a food web cascade occurs when one species has an indirect effect on species at a different level of the energy pyramid (true or false).

Answers

Answer 1

FALSE. Whenever one species has had an indirect impact on species at a nother scale of the energy pyramid, this is known as a food web cascade.

The ecological phenomenon known as trophic cascade, which involves reciprocal shifts in the relative populaces of predator and prey along a food chain, is triggered by the addition or deletion of top predators. This phenomena typically has significant consequences on the structure of ecosystems and the cycling of nutrients. But extinction seems likely to happen if environmental conditions shift too quickly for a species to adapt so if individuals from such a species lack the traits required to survive in a new environment. Whenever one species has had an indirect impact on species at a nother scale of the energy pyramid, this is known as a food web cascade.A mutation is a modification that occurs in the sequence of our DNA as a consequence of errors made during DNA replication or environmental influences like UV radiation and cigarette smoke.

Learn more about species

https://brainly.com/question/13259455

#SPJ4


Related Questions

Selected species have a short life span an early reproduction cycle

Answers

Answer:

True

Explanation:

An example of this would be the mayfly. They have a very short lifestyle and only live for 24 hours, there are some lucky ones that get to live for 2 days. The image below helps support this statement to be true.

Carbon, hydrogen, oxygen, and nitrogen can combine to form monomers
called amino acids. Which type of macromolecule is made up of monomers
that are amino acids?
A. Lipid
OB. Nucleic acid
O C. Protein
D. Carbohydrate

Answers

Answer:

C. Protein

Amino acids are the simplest form of protein

The density of most prey species is independent of predation levels and is influenced to a greater extent by competition with other species.

Answers

False, the density of most prey species is independent of predation levels and is influenced to a greater extent by competition with other species.

Predation occurs when one organism kills and consumes another. Predation supplies energy to the organism that kills, the predator, and promotes reproduction at the expense of the organism being consumed, the prey. Predation has an impact on species at two ecological levels.

Predation is a biological relationship in which one creature, the predator, kills and consumes another, the prey. It is one of several common feeding behaviors, including parasitism, micropredation, and parasitoidism.

Relationships between predators and prey include the lion and zebra, the bear and fish, and the fox and rabbit.

To know more about predation visit

https://brainly.com/question/28871161

#SPJ4

2. Refer to the illustration above. The process shown is
a. mitosis.
c. meiosis.
b.
d. dominance.

Answers

The process in the task given in the illustration above is mitosis.

The correct answer choice is option a.

What is meant by mitosis?

Mitosis can simply be defined as a special type of cell and nuclear division which is concerned with the parent nucleus of a cell division to form two different daughter cells which has the same number of chromosomes as the parent nucleus too.

From the task given above, it is clearly given there that parents nucleus undergoes different phases of cell division to produce two daughter cells which are exactly like the parents nucleus.

In conclusion, we can now confirm from the above explanation that mitosis is a type of cell division .

The complete image is illustration attached.

Read more on mitosis:

https://brainly.com/question/13702483

#SPJ1

Why are mutations a source
of heritable variation?
A. Mutations are always neutral and
therefore don't contribute to
variations.
B. It creates changes in the DNA of an
individual that can be passed on. This is the answer
C. They cause a gamete to die due to a
change in DNA.
D. They cause changes to occur in the
environment around a species.

Answers

Answer:

B

Explanation:

Why are mutations a source of heritable variation? Mutations are changes in the DNA. A single mutation can have a large effect but in many cases evolutionary change is based on the accumulation of many mutations.

all of the following are examples of natural selection except multiple choice the distribution of dark and light colored peppered moths in britain. a rise in bacterial resistance to antibiotics. the reduction in beak length of scarlet honeycreepers when they changed food sources. the 150 breeds of dogs developed from ancestral wolves. two of these are not examples of natural selection.

Answers

Developing 150 breeds of dogs from ancestral wolves is not an example of natural selection.

The process through which populations of living things adapt and change is known as natural selection. A population's members are naturally varied, which means that they are all distinctive in some ways. This variety indicates that some people have characteristics that are more environment-appropriate than others. People that possess advantageous qualities, or adapted traits, are more likely to live and procreate. The adaptable qualities are subsequently passed on to the next generation by these people. These beneficial characteristics spread across the population over time. Favorable features are passed down across generations as a result of natural selection. Natural selection may result in speciation, the process by which one species gives rise to another that is utterly separate.

Hence, survival of the fittest species take among population.

To know more about Traits.

https://brainly.com/question/24886772

#SPJ4

During his experiments with pea plants, Mendel referred to the trait that was expressed in the F1 or first filial generation as
A. recessive.
B. dominant.
C. codominant.
D. independent.
E. homozygous.

Answers

Answer: dominant

Explanation:Becuae the trait was present in all of the P1 generation

A. higher Crude Death Rate
C. higher life expectancy
According to the
United Nations, which
of the following is NOT
a characteristic of
DEVELOPED nations?
B. lower Total Fertility Rate
D. lower Crude Birth Rate

Answers

According to the United Nations, the following which is not a characteristic of developed nations include the following below:

Higher life expectancyLower Total Fertility RateLower Crude Birth Rate.

What is a Developed nation?

This is referred to as a nation which has a high quality of life, developed economy and advanced technological infrastructures when compared to other countries in the word.

Developed countries tend to have a lower fertility rate due to lifestyle choices such as what they eat and also a high prevalence of smoking and other vices.

The low fertility rate results in the lower crude birth rate which is common with such nations.They however have a higher life expectancy due to their excellent medical services and safe environment.

Read more about Developed nations here https://brainly.com/question/28375410

#SPJ1

DNA sequence of the gene encoding the flagellum protein in three different organisms was found to be (in part):ATG-GGC-GTA-GCT-TACATG-GGA-GTA-GCT-TACATG-GGT-GTA-GCT-TACThis represents a ______.O single nucleotide polymorphismfO rameshift mutationO deletion mutationO DNA sequencing errorAnswer: single nucleotide polymorphism

Answers

The given DNA encoding represents single nucleotide polymorphism.

What is polymorphism ?

One of the fundamental ideas of object-oriented programming (OOP), polymorphism addresses circumstances where something happens in a variety of ways. It refers to the idea in computer science that you can access objects of many types through the same interface.

A single nucleotide (adenine, thymine, cytosine, or guanine) change in the genome's sequence that affects at least 1% of the population is referred to as a DNA sequence variation.

Single Nucleotide Polymorphism are most frequently discovered in the DNA between genes. They can serve as biological markers, guiding researchers to genes linked to disease.

To know more about DNA you may visit the link:

https://brainly.com/question/264225

#SPJ4

11. What would happen if a mutation occurred but it still coded for the correct amino acid?

Answers

Answer: If a mutation occurred in a DNA sequence but it still coded for the correct amino acid, the overall function of the protein that the gene encodes would likely not be affected.

Explanation: This is because the genetic code is redundant, meaning that multiple different DNA sequences can code for the same amino acid. However, it is also possible that the mutation could affect the function of the protein in other ways, such as by changing its structure or the way it interacts with other molecules. It's also worth noting that not all mutations have a significant effect on the organism, and some may even be beneficial.

A frog cell normally has 26 chromosomes. How many chromosomes will each daughter cell have after mitosis?


13


26


46


52

Answers

Answer:

26 chromosomes.

Explanation:

Mitosis is basically cell division. Each of the resulting daughter cells would have the same number of chromosomes at the end as the original one.

Answer:

26

Explanation:

In mitosis the daughter cell will have the same number of chromosomes as the parent cell, which is usually the diploid number. mitosis occurs for all other body cells. in this case the parent has 26 so the 2 daughter cells also have 26 chromosomes each.

in meiosis the daughter cells will have the haploid number or half the number of chromosomes than the parent cell. that means since the parent has 26 chromosomes, the 4 daughter cells will have 13 chromosomes each. meiosis occurs only for sex cells/gametes

.What germ layers ‘sandwich’ the body cavity in coelomates?

Answers

Answer:

In coelomates, the body cavity is surrounded by two germ layers: the mesoderm and the endoderm. The mesoderm is the middle germ layer, and it gives rise to the muscles, bones, blood, and other connective tissues. The endoderm is the innermost germ layer, and it gives rise to the lining of the digestive and respiratory systems. Together, these two germ layers form a "sandwich" around the body cavity, with the mesoderm on the outside and the endoderm on the inside.

Explanation:

the long length, circular folds, villi, and microvilli of the small intestine offer a large surface area for absorption of ingested materials.

Answers

The intestines' circular folds provide a larger surface area for absorption while also slowing the movement of partially digested food down the intestines.

Villi, which resemble little fingers, cover their surface (singular, villus). Microvilli are found on each villus in turn.The majority of the circular mucous membrane folds in the small intestine extend transversely around the organ's cylinder for around one-half to two-thirds of its circumference. Some of them create full circles. Others move in a spiralling pattern. The latter typically wrap twice, sometimes sporadically three or four times, around the bowel.

About 1 cm are the biggest folds. its widest point; nevertheless, the greater majority are smaller. Alternating between the larger and smaller folds.

To know more about intestines

https://brainly.com/question/11459308

#SPJ4

Most of the energy released in citric acid cycle reactions is conserved in ________.

Answers

Answer:

NADH

Explanation:

what are protists, bacteria, and viruses and how we can see them? Which contains a nucleus

Answers

Answer:Unlike bacteria, protists' cells are eukaryotic. These organisms have a membrane-bound nucleus and other membrane-bound structures in their cytoplasm. Protists are a diverse group that includes organisms with funguslike, animallike, or plantlike characteristics.

Explanation:pls mark me as brainleast

how are the functions of vacuoles and lysosomes different

Answers

vacuole is to maintain the osmotic or turgor pressure of the cell

The transport of glucose into some cells requires the presence of an electrochemical gradient of Na + ions. In this circumstance, glucose molecules are carried into the cell by___O facilitated diffusion by an antiporter O facilitated diffusion by a symporter O secondary active transport by an antiporter O secondary active transport by a symporter O ATP hydrolysis by the Na + /K + pump

Answers

A symporter transports one glucose and two sodium ions from the cavity of the small intestine into the absorptive cells of the villi.

What is antiport secondary active transport?In secondary active transport, the electrochemical potential difference is created by pumping ions in or out of the cell. There is no coupling of ATP. The downhill movement of one solute from high to low concentration to move another molecule along with it is called symport. Symport is one of the form of secondary active transport. The example of symport is the co-transports one glucose molecule into the cell for every two sodium ions it imports into the cell. This symporter is located in the small intestine epithelial cells, trachea, heart, brain, testis.Glucose is a monosaccharide, one of the digestion products of carbohydrates. Glucose is a polar molecule and can not diffuse through the hydrophobic core of the cell membrane of absorptive cells of the small intestine.Since both Na+ and glucose are transported in the same direction, it is a symport. Here, the energy of the ionic concentration gradient of Na+ serves as a source of energy for glucose transport, the process of glucose transport is secondary active transport.

To learn more about ATP hydrolysis refer to:

https://brainly.com/question/12868948

#SPJ4

match the types of receptors or terms with the most appropriate descriptions or functions. use each answer only once.

Answers

The sorts of receptors or terminology with the most relevant descriptions or functions serve as the stimulus action site.

What does a stimulus mean in biology?

Whatever can cause a bodily or behavioral change is referred to as a stimulus. Stimuli is a plural form of stimulus. Both external and internal stimuli are possible. Your body's response to medication is an illustration of an external stimulus. Your vital signs altering as a result of a change in your body is an illustration of an internal stimulus.

What is an illustration of a stimulus-response?

Example of a stimulus or a reaction: You immediately remove your hand from anything that is hot if you contact it by accident. Withdrawing your hand in response to the stimulus—the heat of a hot object—is your body's reaction.

To now more about stimulus visit:

https://brainly.com/question/1747649

#SPJ4

which of the following is a normal physiologic change that occurs in the mother's respiratory system during pregnancy?

Answers

The option that is a normal physiologic change that occurs in the mother's respiratory system during pregnancy is option  B) increased respiratory rate and decreased respiratory reserve

What are the physiological changes to the respiratory system during pregnancy?

Although there is no change in the respiratory rate during pregnancy, the TV is turned up, which increases minute ventilation and causes the respiratory alkalosis.

Pregnancy causes a number of physiological changes in the mother, such as an increase in fat and total body water, a decrease in plasma protein concentrations, particularly albumin, an increase in blood volume, cardiac output, blood flow to the kidneys, and the uteroplacental unit, as well as a decrease in blood pressure

In conclusion, increased minute ventilation brought on by enhanced respiratory center sensitivity and drive, compensatory respiratory alkalosis, and limited expiratory reserve capacity are the main physiologic changes that happen during pregnancy.

Learn more about respiratory system from

https://brainly.com/question/1270124
#SPJ1

See full question below

Which of the following is a normal physiologic change that occurs in the mother's respiratory system during pregnancy?

A) decreased respiratory rate and increased minute volume

B) increased respiratory rate and decreased respiratory reserve

C) increased respiratory reserve and decreased oxygen demand

D) increased respiratory depth and decreased respiratory rate

what kind of effect can a chromosonal change have on an organism?

Answers

Answer:

Changes that affect the structure of chromosomes can cause problems with growth, development, and function of the body's systems. These changes can affect many genes along the chromosome and disrupt the proteins made from those genes.

Most changes are negative, aneuploidy is when there is an abnormal number of chromosomes, either due to a deletion or addition of a chromosome. Down syndrome is the result of an extra chromosome #21. Turner syndrome impacts females where they only have one X chromosome, resulting in a number of health concerns

Determine the DNA fingerprint for the the victim and three suspects by cutting the DNA with the restriction
enzyme, Not1. Not1 recognizes the following sequence- GGGCCC and cuts at G/C. Which suspect is most likely
guilty of the murder?

A) Provide the fragment sizes for each of the DNA fingerprints: Victim, Suspect 1, Suspect 2, and Suspect 3.
B) Determine which Suspect is guilty of murder.

Answers

Answer: Suspect 1 is the Most Likely Murderer

Explanation:

Refer to photo for question A.

Which of the following statements are true of Moons in our solar system?
a. are spherical
b. Made of Gas
c. Orbit planets, dwarf planets and even some asteroids in out solar system
d. Made of ice or rock

Answers

Answer:

Option (C)

Explanation:

Moons – also known as natural satellites – orbit planets and asteroids in our solar system. Earth has one moon, and there are more than 200 moons in our solar system. Most of the major planets – all except Mercury and Venus – have moons.

Answer:

c

Explanation:

it just made more sense then the others

Which is an example
of a behavioral
adaptation in
emperor penguins?
A. controlling their heart rates to slow down to use less
oxygen and go longer without food
B. huddling together in the winter and rotating to keep
warm this is the answer
C. the coloring of their bodies to camouflage in the water

Answers

An example of behavioral adaptation in emperor penguins is huddling together in the winter and rotating to keep warm (option B).

What is behavioral adaptation?

Adaptation in biology is the process of change that an organism undergoes to be better suited to its environment.

Adaptation can be any of the following types:

Behavioural adaptation: These are responses made by an organism that help it to survive/reproduce in its environment. Physiological adaptation: This is a body process that helps an organism to survive/reproduce. Structural adaptation: This is a feature of an organism’s body that helps it to survive/reproduce

Therefore, the huddling together of emperor penguins in the winter is an example of a behavioral adaptation.

Learn more about behavioral adaptation at: https://brainly.com/question/22909098

#SPJ1

What kind of crystal structure is quartz?


cubic


hexagonal


monoclinic


orthorhombic

Answers

Answer:

B : hexagonal

explanation:

it is on the interent

For organotrophic and lithotrophic microbes, the two sources of electrons available for organisms are reduced organic compounds and ____

Answers

For organotrophic and lithotrophic microbes the two sources of electrons available for organisms are reduced organic compounds and reduced inorganic compounds.

Chemolithotrophs use various inorganic compounds as electron donors. The most common ones are hydrogen gas, sulfur compounds nitrogen compounds, and ferrous iron. It produces energy-reduced electron carriers and precursor molecules for cellular metabolism.

The most common terminal electron acceptors used during anaerobic respiration are nitrate and carbon dioxide, but metals and some organic molecules are also reduced. In anaerobic environments sulfates act as terminal electron acceptors and are reduced to sulfides leading to both the formation of metal sulfides in sediments and the evolution of hydrogen sulfide gas.

Learn more about Organotrophic here:- https://brainly.com/question/2622341

#SPJ4

The inheritance pattern for an autosomal dominant trait is shown in the pedigree. Shaded symbols represent individuals that express the dominant trait. (If the individual is not shaded, they carry the homozygous recessive trait of "aa".)

Answers

Based on this pedigree, the most likely genotypes of individuals I-1 and I-2 will be C. I-1: Aa I-2: aa.

What are genotypes?

The type of variant present at a specific locus (i.e., location) in the genome is scored by what is known as a genotype. Symbols may be used to represent it.

An organism's genotype is made up of all of its genetic components.

The alleles or variations that an individual carries in a specific gene or genetic location are also referred to as the genotype. Based on the information, it should be noted that the correct option is C.

Learn more about genotype on:

https://brainly.com/question/1626661

#SPJ1

The inheritance pattern for an autosomal dominant trait is shown in the pedigree. Shaded symbols represent individuals that express the dominant trait. Based on this pedigree, what are the most likely genotypes of individuals I-1 and I-2? I-1: aa I-2: Aa I-1: AA I-2: Aa I-1: Aa I-2: aa I-1: aa I-2: AA

Pond water can contain many types of organisms. Which of the following are you most likely to find in a pond water sample? Please select all that apply.bacteriaalgaerotifersprotozoa

Answers

You are most likely to detect bacteria, algae, rotifers, and protozoa in pond water samples.

Ponds frequently harbor the species Euglena, Paramecium, amoebas, & ciliates. Every drops of pond water has a hidden universe full of a remarkable variety of tiny life. Simple life forms like bacteria, powerful oxygen providers like algae, various protozoans that resemble aliens, and adorable tiny creatures like water bears may all be found. It is beneficial to study the macroscopic morphological characteristics of bacteria, fungus, algae, and protozoa while the specimen is dyed and illuminated. First, use an eye dropper to suck up a little bit of the water from the container. The water should then be cautiously released onto such a microscope slide. Use a sliding glass slide to cover the slide once water has been added to it.

Learn more about bacteria

https://brainly.com/question/8008968

#SPJ4

Is the vesica urinaria superior or inferior to the prostate?

Answers

The answer is superior

Territories are typically used for activities such as
A) feeding, mating, and rearing young.
B) migration and feeding.
C) identification of kin and rearing young.
D) feeding and identification of kin.

Answers

Territories are typically used for activities such as : feeding, mating, and rearing young.

A 'territory' is any defended area, and often these birds are territorial (mostly in the context that they safeguard some area, even if it is just a nest spot) for at least part of the year. The upside or advantage of protecting a territory is that the 'owner' has access to an asset or more of a resource (or access to an improved quality resource) than they otherwise would have.

Territories can be classified according to the resource (or resources) being defended:

Type A territory, or mating, nesting, and feeding territory is a zone in which all activities take place (such as courtship, mating, nesting, & foraging). It also known as a "all-purpose territory", the kind of territory that many songbirds defend

Type B, also known as mating and nesting territory. All breeding activities take place here, but most foraging takes place elsewhere. This type of territory is the one that male Red-winged Blackbirds defend

For more information on Territories , visit :

https://brainly.com/question/5021430

#SPJ4

Biosocial theorists believe that there is an interaction between biology and social factors in the development of gender identity and gender roles. In the case of David Reimer, Dr. Milton Diamond believed that psychosocial factors were most important, where as Dr. John Money believed biological factors were important.

Answers

The fundamental principle behind DBT's biosocial approach clarifies how symptoms manifest and problems endure, not just in cases of borderline personality disorder but also in a wide spectrum of other psychopathologies.

A disorder is a group of problems that seriously interfere with a person's ability to go about their daily lives and cause them difficulty, distress, impairment, and suffering. Obsessive-Compulsive According to the Oxford English Dictionary's definition of a disorder, which is an ailment that impairs regular physiological or mental function, disorder fulfils the description of a sickness. In more detail, disorders are physical or mental conditions that affect how daily activities and life function normally. They could take up a lot of time and disrupt a person's normal routine.  The flexible nature of diseases makes it possible that they are not always visible in every context, and what may have an effect on one individual in a condition may not have as big of an effect on another. The term "disorder" is therefore extremely ambiguous and arbitrary.

To know more about disease here:                                                                  https://brainly.com/question/943439

#SPJ4                                

Other Questions
An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D For the following data set, calculate the percentage of data points that fall within one standard deviation of the mean and compare the result to the expected percentage of a normal distribution.{8, 12, 27, 32, 45, 57, 61, 73, 82, 94} Literal Equations help asap !! Which statement best evaluates this response to the writing prompt?Prompt:Write an essay for your history teacher. In this essay, Identify what you believe is the most important reason the American Revolutionary War was fought. Support your claim with reasons and evidence.-Associated Passage:The revolutionary War period was a dark and difficult time for the United States. The war was violent. It was expensive. Independence was never certain. Still, I believe it was the right decision to fight it.A. It is weak because it does not discuss the reasons for war B. It Is strong because it suggests its position rather than stating it directly C. It Is strong because the author uses his or her personal voice D. It Is weak because its language is not appropriate for a teacher when assessing a client, what finding would the nurse interpret as indicating stimulation of the parasympathetic nervous system? (select all that apply.) How did the role of the Interstate Commerce Commission change by 1920? Which of the following choices best reflects the interrelationships of the four categories of balanced Scorecard performance measures? A) Learning and growth Customer Internal business process FinancialB) Learning and growth Internal business process Financial CustomerC) Financial Learning and growth Internal business process Customer D) Learning and growth Internal business process Customer Financial Multiple choiceA. Choice B B. Choice D C. Choice C D. Choice A What are the "posterior poles of the eyes"? The more predictable policy decisions by the Federal Reserve are, the more effective they are in the long run. A surveyor is 980 feet from the base of the world's tallest fountain at Fountain Hills, Arizona. The angle of elevation to the top of the column of water is 29.7 degrees. His angle measuring device is at the same level as the base of the fountain. Find the height of the column of water to the nearest 10 feet. x can be 1,2,3,4If x = 1, x?=-150If x = 2, x?=-50If x = 3, x?=50If x = 4, x?=150(x? Has to be the same in all questions)