A lorry leave a factory on a journey of 195km at 08 45 , travelling at an average peed of 52 km/h. A) Find the time at which the lorry the time taken arrive at it detination. B) on the return journey, the lorry leave at 14 55 and arrive at the factory at 18 15. Calculatge the time taken and the average peed of the lorry on the return journey

Answers

Answer 1

The time at which the lorry the time taken arrive at it destination is 12.20.

Given :

A lorry leave a factory on a journey of 195km at 08 45 , travelling at an average speed of 52 km/h.

here,

Distance = 195 km

Speed = 52 km/h

we know that ,

speed = distance / time

on cross muliplicating

speed * time = distance

time = distance / speed

substitute the values

time = 195 / 52

= 3.75 hours

destination time = 8.45 + 3.75

= 12.20

Therefore the time at which the lorry the time taken arrive at it destination is 12.20

Learn more about the time here:

https://brainly.com/question/26941752

#SPJ4


Related Questions

Heather saved 15% buying concert tickets online. If the tickets are regularly $95, how much did Heather pay for them online?

Answers

Answer:

Step-by-step explanation:

$80.75 Your welcome

Answer:

$80.75 dollars

Step-by-step explanation:

15% of 95 is 14.25

95 - 14.25 = 80.75

Literal Equations

help asap !!

Answers

Answer: y=13\3 or 4 1\3

Step-by-step explanation:

Lisa paid $46.58 for 16.7 gallons of gasoline. What was the cost per gallon, rounded to the nearest hundredth? It's a 100 points pls

Answers

Answer:

2.8

Step-by-step explanation:

First you need to divide the cost by the number of gallons dollars/number of gallons =cost per gallon

And then round it . I hope it helped

~Describe the transformation, by giving the coordinate rule.
8.) (x,y) --> (________,________)

Answers

Answer:

(x+3, y-3)

Step-by-step explanation:

While hovering near the top of a waterfall in a national park at 5776 feet, a helicopter pilot accidentally drops his sunglasses. The height h(t) of the sunglasses after t second
is given by the polynomial function h(t)=-16t^2+5776. When will the sunglasses hit the ground?

Answers

Answer:

Step-by-step explanation:

set the height function = 0 and solve for t-16t2+6400=0t2 = -6400/(-16)=

Yoko is riding on a bike course that is 70 miles long. So far, she has ridden 42 miles of the course. What percentage of the course has Yoko ridden so far?

Answers

Answer: 60%

Step-by-step explanation:

Take 42 divided by 70, then times 100% = 60%

Yoko has ridden 60% so far!

so i think in conclusion i don’t know the answer to that sorry

SHOW STEPS OF HOW YOU GOT YOUR ANSWER I WILL MARK BRAINLEST
an electronics store makes a profit of 30$ for every portable DVD player sold and 60$ for every DVD recorder sold. the manager’s target is to make at least 250 dollars a day on sales of portable DVD players and DVD recorders write an inequality that represents the number of both kinds of DVD players that can be sold to reach or beat the sales target let p represent the number of portable DVD players and r represent the number of DVD recorders.

Answers

An inequality that represents the number of both kinds of DVD players that can be sold to reach or beat the sales target  is 30p+60r≥250.

What is meant by inequality?

An inequality in mathematics is a comparison between two numbers or other mathematical expressions that is done in an unfair manner. On the number line, it is most typically used to compare the sizes of two numbers.

A and b are not equal in either situation. These interactions are recognized as robust inequalities.

Given,

Profit gained by selling portable DVD player=$30

Profit gained by selling portable DVD recorder=$60

Let,

The number of portable DVD player=p

The number of DVD recorders=r

And also given that,

The profit must be at least $250.

Therefore, 30p+60r≥250

Hence, an inequality that represents the number of both kinds of DVD players that can be sold to reach or beat the sales target  is 30p+60r≥250.

To know more about inequality, visit:

https://brainly.com/question/28823603

#SPJ1

ABSTRACT REASONING In △EFG, the bisector of
∠F intersects the bisector of ∠G at point H. Explain
why FG — must be longer than FH — or HG . —

Answers

1+1=2 plus four that 9 quick maths porkipine alphredo cheese 1+1=2

Which graph represents f of x equals square root of the quantity x plus 3 end quantity minus 2?

Answers

The graph that correctly represents the function f(x) = [√(x + 3)] - 2 is; Graph D

How to interpret the graph of the function?

We are given the function;

f(x) = [√(x + 3)] - 2

Remember that the argument of a square root must be zero or larger, then the minimum of the domain is the value of x such that:

x + 2 = 0

x = -2

Then the function starts at:

f(-2) = [√(-2 + 3)] - 2

f(-2) = 3

Then the graph should start at (-3, 2).

We can also identify another point by evaluating in x = 2.

f(2) = [√(2 + 3)] - 2

f(2) = -1

So the function also passes through (2, - 1).

Notice that the only graph that contains these two points is the last graph with x-intercept at 7.

Read more about Function Graph at; https://brainly.com/question/4025726

#SPJ1

Question in picture. Please answer quickly

Answers

Answer: [tex]\frac{2\sqrt{2}-1 }{2}[/tex]

Step-by-step explanation:

1. multiply both the numerator and denominator by [tex]2\sqrt{2}[/tex]

2. distribute on the top to get [tex]8\sqrt{2} - 4[/tex] ([tex]\sqrt{2} *\sqrt{2}[/tex] equals 2)

3. multiply the bottom to get 8

4. after getting [tex]\frac{8\sqrt{2}-4 }{8}[/tex], factor out a 4 from each term to get [tex]\frac{4(2\sqrt{2}-1)}{4(2)}[/tex]

5. the fours will cancel and the answer will be [tex]\frac{2\sqrt{2}-1 }{2}[/tex]

Create the equation of a parabola with no x-intercepts.

Answers

Answer:

Step-by-step explanation:

No x intercept means it can't touch the x axis y=x^{2}+1 does the trick since it moves the whole thing up one unit

Ruby and her children went into a movie theater and she bought $42 worth of bags of popcorn and drinks. Each bag of popcorn costs $6 and each drink costs $4. She bought a total of 8 bags of popcorn and drinks altogether. Determine the number of bags of popcorn and the number of drinks that Ruby bought.

Answers

Using system of linear equation the number of popcorn and drinks bought are 5 and  3 respectively

System of Linear Equation

In solving a system of linear equation, we have two unknown variables which we are to find. However, we can use either substitution, elimination or graphical method to solve them.

In this case, to solve this problem, we have to write out two equations and solve for the unknown variable;

let;

x = popcorny = drinks

x + y = 8 ...eq(i)

6x + 4y = 42 ...eq(ii)

From eq(i)

x + y = 8

x = 8 - y ...eq(iii)

Put eq(iii) into (ii)

6(8 - y) + 4y = 42

y = 3

put y = 3 into eq(i)

x + 3 = 8

x = 5

Learn more on system of linear equation here;

https://brainly.com/question/13729904

#SPJ1

= -x + 2. Find the remaining vertices
PERSEVERE A quadrilateral in the coordinate plane has exactly two lines of symmetry, y = x-1 and y
of the figure if there is a vertex at (-1,0). Graph the figure and the lines of symmetry on a separate sheet of paper.
List the coordinates of the vertices by starting with the vertex at (-1,0) and moving clockwise around the quadrilateral.

Answers

Answer:

wheres the photo?

Step-by-step explanation:

PLEASE HELP ME!!!!!!!!!!!!!
A state government borrows $2,000,000 at simple annual interest. Some of the money is borrowed at 6%, some at 7.5%, and some at 8.5%. Use a system of linear equations to determine how much (in dollars) is borrowed at each rate given that the total annual interest is $137,000 and the amount borrowed at 7.5% is four times the amount borrowed at 8.5%. Solve the system of linear equations using matrices.

Answers

If the amount borrowed at 7.5% is four times the amount borrowed at 8.5%. The amount borrowed is: $200,000, $800,000, $1,000,000.

How to find the amount borrowed?

Now let find the amount borrowed

Let X+Y+Z = 2000000

0.06X + 0.075Y + 0.085Z = 137000

Y = 4Z

Substituting Y=4Z into the first and second equations:

X + 5Z = 2000000

0.06X + 0.075(4Z) + 0.085Z = 137000

X = 2000000 - 5Z

0.06X + 0.385Z = 137000

0.06(2000000 - 5Z) + 0.385Z = 137000

120000 - 0.3Z +  0.385Z = 137000

0.085Z + 120000 = 137000

0.085Z = 17000

Divide both side by  0.085Z

Z= 17,000/0.085

Z = 200000

So,

Y = 4Z

Y = 800000

X= 200,000 + 800,000

X = 1000000

Hence,

Z = 200000

Y = 800000

X = 1000000

Therefore the amount borrowed is: $200,000, $800,000, $1,000,000.

Learn more about amount borrowed here:https://brainly.com/question/28959940

#SPJ1

A chool taff meeting had 60 teacher in attendance, 30% of whom were firt-year teacher. How many firt-year teacher were in the meeting?

Answers

18 first-year teachers were in the meeting.

In this question, we have been given that a school staff meeting had 60 teachers in attendance, 30% of whom were the first-year teachers.

We need to find the number of first-year teachers present in the meeting.

Let x be the number of first-year teachers present in the meeting.

As 30 percent of school staff are the first-year teachers, we need to find the 30 percent of 60.

Using the formula of percentage,

x = 60 * (30/100)

x = 18

Therefore, the number of first-year teachers present in the meeting = 18

Learn more about percentage here:

https://brainly.com/question/16797504

#SPJ4

X-Y=4
-2X+6(4-X)=3
-8X+24=3
-24 -24
-8X=-21
X=21/8

Y=11/8
(21/8,11/8)
find the error in the problem.

Answers

Answer: You did wrong at Y=11/8! It should be -11/8, not positive 11/8

Step-by-step explanation:

You solved it all right; just the y is wrong! The reason why y is -11/8 is that a negative and a negative will make a positive, and add an x positive, and you will get a positive answer. If y is negative, the answer would be negative!

The purple team is the only team with a clue at the angle that is an alternate exterior angle to ∠11, but not congruent to it. Which angle is this? Explain why the angle is not congruent to ∠11

Answers

What is the alternate exterior angle of ∠11?

[tex]\angle 1 \cong \angle 7 \text { and } \angle 4 \cong \angle 6[/tex]

The number of sides in the given polygon is, n=11 . The sum of all exterior angles is 360o .

An exterior angle of a triangle is created by extending one side of the triangle. The angle between the extended side and the side next to it is called an exterior angle.

What is a alternate exterior?

Alternate Exterior Angles: The pair of angles on the outside of the two parallel lines but on the other side of the transversal are known as alternate exterior angles.

Look at the area above and below the crossed lines to find outside angles. Look at that outside area for each crossed line on different sides of the transversal to locate alternative outside angles. We assume you stated that the external angles are 1, 2, 7, and 8.

When a transversal connects two coplanar lines, alternate interior angles are created. They are located on the transverse sides of the parallel lines, but on the inner side of the parallel lines. At two different locations, the transversal passes through the two lines that are coplanar.

To learn more about alternate exterior visit:

#SPJ4

https://brainly.com/question/2279752

Rebecca ran 12 1/4 miles in 2 1/2 hour. What was her average speed in miles per hour?
a. 4.9 mph
c. 30.625 mph
b. 4.8 mph
d. 5.5 mph

Answers

Answer: A

Step-by-step explanation: Divide your miles by hour hours:

12.25/2.5 = 4.9

Her average speed was 4.9 miles per hour

find the probability for the experiment of drawing two marbles (without replacement) from a bag containing three green, three yellow, and four red marbles.

Answers

The probability for the experiment of drawing two marbles (without replacement) from a bag containing three green, three yellow, and four red marbles =  0.0111

In this question we need to find the probability for the experiment of drawing two marbles (without replacement) from a bag containing three green, three yellow, and four red marbles.

Total marbles in tha bag

= 3 green marbles + 3 yellow marbles + 4 red marbles

= 10 marbles

the probability of drawing one marble from a bag,

P1 = 1/10

Now there are 9 marbles in the bag.

So, the probability of drawing second marble would be,

P2 = 1/9

So, the required probability of drawing two marbles (without replacement) from a bag would be,

P = P1 * P2

P = 1/10 * 1/9

P = 1/90

P = 0.0111

Therefore, the probability of drawing two marbles (without replacement) from a bag = 0.0111

Learn more about the probability here:

https://brainly.com/question/15124899

#SPJ4

Diego’s family car holds 14 gallons of fuel. Each day the car uses 0. 6 gallons of fuel. A warning light comes on when the remaining fuel is 1. 5 gallons or less.


Diego says the expression 14-0. 6t helps him understand this situation. In this situation, what does this expression represent, and what does the variable t stand for?

Answers

In the given expression  14 - 0.6t, variable t represents the number of gallons of fuel used by the car each day.

Explain the term variable of the equation?A term which includes at least one variable number, symbolized by one or maybe more letters, in an arithmetic operation, equation, or inequality. A symbol (often a letter) used in mathematics to represent an unknowable numerical value in such an equation or algebraic statement. A variable can be defined as a quantity that is changeable and not fixed. Variables are crucial since they make up a significant portion of algebra.

For teh stated question-

The gasoline capacity of Diego's family automobile is 14 gallons. The automobile takes 0. 6 gallons of fuel every day. In the event that there are only 1.5 gallons of fuel left, a warning light will turn on.

In the given expression  14 - 0.6t, t represents the number of gallons of fuel used by the car each day.

To know more about the variable of the equation, here

https://brainly.com/question/27875513

#SPJ4

Please tell me what I should shade in!

Answers

Answer:

Hope this helps : )

You should shade in 1 whole rectangle on the the bottom left corner and the top half of the second rectangle the bottom right corner.

Step-by-step explanation:

This is because 1 1/2 is one whole rectangle and half of another rectangle. However, in this case the second rectangle on the bottom right corner is split into sixths. So half of it is 3/6 which is equal to 1/2.

F(x)=2x+7 and g(x)=3x^2+2

Answers

Answer:

The answer for f(g(3)) is 65.

Steven’ new cell phone plan charge a flat monthly fee of $24. The plan allow an unlimited number of text meage, but each minute (m) ued for phone call cot $0. 15. Which equation mot accurately repreent the monthly cot (c) of Steven’ phone bill baed on how many minute talked?

Answers

As a new cell phone plan charges a flat monthly fee of $24 and allows for an unlimited number of text messages, but charges $0.15 per minute (m) used for phone calls, the equation that will represent the problem is C=24+0.15m.

What is equation?

The definition of an equation in algebra is a mathematical statement that demonstrates the equality of two mathematical expressions. For instance, the equation 3x + 5 = 14 consists of the two equations 3x + 5 and 14, which are separated by the 'equal' sign.

Here,

Let m be the minutes talked on phone,

C=24+0.15m

The problem is represented by the equation C=24+0.15m since the new cell phone plan charges a fixed monthly fee of $24 and permits unlimited text messages, but each minute (m) utilized for phone calls costs $0. 15.

To know more about equation,

https://brainly.com/question/649785

#SPJ4

Why doe the Ditributive property make it eaier to multiply a 2 digit number the a 1 digit number

Answers

Distributive property make it easier to multiply a 2 digit number t0 a 1 digit number because by using distributive property we can multiply the number place of the two digit number by one digit number and inlast we can add it , which makes the whole process easier.

According to Distributive property it helps to solve the complex problems easily either they are of 2 digit or many more . Distributive property multiplying the sum of two or more addends by a number will give the same result as multiplying each addend individually by the number and then adding the products together.

In other words, according to the distributive property, an expression of the form A (B+C) can be solved as A (B+ C) = AB + AC.

This property applies to subtraction as well.

A (B –C) = AB – AC

For example :- 19 X 6

= 10 X 6 + 9 X 6

= 60 + 54

= 114

To know more about Distributive property

https://brainly.com/question/29496254

#SPJ4

the given set is a basis for a subspace w. use the​ gram-schmidt process to produce an orthogonal basis for w.

Answers

The orthogonal basis produced using the Gram-Schmidt process for W is[tex]y_1=\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right], y_2=\left[\begin{array}{c}5 \\1 \\-6 \\-1\end{array}\right][/tex]

What is orthogonal ?

The concept of orthogonality in mathematics is an extension of perpendicularity in geometry. By extension, the term "orthogonality" is also used to describe the division of particular system properties. The phrase also has specific applications in other disciplines, such as chemistry and painting.

[tex]$$x_1=\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right] \quad \text { and } \quad x_2=\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]$$[/tex]

Using Gram-Schmidt process to produce an orthogonal basis for W

[tex]$$y_1=x_1=\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right]$$[/tex]

Now we know [tex]$X_1, X_2$[/tex] and [tex]$Y_1$[/tex]

Lets solve for [tex]$Y_2$[/tex]

[tex]y_2=x_2-\frac{x_2+y_1}{y_1+y_1} y_1$$[/tex]

[tex]y_2=\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]-\frac{\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right]}{\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right]\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right]}\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right][/tex]

[tex]\begin{aligned}y_2 & =\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]-\frac{7+28-0+1}{1+16+0+1}\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right] \\& =\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]-\frac{36}{18}\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right]\end{aligned}[/tex]

[tex]\begin{aligned}& =\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]-2\left[\begin{array}{c}1 \\-4 \\0 \\1\end{array}\right] \\& =\left[\begin{array}{c}7 \\-7 \\-6 \\1\end{array}\right]-\left[\begin{array}{c}2 \\-8 \\0 \\2\end{array}\right] \\y_2 & =\left[\begin{array}{c}5 \\1 \\-6 \\-1\end{array}\right]\end{aligned}[/tex]

Complete question: The set is a basis for a subspace W. Use the Gram-Schmidt process to produce an orthogonal basis for W. Assume the vectors are in the order bold x1 and bold x2

1 7

-4 -7

0 -6

1 1

The orthogonal basis produced using the Gram-Schmidt process for W is:__________. (Use a comma to separate vectors as needed.)

To learn more about orthogonal  visit:https://brainly.com/question/2292926

#SPJ4

Solve
(type and ordered pair. type an exact answer, using radicals and i as needed, use a comma to separate answers as needed)

Answers

Two ordered pairs 45 is x^2 + y^2, 12 is x - y.An ordered pair is made up of the x (abscissa) and y (ordinate) coordinates, with two values stated in a certain order inside parenthesis.

An ordered pair can be found in what way?A pair of ordered numbers contains one point's coordinates in the coordinate system. Using its ordered pair in the form of, a point is given a name (x, y). X and Y coordinates are represented by the first and second numbers, respectively. Using the coordinates of the ordered pair, you can graph a point by placing a dot there.An ordered pair is made up of the x (abscissa) and y (ordinate) coordinates, with two values stated in a certain order inside parenthesis.Think about the following two ordered pairs: (c, d). If (a, b) = and (a, b) = (c, d), they are equivalent (c, d).

Explanation:

45 = x^2 + y^2,

12 = x - y.

To learn more about Ordered pair refer to:

https://brainly.com/question/11139505

#SPJ1

Which word sentence represents the equation?



4y = y + 9



Responses

Four times a number plus 9 is 9.
Four times a number plus 9 is 9.

Four times a number equals the number increased by 9.
Four times a number equals the number increased by 9.

Four increased by a number equals the number increased by 9.
Four increased by a number equals the number increased by 9.

Four times the sum of a number and 9 is the number.

Answers

the answer is “four times a number equals the number increased by 9”

PLEASE HELP!! WILL GIVE BRAINLIEST AND 25 POINTS!!

Solve for x. Round your answer to the nearest tenth.

A. 12

B. 14.4

C. 15.0

Answers

Answer: its is 12

Step-by-step explanation:

Find the area of the rhombus.
5m,10m,5m, and 10m
Please show your work.

Answers

The area of rhombus is 100m²

What is rhombus ?

A rhombus is a quadrilateral with four equal-length sides in planar Euclidean geometry. The term "equilateral quadrilateral" refers to a quadrilateral whose sides all have equal lengths.

A parallelogram is a particular instance of a rhombus. The opposing sides and angles in a rhombus are parallel and equal. A rhombus also has equal-length sides on each side, and its diagonals meet at right angles to form its shape. The rhombus is also referred to as a diamond or rhombus.

A quadrilateral with four equal sides that has the shape of a diamond is called a rhombus. In everyday life, rhombus-shaped objects can be seen. In the illustration below, two instances of rhombuses in nature are shown: a diamond and a kite.

The area of rhombus is

A = pq / 2

The  value of p is 10 and q is 20

A = (10 * 20) / 2

  = 100m²

To learn more about rhombus from the given link  

https://brainly.com/question/88523

#SPJ1

Use compatible numbers to estimate the correct quotient.

Answers

Answer:

60

Step-by-step explanation:

900 divided by 15 is 60

Other Questions
An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D For the following data set, calculate the percentage of data points that fall within one standard deviation of the mean and compare the result to the expected percentage of a normal distribution.{8, 12, 27, 32, 45, 57, 61, 73, 82, 94} Literal Equations help asap !! Which statement best evaluates this response to the writing prompt?Prompt:Write an essay for your history teacher. In this essay, Identify what you believe is the most important reason the American Revolutionary War was fought. Support your claim with reasons and evidence.-Associated Passage:The revolutionary War period was a dark and difficult time for the United States. The war was violent. It was expensive. Independence was never certain. Still, I believe it was the right decision to fight it.A. It is weak because it does not discuss the reasons for war B. It Is strong because it suggests its position rather than stating it directly C. It Is strong because the author uses his or her personal voice D. It Is weak because its language is not appropriate for a teacher when assessing a client, what finding would the nurse interpret as indicating stimulation of the parasympathetic nervous system? (select all that apply.) How did the role of the Interstate Commerce Commission change by 1920? Which of the following choices best reflects the interrelationships of the four categories of balanced Scorecard performance measures? A) Learning and growth Customer Internal business process FinancialB) Learning and growth Internal business process Financial CustomerC) Financial Learning and growth Internal business process Customer D) Learning and growth Internal business process Customer Financial Multiple choiceA. Choice B B. Choice D C. Choice C D. Choice A What are the "posterior poles of the eyes"? The more predictable policy decisions by the Federal Reserve are, the more effective they are in the long run. A surveyor is 980 feet from the base of the world's tallest fountain at Fountain Hills, Arizona. The angle of elevation to the top of the column of water is 29.7 degrees. His angle measuring device is at the same level as the base of the fountain. Find the height of the column of water to the nearest 10 feet. x can be 1,2,3,4If x = 1, x?=-150If x = 2, x?=-50If x = 3, x?=50If x = 4, x?=150(x? Has to be the same in all questions)