You can sound friendlier and more confident on the phone by

Select one:
a. Talking louder
b. Practicing your tone of voice in a recorder
c. Smiling and sitting up straight
d. Pretending you’re talking to a friend

Answers

Answer 1
C cause thats the best answer
Answer 2
C is the answer to the question

Related Questions

A person convicted of a crime can eventually be released with supervision) before the end of his or her sentence. This is known as
es »)
A)
amnesty
B)
bail
pardon.
D)
parole

Answers

Answer:

D

Explanation:

Please help

TAILGATING OTHER DRIVERS:

A. Cannot result in a traffic citation

B. Can frustrate other drivers and make them angry

C. Reduces accidents by preventing you from being cut off

Answers

The answer is B. Can frustrate other drivers and make them angry

HELP!! MY FBI LOVERS.. Make up your own crime scene here are the directions "I need you to tell me about a crime scene, one that you make up. I need it to be a short story, giving me a suspect, a victim, what type of crime scene it is and what evidence you have that was left at the scene and what would tie your suspect to the scene. This is due by Monday. This is a daily grade"

Answers

It was a dark and misty night... I was on the search for a bountey hunter... I needed a K9, and a partner.. I found out that Patty Mayo could help me. So we both followed a blue truck their. WE thought it was sus because it was driving super duper fast. So the driver of the blue truck got out and RAN. he RAN as fast as he could. We ended up getting him, he was the guy I was look for... he has a 1,000,000$ Bond.

The end :)

(I might be late but eh it was fun to write)

first aid basics - assessment

Answers

1. C, 2. C, 3. A, 5. C
These are all the answers I know. Sorry if any of them are wrong but I am certain certain they are correct. Sorry but I am not sure about question 4. I hope this helps enough though.

If you were by yourself how would you be able to control a combative person with a gun and a female getting out of the driver's side?

Answers

Answer: call the police and say the license plate

Explanation:

Hurry, I'll give you brainliest
Many who have experienced mediation say that they have more control over the resolution. Which of the following statements best explains that sentiment?

I thought I was 100 percent right, and mediation taught me that there are two sides and there are ways of solving disagreements.

Mediation is confidential.

Mediation also works in businesses, in commercial disputes, in neighborhood disagreements. It is great!

Mediation is achieved by legal professionals that assist two or more persons to reach a settlement.

Answers

I thought I was 100 percent right, and mediation taught me that there are two sides and there are ways of solving disagreements. Option A

What statement does many who have experienced mediation say?

In the mediation process, an unbiased third party helps the disputing parties communicate and negotiate so they can reach a settlement that is acceptable to both parties.

During this process, the parties have the opportunity to express their own needs and perspectives while also hearing out and taking into account the opinions of others.

Learn more about mediation:https://brainly.com/question/30160384

#SPJ1

1. When does someone enter the court system?​

Answers

Answer:

When they are arrested.

Answer:

When they are arrested or when they commit a crime

Mapp v. Ohio Case: Do you agree with the Court’s decision in the Mapp case? Give reasons for your answer.

Answers

Answer:

Yes

Explanation:

What the officers did was unconstitutional and violated the 4th amendment.  Weeks v. United States established the Exclusionary Rule in 1914. At the time the exclusionary rule was only applied for federal courts instead of all courts. In 1949, Wolf v. Colorado, the High Court ruled that the Exclusionary Rule did not apply to the State but the Fourth Amendment did. In 1961, Mapp v. Ohio, the High Court ruled that the exclusionary rule applies to the state level as well as the federal. Justice Clark said this perfectly, "Thus the State, by admitting evidence unlawfully seized, serves to encourage disobedience to the Federal Constitution which it is bound to uphold....... Nothing can destroy a government more quickly than its failure to observe its own laws, or worse, its disregard of the charter of its own existence."

What are the steps a police officer should take before the stop? Explain why it's important.

Answers

Call in the license plate number which would request profile of the ‘supposed driver’ which abstains felonies and previous charges.

Answer:

First and foremost they must have reasonable suspicion to effect a traffic stop - the only reason to stop is based on that reasonable suspicion - anything after that is on the driver - cooperation goes a long way- feel free to allow a search if your a subject and not a citizen- it’s your right to refuse a search, you can refuse a field sobriety test - with consequences- you can refuse a search — it’s best to make the officer tell you why they pulled you over — never admit to what they pulled you over for - it’s their job to tell you - which gives you their reasonable suspicion .. they won’t pull you over for no reason… you’ve given them a reason — they will look out for themselves as soon as they stop. They are watching you before they step out of their car.. behave ..

Explanation:

Hope this helps

What are the main activities of state law enforcement agencies following the centralized model?

Answers

C, handling criminal investigations and patrolling state highways.

This would be the best answer because law enforcement is known mostly for criminal investigations and guarding state highways. State borders isn’t a MAIN activity.

Hope this helps! :)

If attorneys are trained professionals to prosecute or defend, what is the judge's specific role?
O to approve the witnesses
O to determine punishment
to try the case
to establish hearsay

Answers

Answer:

To approve the witnesses

Is correct answer

I don't know properly

Answer:

to determine punishment

Explanation:

Just finished the questions and got it right :)

There is a range of punishment options the judge considers: incarceration, probation, community service, fines, or other sanctions that fit the crime.

Match the following departments to the law enforcement agencies to which they belong.

state law enforcement -
federal law enforcement -
county law enforcement -
local law enforcement-

Answers

State law enforcement-department of justice
Federal law enforcement-Kansas bureau of investigation
County law enforcement-New York police department
Local law enforcement-the sherrifs department.

Answer:

Department of justice is Federal law enforcement

NYCPD is local/Municipal law enforcement

Sheriff Department is County law enforcement

Kansas Bureau of Investigation is State Law Enforcement

Explanation:

PLEASE HELP FAST!!
(MC)A bank is robbed. In which court is the suspect most likely to appear first?

Supreme Court
State court
County court
Federal court

Answers

the answer would be federal. sorry i’m a little late :)

Answer:

All

NewsVideosImagesBooksMore

Settings

Tools

About  results (1.03 seconds)

Quantum mechanics

Overview

Examples

News

Practice problems

Quantum physics books

Videos

Calculators

History

Types

Worksheets

Share

Image result for quantum physics

Image result for quantum physics

Image result for quantum physics

Image result for quantum physics

Image result for quantum physics

Image result for quantum physics

View all

What does quantum mean in physics?

What is quantum physics? Put simply, it's the physics that explains how everything works: the best description we have of the nature of the particles that make up matter and the forces with which they interact. Quantum physics underlies how atoms work, and so why chemistry and biology work as they do.

Quantum physics | New Scientisthttps://www.newscientist.com › definition › quantum-p...

Is Quantum a physics theory?

Quantum mechanics is a fundamental theory in physics that provides a description of the physical properties of nature at the scale of atoms and subatomic particles. It is the foundation of all quantum physics including quantum chemistry, quantum field theory, quantum technology, and quantum information science.

Quantum mechanics - Wikipediahttps://en.wikipedia.org › wiki › Quantum_mechanics

About featured snippets

Feedback

People also ask

Is quantum physics the hardest subject?

What is a quantum physicist salary?

What is NOT a daily task in which police chiefs are responsible?
A) Work on budgets
B) Acquire equipment
C) Make hiring decisions
D) Making arrests

Answers

Answer:

D

Explanation:

Answer:

I think your the first kpop stan on here that hasn't posted a question about kpop-

2. The Smith System guideline to "leave yourself an out" helps in the decision-making process.
A. O True
B. O False

Answers

A. True. This is the correct answer

Yes, the Smith System guideline to "leave yourself an out" helps in the decision-making process. Thus option (A) is correct.

What is decision-making process?

The decision making process  is a whole cycle from  gathering information, assessing different alternatives till making a final choice or decision. The goal of decision-making process is making the best decision possible.

Decision-making is an integral part of management. A rational or sound decision making is very important for the growth of an organization. . Every manager from top to bottom in an heriarchy takes several decisions on a daily basis for the better growth of the organization.

The Smith System guideline to "leave yourself an out" helps in the decision-making process is true. Therefore option (A) is correct.

Learn more about decision-making process here:

https://brainly.com/question/28249642

#SPJ2

Go listen to my playlist on spotify!
https://open.spotify.com/playlist/2M0Xr2AIkFTKjRQjx8qZ0f

Answers

Answer:

I dont really feel like it

Answer:

thank you :)

Explanation:

true or false,, The juvenile and criminal justice systems are the same, only the ages of the offenders differ.

Answers

Answer:

Juveniles are tried in what is called an adjudication hearing instead of a public trial with a jury. ... While the goal of the adult crime system is to punish, the goal of the juvenile crime system is rehabilitation and doing what's in the best interest of the minor.

Explanation:

A police officer refuses to accept a bribe offered by a local drug dealer to ignore the dealer’s illegal activities. What work value is this an example of?

A. Altruism
B. Compassion
C. Integrity
D. Conflict management

Answers

conflict management
D conflict management

HELP ME FAST PLZ
(LC)Federal judges are nominated by

a Supreme Court justice
the President
the Senate
the House of Representatives

Answers

supreme court justice

What does NBT stand for?​

Answers

Answer:

The National Benchmark Tests (NBTs) are assessments for first-year applicants into higher education institutions. The NBTs were designed to measure a writer's ability to transfer understanding of Academic Literacy, Quantitative Literacy and Mathematics to the demands of tertiary coursework.

Wikipedia

Explanation:

The full meaning that can be associated to NBTthere is  National Bank Trust .

What is National Bank Trust ?

National Bank Trust is been seen as a bank that serves as  a provider of various financial solutions across the country.

This bank is well known as a result of their stable operation, It offers investment banking.

Some of other serves that this bank offers are:

risk managementretail bankingother services.

Therefore, National Bank Trust is gives financial solution to individuals in the state.

Learn more about National Bank Trust at;

brainly.com/question/25605883

"Genericide" applies to ______
trademarks
patents​

Answers

☞ANSWER☜

TRADEMARKS

☞EXPLANATION☜

Trademark Genericide can be defined as the loss of trademark rights when a term enters common usage and consumers begin to denote a particular product than its source. When a trademark becomes the "common descriptive name" of a certain product, the trademark owner will no longer have an exclusive right to its use.9 Jun

Answer:

trademarks

Explanation:

What law enforcement agency is NYPD

Answers

Answer:

New York City Police Department.

Explanation:

"PD" almost always means police department.

Also, it's quite a prominent police department and well-known since New York City is as well.

Brainliest pls (╯∀╰)

It’s New York police department

QUESTION 3
Which of the following headlines is correct in regards to checks and balances?
O A. The president was impeached by both the House of Representatives and the Senate
B. The president was impeached by the Supreme Court
C. The Supreme Court was impeached by the president.
D. The Senate was impeached by the House of Representatives.

Answers

The answer is A the president was impeached by both the House of Representatives and the senate

1. If your vehicle skids, steer the vehicle———-
to straighten the vehicle out, then————-
A. opposite the direction of the skid, in the direction you wish to go.
B.in the direction of the skią in the direction you wish to go.
C. in the direction of the skid, opposite the direction you wish to go.

Answers

Answer:

Well I'm not sure if this will help but I got told whenever your vehicle skids, u should steer the same direction. Like If your vehicle skids to the right, you should steer to the right

Explanation:

Should be B! I’m pretty sure

what does bicyclist sign mean in a road construction?

Answers

Answer:

In explanation

Explanation:

It means watch out for bicyclist and steer clear of the bicycle lane.

Hope this helped, and please mark as Brainliest :)


The Federal Trade Commission (FTC) does not do which of the following?

Answers

what are the options? to the question

The Federal Trade Commission (FTC) does not conduct investigations in businesses engaging in commerce.

What is the role of Federal Trade Commission (FTC)?

The FTC was established in 1914 to guard against practices that are unfair to business operations in the USA.

The basic functions of FTC are:

To protect consumersTo promote competition

Hence, the Federal Trade Commission (FTC) does not conduct investigations in businesses engaging in commerce.

Learn more about Federal Trade Commission (FTC) here : https://brainly.com/question/4716509

#SPJ2

Why did Colonial America adopt only part of the English legal system?


a. Colonial America kept parts of the English system until they were able to substitute Dutch and French influences that abolished private prosecutors.

b. Colonial America used the English legal system as a foundation and built the current system from the existing British system.

c. Colonial America did not want any part of the English system and only kept the private prosecutors until the Constitutional Convention in 1787.

d. Colonial America knew that they needed to adopt all of English law in order to keep order as it was only in the twentieth century that they dropped private prosecutors.

Answers

Answer:

it would be B

Explanation:

A frustum is formed when a plane that is parallel to a cone's base cuts off the upper portion, as shown below. A cone is shown. The top part of the cone is cut off to form a frustum. The frustum has a height of 6 and a radius of 4. The cone has a height of 3 and a radius of 2. What is the volume of the frustum? Leave the answer in terms of π.

Answers

Answer:

44

Explanation:

just did it edg 2021

The volume of the frustum of the cone is V = 44π units³

What is a Cone?

A cone is a three-dimensional shape in geometry that narrows smoothly from a flat base (usually circular base) to a point(which forms an axis to the center of base) called the apex or vertex.

The volume of a cone is given by the equation

Volume of Cone = ( 1/3 ) πr²h

where r is the radius of the cone

h is the height of the cone

Surface area of the cone = πr ( l + r )

where l = √ ( b² + r² )

Given data ,

Let the volume of the smaller cone be V₁

Let the volume of the entire cone be V₂

And , the volume of frustum is V = V₂ - V₁

Let the radius of the smaller cone be r

Now , the value of r = 2 units

The height of the smaller cone h = 3 units

So , the volume V₁ = ( 1/3 ) πr²h

V₁ = ( 1/3 )π ( 2 )² ( 3 )

V₁ = 4 units³

And , volume of the entire cone be V₂ = ( 1/3 )π ( 4 )² ( 9 )

V₂ = 48π units³

So , the volume of frustum is V = 48π units³ - 4 units³

V = 44π units³

Hence , the volume of the frustum is 44π units³

To learn more about cone click :

https://brainly.com/question/1984638

#SPJ7

The complete question is attached below :

A frustum is formed when a plane that is parallel to a cone's base cuts off the upper portion, as shown below. A cone is shown. The top part of the cone is cut off to form a frustum. The frustum has a height of 6 and a radius of 4. The cone has a height of 3 and a radius of 2. What is the volume of the frustum? Leave the answer in terms of π.

crime prevention programs that have been successful?

Answers

Answer:

1. For delinquent and at-risk  preadolescents: Family therapy and  parent training.

2. For older male ex-offenders:  Vocational training.

3. For convicted offenders: Rehabilitation  programs with risk-focused treatments.

Explanation:

Here's a report for the U.S. Department of Justice's  Office of Justice Programs. There are more recent reports but this should work well for your given prompt.

Which statement about cells is false?

a)Different cells work together to form tissues and organs.
b)Cells are the basic structure of living things.
c)New cells contribute to growth and repair.
d)Cells contribute only to the reproduction of an organism.


Answers

Answer:

D)Cells contribute only to the reproduction of an organism

Explanation:

Cells do many different things and do not only limit to reproduction of an organism

How does this become a law question? The answer is D
Other Questions
The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan.