|y-x| if y>x Write each of the following expressions without using the absolute value

Answers

Answer 1

The solution of the expression is; |y-x| = y - x without using absolute value.

What is mean by expression?

Numerical articulation is characterized as the assortment of the numbers factors and works by utilizing tasks like expansion, deduction, increase, and division.

Given that;

from the question the expression is;

⇒ |y−x| , if y > x

⇒ If y > x,

⇒ y - x > 0

then |y-x| is equal to (y-x),

since (y-x) is always positive in this case.

Therefore, The solution of the expression is; |y-x| = y - x

To know more about the expression, visit:

brainly.com/question/1859113

#SPJ1


Related Questions

Suppose a truck rental costs $20 plus $0.30 for each mile
driven. If your total cost of a rental was $39. 80, how many miles
did you drive?

Answers

If the total cost is $39.80, then the number of miles driven is 66 miles.

If your total cost of a rental was $39. 80, how many miles did you drive?

Here we know that  a truck rental costs $20 plus $0.30 for each mile driven.

Then we can model this with a linear equation where the y-intercept is 20, and the slope is 0.30 (where the independent variable will be the number of miles driven).

Then the total cost is modeled by the linear equation:

y = 20 + 0.3*x

If the total cost is $39.80, then we can solve:

39.8 = 20 + 0.3*x

39.8 - 20 = 0.3*x

19.8/0.3 = x

66  =x

There are 66 miles.

Learn more about linear equations at:

https://brainly.com/question/1884491

#SPJ1

Select the point that is a solution to the system of inequalities.
y< x² +3
y>x²-4

Answers

Any point that includes the origin that comes in the shaded region will satisfy the system of equation.

For the points that satisfy the system of inequalities y < x² + 3 and y > x² - 4, we need to graph the two parabolas y = x² + 3 and y = x² - 4 and shade the region where the two graphs overlap.

The graph of y = x² + 3 is an upward-facing parabola that intersects the y-axis at (0, 3). The graph of y = x² - 4 is also an upward-facing parabola that intersects the y-axis at (0, -4).

We can see from the graphs that the region where y < x² + 3 and y > x² - 4 is the shaded region between the two parabolas. This region is bounded by the two lines y = x² + 3 and y = x² - 4.

To find a point that satisfies this system of inequalities, we can pick any point within this shaded region. For example, the point (0, 0) lies within the shaded region and satisfies both inequalities:

[tex]y = 0 < x^2+ 3 = 3\\y = 0 > x^2 - 4 = -4[/tex]

Therefore, the point (0, 0) is a solution to the system of inequalities.

Learn more about the System of equations here:

https://brainly.com/question/12628931

#SPJ1

(11) Esi cut a rope into lengths which are exactly 18cm long, 30cm long or 40cm long. What is the shortest length that the rope can be?​

Answers

The shortest length that rope can be, is 360 cm; such that the rope may be cut into lengths of exactly 18cm long, 30cm long or 40cm long.

A rope is cut into length which may be exactly 18cm long, 30cm long or 40cm long.

The shortest length that rope can be

Considering the individual lengths which are all integers, the shortest length is calculated as the LCM or the Least Common Multiple of the individual lengths that are considered

Factorize the numbers 18, 30 and 40 in the following way.

18 = 2 * 3 * 3

30 = 2* 3 *5

40 = 2* 2* 2* 5

The LCM of  the numbers 18, 30 and 40 is

= 2* 2* 2* 3* 3* 5

= 360

So, the shortest length that rope can be, to make it cut into lengths of exactly 18cm long, 30cm long or 40cm long, is 360 cm.

Therefore, the required shortest length that rope can be, is 360 cm; such that the rope may be cut into lengths of exactly 18cm long, 30cm long or 40cm long.

To know more about shortest length check the below link:

https://brainly.com/question/29807939

#SPJ9

Help me on this please

Answers

Answer:

infinitely manyno solutionone solution

Step-by-step explanation:

You want to determine the number of solutions to three different systems of equations.

Standard form

A linear equation is written in standard form when the coefficients are mutually prime, and the leading coefficient is positive:

  ax +by = c . . . . . . GCF(a, b, c) = 1, a > 0

The equations are easiest to compare when they are all written in standard form.

Numbers of solutions

A system will have an infinite number of solutions when the equations are identical.

A system will have zero solutions when it reduces to ...

  (non-zero constant) = 0

A system will have one solution when the equations are different.

System 1

A factor of 2 can be removed from the first equation:

  2x -3y = 5

A factor of 3 can be removed from the second equation:

  2x -3y = 5

These equations are identical, so have infinitely many solutions.

System 2

Multiplying the first equation by 2 gives ...

  2y = -3x +6

Adding 3x, we have ...

  3x +2y = 6

When we subtract the second equation from this, we get ...

  (3x +2y) -(3x +2y) = (6) -(3)

  0 = 3

These equations have no solution.

System 3

These equations are already in standard form, and are different. This system has one solution.

(The exact solution is (x, y) = (0.48, 3.36).)

Which graph represents this equation? y = 3 2 ⁢ x 2 − 6 ⁢ x A. The graph shows an upward parabola with vertex (3, minus 4.5) and passes through (minus 1, 3.5), (0, 0), (6, 0), and (7, 3.5) B. The graph shows an upward parabola with vertex (2, minus 6) and passes through (minus 1, 7), (0, 0), (4, 0), and (5, 7) C. The graph shows an upward parabola with vertex (minus 3, minus 4.5) and passes through (minus 7, 3.5), (minus 6, 0), (0, 0), and (1, 3.5) D. The graph shows an upward parabola with vertex (minus 2, minus 6) and passes through (minus 5, 7), (minus 4, 0), (0, 0), and (1, 7)

Answers

The graph that represents the equation is:

The graph shows an upward parabola with vertex (2, -6) and passes through (-1, 7), (0, 0), (4, 0), and (5, 7).

Option B is the correct answer.

We have,

The equation y = (3/2)x² - 6x represents an upward parabola since the coefficient of x² is positive.

Now,

The vertex of the parabola.

x = -b/2a,

where a and b are the coefficients of x² and x, respectively.

So,

a = 3/2 and b = -6

x = -(-6)/(2(3/2)) = 6/3 = 2.

Plugging x = 2 into the equation,

We get y = 3/2(2)² - 6(2) = -6,

so the vertex is (2, -6).

We can eliminate options A and C since their vertices are not (2, -6).

Now,

To check which of the remaining options fits the equation, we can plug in the given points and see if they satisfy the equation.

Option B gives:

When x = -1, y = 3/2(-1)² - 6(-1) = 7

When x = 0, y = 3/2(0)² - 6(0) = 0

When x = 4, y = 3/2(4)² - 6(4) = 0

When x = 5, y = 3/2(5)² - 6(5) = 7.5

So option B fits the equation, and is the graph that represents

y = (3/2)x² - 6x.

Therefore,

The graph that represents the equation is:

The graph shows an upward parabola with vertex (2, -6) and passes through (-1, 7), (0, 0), (4, 0), and (5, 7).

Learn more about parabola here:

https://brainly.com/question/21685473

#SPJ1

I need to fill in the blanks

Answers

For an isosceles triangle, a leg is congruent to the other leg. A leg is not necessarily congruent to the base. The correct solution found by solving the equation 2x = 3x - 5 is x = 5. The length of the top left side is 10, and the length of the bottom left side is 10.

What is an isosceles triangle?

In Mathematics and Geometry, an isosceles triangle simply refers to a type of triangle with two (2) sides that are equal in length and two (2) equal angles.

This ultimately implies that, an isosceles triangle comprises two (2) side lengths that are equal and two (2) angles with the same magnitude.

In this isosceles triangle, we have the following equation;

2x = 3x - 5 (two (2) side lengths are congruent).

3x - 2x = 5

x = 5 units.

For the bottom left side, we have;

3x - 5 = 3(5) - 5 = 15 - 5 = 10 units.

Read more on isosceles triangle here: brainly.com/question/19238666

#SPJ1

Given this equation what is the value at the indicated point?

Answers

Answer:

1 = y^2 - 2

y^2 = 3, so y = -√3

Please help me solve questions 4, 5, & 6!

Answers

The probabilities are given as follows:

4. A. 1/2.

5. B. 3/7.

6. C. 3/13.

How to calculate a probability?

A probability is calculated as the division of the desired number of outcomes by the total number of outcomes in the context of a problem/experiment.

For item 4, we have that out of 30 trials, an Alaskan Malamute won 15 times, hence the probability is given as follows:

p = 15/30

p = 1/2.

For item 5, we have that out of 42 trials, a Siberian Husky was chosen 18 times, hence the probability is given as follows:

p = 18/42

p = 3/7.

For item 6, we have that out of 52 cards in a deck, 12 are pictures, hence the probability is given as follows:

p = 12/52

p = 3/13.

More can be learned about probability at https://brainly.com/question/24756209

#SPJ1

I need help on this im on a test pls

Pattern A follows the rule "add 2" and Pattern B follows the rule "subtract 2.

1, 3

1, 10

3, 6

5, 4

5, 6

7, 4

Select all correct answers

Answers

1,10
5,6
7,4

This is because those answers, following the pattern, work correctly together.

On Team B 80% of the football players weigh more than 200 pounds. If 41 men are on the team, how many weigh more than 200 pounds?

Answers

Team B has 33 players that weigh more than 200 pounds.

How to calculate the percentage?

To calculate the percentage, divide the amount by the total value and multiply the result by 100. The percentage is calculated using the formula: (value/total value)100%.

When 80% of the players weigh more than 200 pounds, 20% of the players weigh less than 200 pounds.

We can start by locating 20% of the players:

20% of 41 = 0.20 x 41 = 8.2

So we can guess that there are about 8 players weighing 200 pounds or fewer.

We may subtract this estimate from the total number of participants to obtain the number of players who weigh more than 200 pounds:

41 - 8 = 33

As a result, Team B has 33 players that weigh more than 200 pounds.

Learn more about percentages here:

https://brainly.com/question/31060287

#SPJ1

Did I get the first question correct? Question 1:

The side length c of the triangle is equal to:

c^2=a^2+b^2 −2ab cosC

where a and b are the other two side lengths of the triangle, and C is the angle opposite side c.

To solve for c, we can plug in the values of a, b, and C into the formula and solve for c. For example, if a=3, b=4, and C=60 then we would plug in these values into the formula and solve for c as follows:
c^2=3^2+4^2 −2⋅3⋅4cos60
c^2=25
c= square root 25 =5
Therefore, the side length c of the triangle is equal to 5.

Answers

Answer:

Yes, you did solve it correctly, and the way you did it is fine

Step-by-step explanation:

You correctly applied the formula for the Law of Cosines to solve for the unknown side length c of a triangle, given the values of the other two side lengths and the angle opposite the unknown side. Specifically, you plugged in the given values of a, b, and C into the formula c^2 = a^2 + b^2 - 2ab cos(C) and then solved for c by taking the square root of both sides of the equation. Finally, you simplified the expression for c by calculating the square root of 25 to obtain a numerical value of c=5

POWERED BY CGPT

Find the zeros of the function.
Enter the solutions from least to greatest.
f(X)=(-X-2) (-2x-3)

Answers

The zeros of the function f(x) = (-x - 2)(-2x - 3) are x = -2 and x = -3/2, listed from least to greatest.

What are the zeros of the function?

Given the function in the question:

f(x) = ( -x - 2 )( -2x - 3 )

To determine the zeros of the function f(x), we need to solve the equation f(x) = 0.

f(x) = ( -x - 2 )( -2x - 3 )

0 = ( -x - 2 )( -2x - 3 )

( -x - 2 )( -2x - 3 ) = 0

We can set each factor equal to zero and solve for x:

( -x - 2 ) = 0

-x - 2 = 0

-x = 2

x = -2

( -2x - 3 ) = 0

-2x - 3 = 0

-2x = 3

x = -3/2

Therefore, the zeros are x = -2 and x = -3/2.

Learn more about zeros of functions here: https://brainly.com/question/27551059

#SPJ1

The scores on a test are normally distributed with a mean of 90 and a standard deviation of 18. Find the score that is one-half a standard deviation
below the mean.

A score of__is one-half a standard deviation below the mean.

Answers

the score that is one-half a standard deviation below the mean is 81.

If you need how I solved it comment!

Two containers designed to hold water are side by side, both in the shape of a cylinder. Container A has a diameter of 14 feet and a height of 11 feet. Container B has a diameter of 10 feet and a height of 19 feet. Container A is full of water and the water is pumped into Container B until Container B is completely full.

Answers

After filling Container B completely, there are approximately 209.56 cubic feet of water left in Container A.

How to solve

Container A:

Diameter = 14 feet

Radius = Diameter / 2 = 14 / 2 = 7 feet

Height = 11 feet

Volume of Container A = π * (7^2) * 11 ≈ 1,696.46 cubic feet

Container B:

Diameter = 10 feet

Radius = Diameter / 2 = 10 / 2 = 5 feet

Height = 19 feet

The volume of Container B = [tex]π * (5^2) * 19[/tex] ≈ 1,486.90 cubic feet

Now, let's find out how much water is left in Container A after filling Container B completely.

Water left in Container A = Volume of Container A - Volume of Container B

Water left in Container A ≈ 1,696.46 - 1,486.90 ≈ 209.56 cubic feet

So, after filling Container B completely, there are approximately 209.56 cubic feet of water left in Container A.

Read more about cubic feet here:

https://brainly.com/question/22260371

#SPJ1

You work independently as a copier salesperson. Last month, you sold 26 printers at a cost of $1,750 each. The cost of goods sold for each printer is $975. Additional operating expenses include your salary ($3,000/month), advertising ($50/month), and office lease ($550/month). Use this information to calculate (a) your gross profit and (b) your net income.

Answers

To calculate the gross profit, we need to subtract the cost of goods sold (COGS) from the revenue generated by sales. The revenue generated by sales can be found by multiplying the number of printers sold by the selling price of each printer, which is $1,750.

Revenue generated by sales = 26 x $1,750 = $45,500

The cost of goods sold for each printer is $975, so the total cost of goods sold for all 26 printers is:

Total cost of goods sold = 26 x $975 = $25,350

Therefore, the gross profit can be calculated as:

Gross profit = Revenue generated by sales - Total cost of goods sold

Gross profit = $45,500 - $25,350

Gross profit = $20,150

The gross profit is $20,150.

To calculate the net income, we need to subtract all operating expenses from the gross profit. The operating expenses include your salary ($3,000/month), advertising ($50/month), and office lease ($550/month).

Total operating expenses = $3,000 + $50 + $550

Total operating expenses = $3,600

Therefore, the net income can be calculated as:

Net income = Gross profit - Total operating expenses

Net income = $20,150 - $3,600

Net income = $16,550

The net income is $16,550.

In summary, the gross profit is the revenue generated by sales minus the cost of goods sold, which in this case is $20,150. The net income is the gross profit minus all operating expenses, which in this case is $16,550.

To learn more about gross profit click:

https://brainly.com/question/942181

#SPJ1

How to front end round 10,355?

Answers

Front-end rounding 10,355 to the nearest ten is 10,360.

Describe Rounding of Numbers?

Rounding is the process of approximating a number to a specified degree of accuracy or precision. Rounding is useful when we want to simplify numbers or express them in a more manageable or meaningful way. There are various methods of rounding, such as rounding up, rounding down, and rounding to the nearest value.

To round a number to a specified degree of accuracy, we first identify the place value we are rounding to, such as units, tens, hundreds, etc. We then look at the digit in that place value and the digit to the right of it. If the digit to the right is 5 or greater, we round up by adding 1 to the digit in the place value we are rounding, and then replace all the digits to the right with zeros. If the digit to the right is less than 5, we round down by simply dropping all the digits to the right.

To front-end round a number, you look at the digit in the place value you are rounding to and round up or down based on the digit to the right of that place value.

To front-end round 10,355 to the nearest ten, we look at the tens place, which is the second digit from the right. The digit in the tens place is 5, which is greater than or equal to 5, so we round up.

To round up, we add 1 to the digit in the tens place and replace all the digits to the right with zeros. So, rounding up 10,355 to the nearest ten gives us:

10,360

Therefore, front-end rounding 10,355 to the nearest ten is 10,360.

To know more about digit visit:

https://brainly.com/question/14588148

#SPJ1

help please math homework

Answers

Answer:

60.5 m

Step-by-step explanation:

We can use the arc length formula to calculate the length of highlighted arc. Let the numerical measure of the highlighted arc be known as C, the angle measure be known as [tex]\theta[/tex], and r as the radius of the circle.

Given variables:

C = Measure of the highlighted arcr = radius of the circle[tex]\theta[/tex] = angle length of the highlighted arc

Plug in all the variables into the formula and solve for the letter C.

[tex]\boxed{\text{Formula: C = }{2\pi r\huge{\text(}\frac{\theta}{360}\huge\text{)}}}[/tex]

[tex]\implies C = }{2\pi (11)\huge{\text(}\dfrac{315}{360}\huge\text{)}}}[/tex]   [tex]\implies C = }{22\pi \huge{\text(}\dfrac{315}{360}\huge\text{)}}} = 60.5 \ \text{m}[/tex]

Therefore, Option A is the correct option.

find the logarithim of 6.373log4.948/[tex]\sqrt{0.004636[/tex]

Answers

The logarithm of 6.373log4.948/sqrt(0.004636) is approximately 2.2022

Understanding Logarithm

Logarithm is the inverse operation of exponentiation. It is a function that tells you what power you need to raise a given base to in order to get a certain value.

The logarithm of a number x with respect to  base a is denoted as logₐ(x).

For example, if we have a base of 2 and a value of 8, we can write:

log₂(8) = 3

Going back to our question, we can apply the basic knowledge of logarithm to solve the question.

First, simplify the expression:

6.373log4.948/sqrt(0.004636)

= 6.373 * log(4.948) / sqrt(0.004636)

= 6.373 * 1.6941 / 0.068

= 159.50

Now, we can find the logarithm of 159.50.

log(159.50) ≈ 2.2022

Learn more about logarithm here:

https://brainly.com/question/25710806

#SPJ1

Help me with this math if you may.

Answers

Answer:

4/5

Step-by-step explanation:

2 : 5/2

4/2 : 5/2

4 : 5

The scale factor is:

4/5

Write a compund interest function to model the following then find the balance after the given number of years situation$17 400 invested at a rate of 2.5 compounded annually 8 years

Answers

Therefore, after 8 years, the interest will be $20,146.60.

What is interest?

When a customer pays interest to borrow money from a bank, for example, interest is referred to as a payment from the borrower in the finance industry.

The customer would pay an amount that is greater than the amount they borrowed due to interest.

The principal is the sum of money that was first invested or lent and upon which interest is based.

We refer to the process of calculating fresh interest based on the new principal (which is the old principal plus interest) at the conclusion of the subsequent payment period as compound interest when we add interest to interest.

So, compound interest is interest that is paid on both the principal and interest that has already been generated.

We may calculate compound interest using the following straightforward formula:

That has to be clarified in order for us to address the issue at hand:

17400 invested at a 2.5% annual compounded rate for an 8-year period.

Let's take a look at what is provided and note it down.

Therefore, the principal is $43,000.00. In addition, we know that our rate is 2.5%, or 0.025

If it is annually compounded, n=1 times every year.

Additionally, t=8 years.

A = 17400(1 + 0.025/1)⁸ A = $20,146.60

Therefore, after 8 years, the balance will be $20,146.60.

To know more about interest visit:

brainly.com/question/29222674

#SPJ1

Therefore, after 8 years, the interest will be $20,146.60.

What is interest?

When a customer pays interest to borrow money from a bank, for example, interest is referred to as a payment from the borrower in the finance industry.

The customer would pay an amount that is greater than the amount they borrowed due to interest.

The principal is the sum of money that was first invested or lent and upon which interest is based.

We refer to the process of calculating fresh interest based on the new principal (which is the old principal plus interest) at the conclusion of the subsequent payment period as compound interest when we add interest to interest.

So, compound interest is interest that is paid on both the principal and interest that has already been generated.

We may calculate compound interest using the following straightforward formula:

That has to be clarified in order for us to address the issue at hand:

17400 invested at a 2.5% annual compounded rate for an 8-year period.

Let's take a look at what is provided and note it down.

Therefore, the principal is $43,000.00. In addition, we know that our rate is 2.5%, or 0.025

If it is annually compounded, n=1 times every year.

Additionally, t=8 years.

A = 17400(1 + 0.025/1)⁸ A = $20,146.60

Therefore, after 8 years, the balance will be $20,146.60.

To know more about interest visit:

brainly.com/question/29222674

#SPJ1

Two number are in ratio 9:13 and their sum is 176 . Find the number​

Answers

Answer:

9x + 13x = 176

22x = 176

x = 8

So the numbers are 9 × 8 = 72 and

13 × 8 = 104.

Maths
W is on the pic

Answers

The equation of line L is given as follows:

L: x = 2.

How to obtain the equation of line L?

The equation of line L is the line of symmetry of the quadratic function given as follows:

y = 3x² - 12x + 7.

Considering a quadratic function with equation y = ax² + bc + c, the line of symmetry is defined as follows:

L: x = -b/2a.

The coefficients of the function are given as follows:

a = 3, b = -12.

Hence the equation of line L is defined as follows:

L: x = -(-12)/2(3)

L: x = 2.

More can be learned about quadratic functions at https://brainly.com/question/1214333

#SPJ1

A tourist wants to visit 7 cities in Israel. Driving distances, in kilometers, between the cities are shown below7 . Find a route for the person to follow, returning to the starting city:
a. Using Nearest Neighbor starting in Jerusalem
b. Using Repeated Nearest Neighbor

Answers

a. Using Nearest Neighbor starting in Jerusalem, the value will be 1000km.

b. Using Repeated Nearest Neighbor, the values are attached.

How to explain the information

Using Nearest Neighbor starting in Jerusalem, the value will be from A to B to C to D to E to F to A.

This will be:

Total length = 58 + 95 + 35 + 29 + 233 + 241 + 309

= 1000km.

Therefore, Using Nearest Neighbor starting in Jerusalem, the value will be 1000km na using Repeated Nearest Neighbor, the values are attached.

Learn more about word problem on

https://brainly.com/question/21405634

#SPJ1

please answer this question ​

Answers

the answer to your question is 156

Plot the numbers -1 1/6 and 7/3 on the number line below.

Answers

To find the answer to your question, you must figure out where the fractions are located on the number line.

-1 1/6 is the small vertical line to the left of the line with the -1. To write this, you must write -1 1/6 above the small vertical line to the left of the line labled -1

To label a line with 7/3, we must find what 7/3 is equivalent to when the denominator is 6, as the number lines are split into sixths. We must also convert it from an improper fraction to a mixed fraction. To do this, we must figure out how many denominator values (3) can fit into the numerator values (7). 3 can fit into 7 twice, with a remander of 1. This makes the fraction 2 1/3, which is equivalent to 2 2/6.
To mark this on the line, we must find 2, and mark 7/3 two vertical lines to the right.

Please solve As soon as possible.

Answers

An equation to match the graph include the following: f(x) = |x - 1| - 1.

What is a translation?

In Mathematics and Geometry, the translation a geometric figure or graph to the right simply means adding a digit to the value on the x-coordinate of the pre-image while the translation a geometric figure or graph downward simply means subtracting a digit from the value on the y-coordinate (y-axis) of the pre-image.

Since the parent function is f(x) = |x|, g(x) would be created by translating f(x) the parent function one units to the right and one units downward as follows;

f(x) = |x|

g(x) = |x - 1| - 1

Read more on function and translation here: brainly.com/question/31559256

#SPJ1

a. Use the appropriate formula to determine the periodic deposit.
b. How much of the financial goal comes from deposits and how much comes from interest?
Periodic Deposit
Rate
$? at the end of each month 6.75% compounded monthly
Click the icon to view some finance formulas.
Time
45 years
Financial Goal
$1,000,000
***
a. The periodic deposit is $.
(Do not round until the final answer. Then round up to the nearest dollar as needed.)

Answers

The periodic deposit required to reach the financial goal of $1,000,000 in 45 years with a 6.75% annual interest rate compounded monthly is approximately $541.05.

And,  Amount $292,593.00 comes from deposits and $707,407.00 comes from interest.

For the periodic deposit, we can use the formula:

P = (FV × r) / ((1 + r)ⁿ - 1)

where P is the periodic deposit, FV is the financial goal, r is the interest rate per period, and n is the total number of periods.

Using the given values, we get:

P = ($1,000,000 0.0675) / ((1 + 0.0675/12)^(45x12) - 1)

P ≈ $541.05

So, the periodic deposit required to reach the financial goal of $1,000,000 in 45 years with a 6.75% annual interest rate compounded monthly is approximately $541.05.

And, To determine how much of the financial goal comes from deposits and how much comes from interest, we can calculate the total amount of deposits made over the 45-year period:

Hence, Total deposits is,

P n = $541.05 (45 x 12)

      ≈ $292,593.00

Then we can subtract this amount from the financial goal to get the amount that comes from interest:

Amount from interest = FV - Total deposits

= $1,000,000 - $292,593.00

≈ $707,407.00

So , Amount $292,593.00 comes from deposits and $707,407.00 comes from interest.

Learn more about the multiplication visit:

https://brainly.com/question/10873737

#SPJ1

Write a function in any form that would match the graph shown below:

Answers

The function that would match the graph shown below is given as follows:

y = -5(x³ + 7x² + 8x - 16).

How to define the function?

The function is defined using the Factor Theorem, as we have the x-intercepts of the graph, hence we can write the function as a product of it's linear factors.

Considering the x-intercepts, the roots are given as follows:

x = -4 with a multiplicity of 2, as the graph turns.x = 1 with a multiplicity of 1.

Hence, considering the leading coefficient a, the function is defined as follows:

y = a(x + 4)²(x - 1)

y = a(x² + 8x + 16)(x - 1)

y = a(x³ + 7x² + 8x - 16).

When x = 0, y = 80, hence the leading coefficient a is obtained as follows:

-16a = 80

a = -5.

Hence the function is:

y = -5(x³ + 7x² + 8x - 16).

More can be learned about the Factor Theorem at https://brainly.com/question/24729294

#SPJ1

Consider the function defined by f(x) for x > 0 and its graph y = f(x).
The graph of f has a horizontal tangent at point P. Find the coordinates of P.

Answers

This means that the coordinates of P are (a, b), where a is the value for which f'(a) = 0, and b = f(a).

What is coordinate?

The term "coordinate" generally refers to a value or set of values that describe the position or location of a point or object in a particular system or space. In mathematics, coordinates are typically used to describe the position of a point on a graph or in a geometric plane, and they usually consist of a set of numerical values that indicate the distance or direction of the point from a specified origin or reference point. In geographic or cartographic contexts, coordinates might refer to latitude and longitude values that indicate a specific location on the Earth's surface. Other systems may use different types of coordinates, but the underlying idea is usually the same: a set of values that describe the position of an object or point in a given space or system.

if the graph of f has a horizontal tangent at point P, this means that the slope of the tangent line at P is zero.

Let (a, b) be the coordinates of P. Then the equation of the tangent line at P is:

[tex]y - b = f'(a)(x - a)[/tex]

Since the slope of the tangent line at P is zero, we have:

f'(a) = 0

This means that the derivative of f at x = a is zero. So, we need to find the value of a for which f'(a) = 0.

Once we find the value of a, we can substitute it into the equation of the tangent line to find the value of b.

So, let's find f'(x) first:

f(x) = ... (the function is not given, so we cannot find f'(x) explicitly)

We know that f'(a) = 0, so we have:

[tex]f'(a) = lim h- > 0 [f(a+h) - f(a)]/h = 0[/tex]

This means that:

[tex]lim h- > 0 [f(a+h) - f(a)]/h = 0[/tex]

Multiplying both sides by h, we get:

[tex]lim h- > 0 [f(a+h) - f(a)] = 0[/tex]

Taking the limit as h approaches 0, we get:

[tex]f(a) - f(a) = 0[/tex]

So, we have:

[tex]f(a) = b[/tex]

To know more about tangent line, visit:

https://brainly.com/question/31326507

#SPJ1

Need help in part two and part 3 step by step on each Sweet Dreams
Part 1
Directions: Molly collected data from her friends. Each friend told her the number
of hours they slept last night. Use the information in the chart below to complete a
line plot of the data. Determine the scale you should use, and a title for the line
plot. Using the blank line plot below, write in the intervals, the title you chose, and
place a dot on the line plot for each of Molly’s friend’s hours of sleep. Then, answer
the questions about the line plot you’ve created.

Answers

The most common amount of sleep is 8 1/2 hours.

There is no outlier in the data.

The difference in hours between the longest night's sleep and the longest night's sleep is 3.5 hours.

The number of people who slept longer than 8 hours is 15 people.

What is a dot plot?

In Mathematics and Statistics, a dot plot can be defined as a type of line plot that is typically used for the graphical representation of a data set above a number line, especially through the use of crosses or dots.

Based on the information provided about the number of hours Molly's friends slept last night, we can reasonably infer and logically deduce that all of the data points would be between 6 and 11, without any outlier.

In this scenario, we would use an online graphing calculator to construct a dot plot with respect to a number line that accurately fit Molly's data set, with a scale of 0 < x < 11.

Difference in hours = 10 - 6.5 = 3.5 hours.

In conclusion, the dot plot would be titled "Hours of sleep."

Read more on dot plots here: brainly.com/question/30486649

#SPJ1

Missing information:

The question is incomplete and the complete question is shown in the attached picture.

Other Questions
Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!! to the principal for remission of fine What are the bond angles? You want to buy a house within 3 years, and you are currently saving for the down payment.You plan to save $5000 at the end of the first year, and you anticipate that your annual savingswill increase by 10 % annually thereafter. Your expected annual return is 7%. How much wouldyou have for a down payment at the end of year 3? how do the values of the integral 1 2 q/t compare for a reversible and irreversible process between the same end states? calculate the change in entropy for the vaporization of xe at its boiling point of -107 c given that vaph = 12.6 kj/mol. 1. -0.118 j/k mol 2. -13.2 j/k mol 3. 0.750 j/k mol 4. 75.9 j/k mol FeatureThe Ethanol DebateNatalie StewartOur society has recently undergone a shift towards greener living. People have grown more aware of how their actions seriously and negatively impact the environment. Many are seeking out new ways to decrease pollution levels and to find cleaner energy sources to power their homes and businesses. Ethanol is an increasingly popular fuel alternative to gasoline, made from distilled, fermented corn. The benefits of ethanol include lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline, as well as decreasing the United States dependence on foreign oil. Though many people support the production of ethanol for use as an alternative fuel, most of them ignore the serious drawbacks of ethanol use.One important economic factor in producing ethanol is its influence on the price of corn. Corn prices have more than doubled since 2005 because of increased demand, according to financial experts. Farmers know that corn is highly sought after, so they allot more space on their farms to grow large amounts of corn. This leaves less room for growing other kinds of crops, such as wheat or soybeans. These smaller amounts force suppliers to raise the prices of these now secondary crops as well. Bread and cereal manufactures are also involved in the economics of ethanol. These companies then pass rising costs of their crops to consumers, leading to higher prices at the grocery store.Corn is also a common source of food for livestock. Many farmers are now struggling to feed their herds of cows, chickens, and pigs. The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers. Shoppers are certain to see the prices of beef, chicken, and pork increase if corn prices continue to skyrocket. Unfortunately, hardworking farmers and ranchers see very little profits from this increase in price. Many of them oppose ethanol as an alternative fuel source because of the extreme impact it is having on their way of life.In addition, opponents of ethanol note that government subsidies cost American taxpayers more money. State and federal government subsidy programs offer tax credits to gas stations for each gallon of ethanol they mix in with the gasoline they sell. Government programs also supply companies that produce ethanol with corn! Where does the government get the money for these subsidies? Money for these projects comes from ourthe taxpayerspockets. These costs are in addition to rising fuel prices, which are currently almost four dollars per gallon. Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Overall, it would be more cost-effective for everyone if the government pursued other options for fuel and energy sources.Ethanol has some benefits. However, overenthusiastic supporters should consider all sides of the issue before taking actions that are already putting Americas economy in a precarious position. Ethanol is not the answer to our economic and environmental problems. Instead of focusing on a technology that is too costly to be practical, we should be encouraging our government to continue investing in other alternatives. Only then will we see our food and energy prices stabilize. Which two pieces of evidence from the passage support the author's point of view as identified in the previous question?ResponsesA The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.The increased cost of feeding their animals has forced many farmers to reduce the size of their herds, decreasing the supply of meat available to consumers.B People have grown more aware of how their actions seriously and negatively impact the environment.People have grown more aware of how their actions seriously and negatively impact the environment.C Another benefit of ethanol is decreasing the United States dependence on foreign oil.Another benefit of ethanol is decreasing the United States dependence on foreign oil.D One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.One benefit of ethanol includes lowering the amount of harmful carbon dioxide gases released into the air by burning fossil fuels like gasoline.E Many people are disappointed in ethanol because they believed that it would help reduce the price at the pump, not increase it. Please answer question #35 According to Thomson Financial, last year the majority of companies reporting profits had beaten estimates. A sample of 162 companies showed that 94 beat estimates, 29 matched estimates, and 39 fell short.(a) What is the point estimate of the proportion that fell short of estimates? If required, round your answer to four decimal places.pshort = .2407(b) Determine the margin of error and provide a 95% confidence interval for the proportion that beat estimates. If required, round your answer to four decimal places.ME = (c) How large a sample is needed if the desired margin of error is 0.05? If required, round your answer to the next integer.n* = Discussion What part of the life cycle is represented by the mature pollen grain int[] oldArray = {1, 2, 3, 4, 5, 6, 7, 8, 9}; int[newArray = new int[3][3]; int row = 0; int col = 0; for (int index = 0; index < oldArray.length; index++) { newArray[row][col] = oldArray[index]; row++; if ((row % 3) == 0) { col++; row = 0; } } System.out.println(newArray[0][2]); What is printed as a result of executing the code segment? Determine if each of the following relationships represents a proportional relationship or not.SELECT ALL situations that represent a proportional relationship.A). Natalia is selling fresh eggs at the local farmer's market. She sells 6 eggs for $3.12, a dozen eggs for $6.24, and eighteen eggs for $9.36.B). Joey is training for a bicycle race and has been completing his longer training rides on Saturdays. Over the past month, Joey has ridden his bicycle 36 miles in 3 hours, 46 miles in 4 hours, and 22 miles in 2 hours.C). graph 1 provided in the picturesD). graph 2 provided in the picturesE). Azul bought several different packages of 8-inch by 10-inch art canvases for craft project at her family reunion. The number of canvases in a package and the cost of the package is shown in the table. (TABLE PROVIDED IN PICTURES)F). Kareem is comparing the cost of regular unleaded gasoline at three different gas stations near his home. Instead of filling up his car's gas tank at one station, he puts a few gallons in at each of the three different stations. The number of gallons of gasoline and the cost of the gasoline is shown in the table. (TABLE PROVIDED IN PICTURES) In the financial statements, dividends in arrears on cumulative preferred stock should be _____Select one: a classified as an offset to retained earnings b. classified as a liability either current or long term.C. disclosed in the footnotes. d. classified as an offset to net income f q1 has the same magnitude as before but is negative, in what region along the x-axis would it be possible for the net electric force on q3 to be zero? (a) x , 0 (b) 0 , x , 2 m (c) 2 m , x Janelys has a bag of candy full of 15 strawberry chews and 5 cherry chews thatshe eats one at a time. Which word or phrase describes the probability thatshe reaches in without looking and pulls out a strawberry chew?