answers

The measure of Angle f from the the figure is [tex]53^{o}[/tex].

What is the relation between Angles and Parallel lines ?

On a shared plane, parallel lines do not cross one another. Now, if a transversal crosses two parallel lines at two separate sites, four angles are created at each location. The characteristics of parallel lines with respect to transversals are therefore listed below.

Angles that coincide are equal.Angles that are vertically opposite or vertically angled are equal.Interior angles that alternate are equal.Exterior angles that alternate are equal.On the same side of the transversal, a pair of internal angles are additional.

The pair of alternative internal angles are equal when two parallel lines are crossed by a transversal.

When a transversal cuts between two parallel lines, the interior angles on the same side of the transversal are additional.

In the problem angle

a = [tex]119^{o}[/tex]

e = [tex]66^{o}[/tex]

Now , c = e ( alternate angles, interior)

⇒ c = [tex]66^{o}[/tex]

a + b = [tex]180^{o}[/tex] ( as sum of angles on a straight line is [tex]180^{o}[/tex] )

b = [tex]180^{o}[/tex] - [tex]119^{o}[/tex] = [tex]61^{o}[/tex]

f + b+ c = [tex]180^{o}[/tex]                [sum of angles of a Triangle is [tex]180^{o}[/tex] ]

f = [tex]180^{o}[/tex]  - [tex]61^{o}[/tex] - [tex]66^{o}[/tex] = [tex]53^{o}[/tex].

The measure of Angle f from the the figure is [tex]53^{o}[/tex].

To learn mre about Angles refer to :

https://brainly.com/question/17335144

#SPJ1

write an eqation of the line that passes throught the points (0,-2), (4,-2),

Answers

The equation of a line is given by:

y = mx + c

where m is the slope of the line and c is the y-intercept.

The equation of the line is y = -2.

What is an equation of a line?

The equation of a line is given by:

y = mx + c

where m is the slope of the line and c is the y-intercept.

Example:

The slope of the line y = 2x + 3 is 2.

The slope of a line that passes through (1, 2) and (2, 3) is 1.

We have,

The equation of the line is given as,

y = mx + c

The line passes through the points (0, -2) and (4, -2).

Now,

Slope = m

m = (-2 + 2) / (4 - 0)

m = 0 / 4

m = 0

Now,

(x, y) = (0, -2)

y = mx + c

-2 = 0 x 0 + c

c = -2

Now,

m = 0 and c = -2

y = 0x -2

y = -2

Thus,

The equation of the line is y = -2.

Learn more about equation of a line here:

https://brainly.com/question/23087740

#SPJ1

Ru buy three cake for £1. 60 each. He pay with a £20 note. How much change doe he get

Answers

We know that Ru will get back £15.2 when she buys 3 cakes for £1.60 each using simple mathematical operations.

What are mathematical operations?

The process of calculating a value using operands and a math operator is known as a mathematical "operation."

The provided operands or integers must follow certain established rules that are associated with the math operator's symbol.

The rules that determine how to solve an expression with several operations are referred to as the order of operations.

PEMDAS stands for Parentheses, Exponents, Multiplication, Division, Addition, and Subtraction (from left to right).

So, we know that:

Ru buys 3 cakes for £1.60 each.

She was given £20 not.

The money she will get back is:

20 - (1.60*3)

20 - 4.8

£15.2

Therefore, we know that Ru will get back £15.2 when she buys 3 cakes for £1.60 each using simple mathematical operations.

Know more about mathematical operations here:

brainly.com/question/28937023

#SPJ4

50 POINTS IF ANSWERED PLS!!!!
Which angle is the biggest based on the sides of the triangles below? Explain your reasoning.

Answers

Answer:

angle c

Step-by-step explanation:

since the largest angle will be across from the longest side, angle c is the right answer because it is across from the longest side which measures 35 cm.

hope this helps

you are to build a rectangular pen with three parallel partitions using 500 feet of fencing. what dimensions will maximize the total area of the pen?

Answers

The dimensions required are 125 feet and 50 feet.

The derivative of a function of a single variable at a chosen input value, when it exists, is the slope of the tangent line to the graph of the function at that point. The tangent line is the best linear approximation of the function near that input value. For this reason, the derivative is often described as the "instantaneous rate of change", the ratio of the instantaneous change in the dependent variable to that of the independent variable. Derivatives can be generalized to functions of several real variables. In this generalization, the derivative is reinterpreted as a linear transformation whose graph is (after an appropriate translation) the best linear approximation to the graph of the original function. The Jacobian matrix is the matrix that represents this linear transformation with respect to the basis given by the choice of independent and dependent variables.

The total length will be x and the height will be y.

Perimeter = 500 = 2x + 5y

Total Area = A = xy

Solve for y using the equation of perimeter:

5y = 500 - 2x

y = 100 - 2x/5

Put y in the equation of the Area

A = x(100 - 2x/5)

A = -2x²/5 +100x

To find the maximum area, find the derivative:

A' = -4x/5 + 100

To maximise the area, we equate A' to zero.

A' = 0

-4x/5 +100 = 0

∴ x = 125

A'  is positive when x < 125 and A' is negative when x >125, therefore meaning that x=125 is a maximum. Since this value is a maximum, the area is maximized when the total length is 125ft.

Put x = 125 in equation of perimeter:

500 = 2(125) + 5y

500 = 250 + 5y

5y = 250

∴ y = 50 ft

Thus, the dimensions required are 125 feet and 50 feet.

To learn more about dimensions, visit brainly.com/question/28688567

#SPJ4

given a fixed point and a fixed line, a parabola consists of all points that are equidistant to the fixed point and the fixed line. State True or False your answer:
a. True
b. False

Answers

It is true that given a fixed point and a fixed line, a parabola consists of all points that are equidistant to the fixed point and the fixed line.

A parabola is a quadratic function graph .A parabola is a curve equation in which a point on the curve is equidistant from a fixed point and a fixed line.

The fixed point is known as the parabola's focus, and the fixed line is known as the parabola's directrix. It is also worth noting that the fixed point does not lie on the fixed line.

A parabola is a locus of any point that is equidistant from a given point (focus) and a given line (directrix). The parabola is a significant curve of the coordinate geometry's conic sections.

The general equation of a parabola is: y = a(x-h)² + k or x = a(y-k)² +h, where (h,k) denotes the vertex.

The standard equation of a regular parabola is y² = 4ax.

It's true that given a fixed point and a fixed line, a parabola consists of all points that are equidistant to the fixed point and the fixed line.

To know more about Parabola here

https://brainly.com/question/21685473

#SPJ4

Pls Help Got to do this right now!!!
Which expression is the additive inverse of - 13/6?

A) 13/6
B) 6/13
C) - 6/13
D) - 13/6

WILL MARK BRAINLIEST!!

Answers

Option A is correct


Explanation- inverse mean opposite

A new Youth Activity Center is being built in Ook Valley. The perimeter of the rectangular playing field is 272 yards. The length of the field is 8 yards less than double the width. What
are the dimensions of the playing field?

Answers

Answer:

w = 48 and l = 88

Step-by-step explanation:

A new Youth Activity Center is being built in Ook Valley. The perimeter of the rectangular playing field is 272 yards. The length of the field is 8 yards less than double the width. What are the dimensions of the playing field?

P = 2w + 2l

w = w

l = 2w - 8

272 = 2w + 2(2w - 8)

272 = 2w + 4w - 16

272 = 6w - 16

288 = 6w

w = 48

remember that: l = 2w - 8

l = 2w - 8 when w = 48

l = 2(48) - 8

l = 96 - 8

l = 88

CHECK:  w = 48 and l = 88

P = 2w + 2l

272 = 2(48) + 2(88)

272 = 96 + 176

272 = 272

so: w = 48 and l = 88

Your grocery bill before taxe wa $265. 24. You have to pay 7. 3 ale tax. How much i your grocery bill?

Answers

If the grocery bill before tax is $265.24 and you have to pay 7.3% tax, then he has to pay $284.6 for the grocery bill

The amount of the grocery bill before tax = $265.24
The percentage of tax = 7.3%

The amount of tax = The price of the grocery bill before tax × (7.3/100)

Substitute the values in the equation

= 265.24 × (7.3/100)

= 265.24 × 0.073

= $19.36

The final bill including tax = The price of the grocery bill before tax + The amount of tax

Substitute the values in the equation

= 265.24 + 19.36

= $284.6

Therefore, the grocery bill including tax = $284.6

Learn more about tax here

brainly.com/question/12188659

#SPJ4

A cashier gets a $100 bonus for working on a holiday plus $11/h. The total holiday salary is given by the function y = 11x + 100. How will the graph change if the bonus is raised to $150 and the hourly rate is lowered to $10/h? Choose the answers that describe these transformations.



HELP PLEASE

Answers

(50,650) the graph evolve if the hourly rate is reduced to $10/h and the incentive is increased to $150.

Given that,

For working on a holiday, a cashier is given a $100 bonus in addition to $11/h. The equation y = 11x + 100 yields the entire holiday salary.

We have to find how would the graph evolve if the hourly rate is reduced to $10/h and the incentive is increased to $150.

We know that,

We get,

A cashier is given a $100 bonus in addition to $11/h is y=11x+100

The hourly rate is reduced to $10/h and the incentive is increased to $150 is y=10x+150

Now we subtract those two equation

11x+100-10x-150=0

x-50=0

x=50

We get y as y=10x+150

y=10(50)+150

y=500+150

y=650

Therefore, (50,650) the graph evolve if the hourly rate is reduced to $10/h and the incentive is increased to $150.

To learn more about increase visit: https://brainly.com/question/12165844

#SPJ1

Given: ∠BCD is right; BC ≅ DC; DF ≅ BF; FA ≅ FE

Triangles A C D and E C B overlap and intersect at point F. Point B of triangle E C B is on side A C of triangle A C D. Point D of triangle A C D is on side C E of triangle E C D. Line segments B C and C D are congruent. Line segments B F and F D are congruent. Line segments A F and F E are congruent.

Which relationships in the diagram are true? Select three options.

△ACF ≅ △ECF by HL
ΔCBF ≅ ΔCDF by SSS
ΔBFA ≅ ΔDFE by SAS
ΔCFD ≅ ΔEFD by SSS
ΔCBE ≅ ΔCDA by HL
SAS

Answers

The three relationships in the diagram that are true include the following;

B. ΔCBF ≅ ΔCDF by SSS

C. ΔBFA ≅ ΔDFE by SAS

E. ΔCBE ≅ ΔCDA by HL

What is the Right Triangles Similarity Theorem?

In Mathematics, the Right Triangles Similarity Theorem states that when the altitude of a triangle is drawn to the hypotenuse of a right angled triangle, then, the two (2) triangles that are formed would be similar to each other, as well as the original triangle.

Based on the Right Triangles Similarity Theorem, we have the following;

ΔCBF ≅ ΔCDF by side, side, side (SSS).ΔBFA ≅ ΔDFE by side, angle, side (SAS).

What is HL?

In Mathematics, HL is an abbreviation for hypotenuse leg and it can be defined as a theorem which states that if the hypotenuse and one (1) leg in a right-angled triangle are congruent to the hypotenuse and leg of another right-angled triangle, then the two (2) triangles would be congruent.

By applying the hypotenuse leg (HL) theorem across right-angle BCD (∠BCD), we have the following;

ΔCBE ≅ ΔCDA

Read more on a triangle here: brainly.com/question/11544842

#SPJ1

If 8% of a liquid is 56 mL, what is the whole
amount?
Please help

Answers

Answer:

  700 mL

Step-by-step explanation:

You want to know the whole amount if 8% of it is 56 mL.

Relation

The problem statement tells you ...

  8% × whole = 56 mL

Divide by the coefficient ...

  whole = (56 mL)/(0.08) = 700 mL

The whole amount is 700 mL.

What is the value of g(5)-2g(1)

Answers

Answer:

3 grams

Step-by-step explanation:

g(5)-2g(1)

g × 5- 2g(1)

5g - 2g×1

5g - 2g

3g

Other Questions
7What is the solution to the inequalitybelow?5x-10 -3x + 14A. x -3B. x-3C. x 3D. x 3 all of the following are part of the official jurisdiction of the federal courts exceptA. treaties with other nations.B. federal statutes.C. cases involving the U.S. Constitution.D. cases involving citizens from the same state.E. any case in which the U.S. government is party. Which of the following is a benefit of knowing and using organizational skills?Reducing stressIncreasing how long tasks takeReducing efficiencyIncreasing the number of steps in a task micro tek inc. is considering an investment in new equipment that will be used to manufacture a smartphone. the phone is expected to generate additional annual sales of 4,000 units at $450 per unit. the equipment has a cost of $940,000, residual value of $20,000, and an eight-year life. the equipment can only be used to manufacture the phone. the cost to manufacture the phone follows: 61. at 0500 hours, you respond to the home of a 76 year old man complaining of chest pain. upon arrival the patient states that he had been sleeping in the recliner all night due to indigestion, when the pain woke him up. he also tells you he has taken two nitroglycerin tablets. his vital signs are as follows: respirations, 16 breaths/min; pulse, 98 beats/min; blood pressure, 92/76 mm hg. he is still complaining of chest pain. what actions should you take to intervene. The sum of two numbers is 35 if one number is 4 times the second number find the numbers. Write a formal message of condolence using the following Rita Karki - 46 Years - died of cance helpbul, sociable - a leader of the community - active- miss her very The Double V Campaign sought to fight for democracy in Europe and toend racism in the United States.O create a new League of Nations.revert back to the policy of neutrality.O promote a communist government. when the nurse interviews a client with internal hemorrhoids, what would the nurse expect the client to report? find the volumes of the solid(s) Describe how high-energy electrons are ultimately responsible for driving the reactions of photosynthesis. Plot the image of point A under a dilation about point P with a scale factor of 3. Below is a list of inventions that came out during the Industrial Revolution, describe the impactof each oneIndoor plumbingToiletsToilet paper Electricity Cars Trains Radio Steam Engine Dynamite Cameras I have a triangle with c as hypotenuse, b as opposite, and nothing for adjacent. Bottom left corner is 62 degrees and the right bottom corner is 90 degrees. Round answer to nearest 16th of an inch SolvingThe product of 5 and the differencebetween a number and 7 is 75. What isthe number? a pregnant woman in the second trimester of pregnancy complains of constipation and describes the home care measures she is taking to relieve the problem. which would the nurse determine is a harmful measure in preventing constipation? Which statement accurately describes how toproperly use a semicolon to join independentclauses? An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge.