Why did general lee want the north to suffer?

Answers

Answer 1

Answer:

in hopes on relieving pressure on war-torn Virg*nia


Related Questions

what you think was the intent of the framers of the “Black Codes” in Mississippi following the demise of slavery. What fears concerning the Black population are expressed in the “Codes”? How does the “Codes” achieve that intent? Although the freed people had been emancipated from slavery, how could the “Codes” limit their “new birth of freedom”?

Answers

The black codes were laws put in place to restrict minorities. They were created with the intent to maintain segregation, uphold white supremacy ideas, and exploit cheap labor. They did this by creating things like the poll tax, literacy tests, the grandfather clause, and the white primary. The black codes prevented black Americans from exercising their right to vote.

Answer:

The black codes were put into place in an attempt to keep black in their place and to lower morale among them so that slaves literally could not do anything unless they were told and were not allowed to even eat unless their masters allowed them to and even then they didn't get what they want it was usually scrapped there master chose to give them when they were moldy and bad.

Another thing is that they were not allowed to leave their masters' place or else be brung back in and beat in front of other slaves usually as an example that if yall do this is what you are gonna get.

It was so bad a lot of them killed themselves to escape the horrors they would ace and the hard labor but even then it was taken out on the other slaves so It didn't really work in the long run it just helped them.

Another striking thing I find is that when Abraham Lincoln introduced the Emancipation proclamation many of the slaves were so mentally beaten down and worn out that they chose to stay slaves because that was the only thing they knew how to do.

Imagine living in a time like that and being black.

Explanation:

Which of the following are relevant factors when determining if a source of
information is accurate and credible?
Publish Date, Publisher, Author
Is the source free?
Is the perspective biased?
Are there mistakes in the writing?

Answers

Answer: Is the perspective biased

Explanation: How I know that the answer is the second option is by ruling out the other options.

You can rule out the first option because who wrote the article, who published the article,  and when the article became available to the public is not important in determining weather it is accurate or credible.

You can also rule out the second option because weather or not the source is free is not going to tell you weather it is accurate or not.

And finally, you can rule out the last option because there is no way to tell if the source is inaccurate and credible by the author making a mistake in the article. Like misspelling.

With all this information, you can clearly see that the only answer for this question is the third option. Is the perspective biased?

How has technology negatively impacted politics ​

Answers

Answer:

In some ways, yes. Technology in politics can make data unreliable or cause uncertainties at times.

Explanation:

In some ways yes just look it up you can tell

The French revolution inspired the _____revolution

Answers

Answer:

The American Revolution

Explanation:

(I'm not too sure if this is right so don't take my word for it)

A person-trip is travel more than how many miles from a person's home?​

Answers

A person-trip is travel more than : 50 miles from a person's home

What is a person-trip

A person-trip is a type of travel which involves an individual only and can be made using any mode of transportation and long walks as well. For trip to be considered a person- trip, the distance covered by the individual has to be at least 50 miles or more.

Hence we can conclude that A person-trip is travel more than : 50 miles from a person's home.

Learn more about person-trip : https://brainly.com/question/15414955

#SPJ1

In 1803, the United States bought a large area of land from France. Which of the labeled locations on the map was most likely part of this sale?

Answers

Answer:

See attached photos.

Explanation:

The Louisiana Purchase was the acquisition of the territory of Louisiana by the United States from the French First Republic in 1803. In return for fifteen million dollars, or approximately eighteen dollars per square mile, the United States nominally acquired a total of 828,000 sq mi.

Hope this helps!

The Louisiana Purchase was the 1803 American purchase of Louisiana land from the French First Republic. The United States nominally purchased a total area of 828,000 sq mi in exchange for fifteen million dollars, or around eighteen dollars per square mile.

What do you know about the  United States ?

The Americas have been home to indigenous people for thousands of years. The Thirteen Colonies were founded in what is now the Eastern United States as a result of British colonialism, which started in 1607.

Over taxes and political representation, they fought the British Crown, sparking the American Revolution and subsequent Revolutionary War.

The first nation-state built on the unalienable natural rights, consent of the governed, and liberal democracy was the United States when it proclaimed its independence on July 4, 1776. By 1848, the nation had reached the entire continent of North America.

Learn more about the  United States , from :

brainly.com/question/1527526

#SPJ2

In 1920, American voters elected a President who promised

Answers

Answer:

Harding's campaign promised a return to "normalcy," rejecting the activism of Theodore Roosevelt and the idealism of Woodrow Wilson. Voters responded to his genial nature, impressive stature, and bland message; he won by a landslide. Harding recorded several speeches for the Nation's Forum.

Explanation:

In 1920 American voters elected a president who promised to increase the U.S. role in world affairs

Use the excerpt to answer the question.

In the wake of the 2001 recession, the tech sector’s impact on employment occurred primarily

A.
in Silicon Valley.

B.
in Southern California.

C.
around Washington, D.C.

D.
away from Silicon Valley.

Answers

In the wake of the 2001 recession, the tech sector’s impact on employment occurred primarily in Silicon Valley. Option A. This is further explained below.

What is a recession?

Generally, the recession is simply defined as It was in Silicon Valley that the tech industry had the greatest influence on employment in the aftermath of the 2001 recession.

In conclusion, It was in Silicon Valley that the tech industry had the greatest influence on employment in the aftermath of the 2001 recession.

Read more about Silicon Valley

https://brainly.com/question/2637058

#SPJ1

Use the excerpt to answer the question.

Which of the following best captures George H. W. Bush’s description of the power of the United States in 1991?

A.
an embattled army

B.
a fierce rival against formidable foes

C.
an uncontested international police force

D.
an emerging power unrecognized on the global stage

Answers

What best captures George H. W. Bush’s description of the power of the United States in 1991 is "a fierce rival against formidable foes". Option B. This is further explained below.

Who is George H. W. Bush?

Generally, George Herbert Walker Bush was the 41st President of the United States of America and was instrumental in the building of America as we know it.

In conclusion,  The phrase "a ferocious opponent against strong enemies" best conveys George H. W. Bush's view of the United States' might in 1991.

Read more about George H. W. Bush

https://brainly.com/question/16307611

#SPJ1

Saint-Domingue's
leaders refuse to grant
citizenship to
Saint-Domingue's
lower classes vastly
?
outnumber its
ruling class.
mixed-race Haitians.
The Haitian
Revolution
Which statement best completes the diagram of the causes of the Haitian
Revolution?
A. Saint-Domingue's trade relations with Europe break down entirely.
OB. Saint-Domingue's government loses the support of Napoleon
Bonaparte.
C. Saint-Domingue's large slave population demands a social
revolution.
D. Saint-Domingue's leaders begin to enslave poor whites as well as
Africans.

Answers

The causes of the Haitian Revolution according to the diagram is that the Saint-Domingue's large slave population demands a social revolution.

What causes the Haitian Revolution?

This refers to the successful revolution by self-liberated slaves against French colonial rule in Saint-Domingue now known as Haiti.

Hence, the causes of the Haitian Revolution according to the diagram is that the Saint-Domingue's large slave population demands a social revolution.

Therefore, the Option C is correct.

Read more about Haitian Revolution

brainly.com/question/13723430

#SPJ1

Who is attributed with spreading Buddhism throughout India and beyond?

A. Mahabharata
B. Samudra Gupta
C. Asoka
D. Julius Caesar

Answers

Answer:

Emperor Ashoka

Explanation:

Emperor Ashoka has become known as one of world history's most humanitarian leaders. After a horrible war with a neighboring kingdom, Ashoka became horrified at the bloodshed he had caused.

Answer:

C. Asoka

Explanation:

The correct spelling is King Ashoka :)

The Congress of Racial Equality
was led by Martin Luther King Jr.
O used boycotts in the 1960s to achieve integration.
O used sit-ins in the 1940s to encourage integration.
• was led by Rev. Ralph Abernathy.
u

Answers

Answer:

Yes

Explanation:

I need points to unlock my grade

The government needs to provide public goods for what reason?
A. They are necessary for raising the standard of living.
B. The government can reduce taxes by profiting from public goods.
C. Private companies cannot profit by providing them.
D. Citizens demand government regulation to protect their freedom.
SUBMIT

Answers

Answer:

Public Goods - The Economic Lowdown Podcast Series

Explanation:

Is public transportation a public good? How about national defense? Knowing the characteristics of public goods will help you understand why private firms excel at producing private goods, but they have little incentive to produce public goods. Rather, if society wants public goods, government must produce them. This episode of The Economic Lowdown defines the characteristics of private and public goods and explains why these characteristics help determine who is best positioned to produce each.

[Hope's it's Help]

Answer:

The government plays a significant role in providing goods such as national defence, infrastructure, education, security, and fire and environmental protection almost everywhere. These goods are often referred to as “public goods”.

Explanation:

Deforestation in Mexico is caused by all of the following except

Answers

A.
the spread of disease in the forests.


B.
the demand for timber exports.


C.
the need for farmland.


D.
the need for grazing land.

Answers

Deforestation in Mexico is caused by all of the following except the spread of disease in the forests. Option A. This is further explained below.

What is Deforestation?

Generally, is simply defined as the process of removing trees from a large region.

In conclusion, The growth of illness in Mexico's woods is not a factor in deforestation.

Read more about Deforestation

https://brainly.com/question/17178423

#SPJ1

Do you think black Americans were liberated & freed after slavery was abolished?

Answers

Answer:

No, black Americans were not completely liberated and freed after slavery was abolished.

Explanation:

Only the Northern states abolished slavery. Many states in the South continued enslaving black Americans because Southern states were the most resourceful when it came to harvesting crops and materials.

Which of the following is true about email communication

Answers

Answer:

Emails Should be concise and contain a disclaimer

Explanation:

What was the main reason towns and cities Baganda to develop out west

Answers

Answer:

aganda civil servants also helped administer other ethnic groups, and Uganda's early history was written from the perspective of the Baganda and the colonial officials who became accustomed to dealing with them.

Explanation:

- dominate social groups
- Migration
-industrialization

i really confuse with this answer can someone help

Answers

Answer:

Tanks and airplanes.

Explanation: These ended the stalemate.

Was reconstruction a success or a failure ?
Respond with a thesis statement and a quotation

Answers

Reconstruction was both a success and a failure because it helped some African Americans integrate into society but failed to guarantee their rights.

Why was Reconstruction both a failure and a success?

Reconstruction was a success because it educated many African Americans in schools built during the peirod.

It was, however a failure because African Americans lost civil rights in the racist South as soon as Reconstruction was declared over.

Find out more on Reconstruction at https://brainly.com/question/13753522.

#SPJ1

Use the excerpt to answer the question.

Which of the following of Barack Obama’s characteristics in 2008 does this excerpt highlight?

A.
his race

B.
his inexperience

C.
his liberalism

D.
his education

Answers

His liberalism it’s a guess I’m not 100% sure

By 1914, imperialism had fed into European tensions because of

Answers

Answer:

O the high number of European countries competing for colonies all over the world.

Explanation:

Which of the following countries used a command economy during the Cold War?
A. Soviet Union
B. The United States
C. Great Britain
D. Israel

Answers

It's A. Soviet Union

Answer:

Soviet Union

Explanation:

Hope that helps! :)

Which historical event was seen by the greatest number of Americans on the evening television news?
John F. Kennedy assassination
Apollo Moon Landing
Bombing of Pearl Harbor
Presidential election results for Harding and Cox

Answers

Select the correct text in the passage.

The concept of an American Identity has

Answer:

B.Apollo Moon Landing

Explanation:

its might be wrong but its an answer unlike the person above me

Question 8 (3 points)
How has increased immigration into South Carolina affected the economic concern
of the state?

Answers

Answer:

While 1 in 20 South Carolinians is an immigrant, foreign-born residents make up a vital, educated share of the state's labor force.

Which of the following factors contributed to American consumer spending
during the 1920s?
A. Rich people welcomed middle-class people into their homes and
schools.
• B. Products that were imported from other countries were very
inexpensive.

C. An excess of luxury goods raised the standard of living for
everyone.
D. People were willing to borrow money to buy products instead of
saving for them.

Answers

The factor that contributed to the spending during 1920 was people were willing to borrow money to buy products instead of saving for them. Thus the correct answer is D

What is a consumer?

A consumer is referred to as an end-person who purchases the goods from the business and utilizes it. A consumer can be the customer but all customers are not consumers.

Greater salaries and the introduction of credit were two factors that contributed to increased consumer expenditure in the 1920s. Personal debt arises as a consequence of increased consumer expenditure, which had a national impact.

Therefore, option D's willingness to borrow money instead of saving them to buy products is the correct answer.

Learn more about consumers, here:

https://brainly.com/question/352725

#SPJ1

List one thing that you saw Hollywood stars of the day doing in the video.

Answers

Answer:

I saw them seeing their names on the floor

Tab 1:
Tab 2:
When we came there, we were attacked by a party
of French and Indians, whose number, I am
persuaded, did not exceed three hundred men;
while ours consisted of about one thousand three
hundred well-armed troops, chiefly regular
soldiers, who were struck with such a panic that
they behaved with more cowardice than it is
possible to conceive. The officers behaved
gallantly, in order to encourage their men, for
which they suffered greatly, there being near
sixty killed and wounded.
Intro
How is Washington's account similar to the newspaper
account?
O Both accounts describe the hilly terrain.
O Both accounts describe how the British soldiers
panicked.
Both accounts describe the French and Indians'
battle formation.
Both accounts describe how many soldiers were on
each side.

Answers

Answer:

what is the question exactly ?

During the nineteenth century, dictators referred to as _____________ seized power in many South American countries.
Answers

A.
conquistadors


B.
caudillos


C.
quipu


D.
patois

Answers


Answer:


A. Conquistadors



Which of the following situations accurately describe "democracy"?
Select one:

a.
Citizens exercise their rights to own private property and
compete in open markets with little government involvement

b. Citizens have the responsibility to choose their officials
thoughtfully and wisely

c. A government applies its laws equally and fairly and not on
the whims of a ruler

d. Citizens are free to pursue a better life with all amenities for
a comfortable existence

Answers

Answer:

b

Explanation:

Option B. Citizens have the responsibility to choose their officiala thoughtfully and wisely.

Explanation:

Its the only democratic government which is for the people, of the people and by the people. Democracy makes the people responsible in choosing their officials to run the country smoothly. Democracy gives the representation to all the sections of the society. In Democracy every person is given the right to vote , to wise candidate for his / her country.

Jacob has a total of 64 quarters and dimes that have a combined value of $13.45. How many quarters and dimes are there?

Answers

If Jacob has a total of 64 quarters and dimes. The number of quarters and dimes that are there is: 47 quarters and 17 dimes.

Numbers of quarters and dimes

Number of dimes = d

Number of quarters = q

Hence:

d+q=60

10d+.25q=13.45

Substitution

d=64-q

(.10)(64-q) + (.25)q = 13.45

6.4-.10q+.25q=13.45

-.10q+.25q=7.05

.15q=7.05

q=7.05/.15

q=47

Substitute this back in the original equation:

d+47=64

d=64-47

d=17

Therefore the number of  quarters and dimes that are there is: 47 quarters and 17 dimes.

Learn more about about quarters and dimes here:

https://brainly.com/question/13220020

#SPJ1

Other Questions
Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold.