Which statement is Irue about the given information?
+
B
с
DE

Which Statement Is Irue About The Given Information?+BDE

Answers

Answer 1

Answer:

b

Step-by-step explanation:

Answer 2

awnser 3

both are congrent


Related Questions

What is the value of 6k^-4 if k = -1?
A. -24
B. 1
C. 6
D. 24

Answers

Answer: 6

Step-by-step explanation:

[tex]6\left(-1\right)^{-4}[/tex]

[tex]6\cdot \frac{1}{\left(-1\right)^4}[/tex]

[tex]6\cdot \:1[/tex]

[tex]6[/tex]

Answer:

C, the answer is 6.

Step-by-step explanation:

If you substitute -1 into the variable "k", it would look like this equation, 6(-1)[tex]6(-1)^{-4}[/tex], if you then raise -1 to the power of -4, you would then get the value 1. Thus, 6 * 1 equals 6. C would be the correct answer.

I need serous help like now Marie can find the volume of a cube by using the formula V = s³, where s represents the side length of the cube. If Marie's cube has a side length of 2 1\2 centimeters, what is the volume of her cube? Show your work. Make sure that you include the correct unit of measure in your answer.

Answers

Answer:

[tex]V=15.62\ cm^3[/tex]

Step-by-step explanation:

The volume of a cube is given by the formula :

V = s³, where s represents the side length of the cube

The side length of Marie's cube is [tex]2\dfrac{1}{2}\ cm[/tex]. We need to find the volume of her cube. For this, we can use the formula of the volume of a cube such that,

[tex]V=(2\dfrac{1}{2})^3\\\\=(\dfrac{5}{2})^3\ cm^3\\\\=\dfrac{125}{8}\ cm^3\\\\=15.62\ cm^3[/tex]

So, the volume of her cube is [tex]15.62\ cm^3[/tex].

Isaac buys a plant that is 3 inches tall. After one week the plant is 5 inches tall. After a second week the plant is 7 inches tall. At this rate, how tall will the plant be after the fifth week? a 15 inches tall b 2 inches tall c 13 inches tall d 11 inches tall

Answers

Answer:

C 13 inches

Step-by-step explanation:

Because the plant grows two inches every week so if by the second week it is 7 inches tall just add 3 more weeks or 6 inches of growth to the 7 inches and you get your answer 13 inches

0.6 divided by what equals 2.5

Answers

Answer: 0.6 divided by 0.24 equals 2.5

Answer:

1.5

Step-by-step explanation:

Do the reverse/opposite/check division with multiplication.

2.5 · 0.6 = 1.5  

Subtract and reduce: 2 2/3 - 1 1/2

Answers

Step-by-step explanation:

I used a calculator but the answer is 1 1/6

c). The local bus service has 2 lines of buses that start together at 8
a.m. Buses on line A leave after every 15 minutes while Buses on line
B leave after every 20 minutes. In a day, how many times do buses on
both line A and B leave together between 8 a.m. and 11 a.m.

Answers

Answer:

3 times

Step-by-step explanation:

Firstly we calculate the number of minutes between 8 and 11 am

The number of hours is 3 hours

The number of minutes is 180 minutes since 1 hour is 60 minutes

Now out of 180, to know the number of times that they both leave, we need to get the multiples of both between 0 and 180

The multiples are;

60, 120, 180

This means that they leave together 3 times

Give 3 examples of integers which are greater than −2

Answers

Answer: -1 would be greater than negative two, along with 20, 1000.

-2 is a negative number, so any number that is -1 or higher is greater than -2

Answer:

1,2,3

Step-by-step explanation:

Cual es la raíz cuadrada de 48?

Answers

√48 = 4√3

Click on the photo to view full solution

determine the angle of x :p

Answers

Answer:

x=-10 I think?? because they are congruent






Need answer ASAP!!!
Will make brainliest!!
which number best represents the slope of the graphed line?

Answers

Answer:( -10,10), (-,+)

Step-by-step explanation:

Awnser:

-2

Step by Step:

To find a slope, you need to find 2 points. You can't have a line with only 1 point.

The equation for a slope is: y2-y1/x2-x1.

It doesn't matter which order you put them in.

I used (-4,1) and (-6,2).

So: 2-1/-6-(-4)

1/-6+4

1/-2

-2

2/3 ( 12 n + 6 ) − 1 5 ( 10 n − 2 )

Answers

Answer:

34-158n

Step-by-step explanation:

First factor:

8n+4-150n+30

Then combine like terms

34-158n

Answer:    -142n+34

Step-by-step explanation:(2/3)(12n)+(2/3)(6)+(-15)(10n)+(-15)(-2)

=-142n+34

Find the solutions using the Quadratic Formula.
x2 – 5x-14 = 0

Answers

Answer is X=-2 ,x=7

(X+2) (x-7) =0

Which statement would be included in the proof of why Measure of angle C + measure of angle G + measure of angle H = 180 degrees.?
A. Angles F and H are congruent.
B. Angles A and G are congruent.
C. Angles A and H are congruent.
D. Angles E and C are congruent.

Answers

I think c

Step-by-step explanation:

I did it a min ago

Answer:

ur answer would be C. Angles A and H are congruent.

Step-by-step explanation:

right on edge 2021 for math

Dee spends $0.25, $0.30, $0.10 and $0.04.

How much $ does she spend in all?

Answers

Answer:

$0.69

Step-by-step explanation:

Add them all up.

Answer:

$0.64

Step-by-step explanation:

hope this helped :-)

From points A and B, the distance between which is 1020 mi, two trains left simultaneously towards each other. The speed of one train was 10 mph greater than the speed of the other one. In 5 hours the trains had

Answers

Complete question :

From points A and B, the distance between which is 1020 mi, two trains left simultaneously towards each other. The speed of one train was 10 mph greater than the speed of the other one. In 5 hours the trains had not met yet and were 170 mi apart. Find the speed of the trains.

Answer:

Train A = 80 miles per hour

Train B = 90 miles per hour

Step-by-step explanation:

Given that :

Distance between A and B = 1020

Let the speed of A = x

Speed of B = x + 10

Since they both left simultaneously;

Distance traveled after 5 hours will be :

Distance = speed * time

A = x * 5 = 5x

B = (x + 10) * 5 = 5x + 50

After the distance traveled by each of A and B, they are still 170 miles apart

Hence, distance covered after 5 hours ;

Total miles - miles left

1020 - 170 = 850 miles

Hence,

5x + 5x + 50 = 850

10x = 850 - 50

10x = 800

x = 80

Train A = 80 miles per hour

Train B = 80 + 10 = 90 miles per hour

If f(x) = 4x - 8, what is the value of f(-3)?

Answers

Answer:

-20

Step-by-step explanation:

f(x)= 4x-8 f(-3)

y= 4(-3) -8

y= -12 -8

y= -20

__7. Cooling Tea: A freshly made cup of tea is served at a temperature of about 180°F. The tea

cools rapidly at first, and then slows down gradually as it approaches room temperature.

Independent Quantity:

Dependent Quantity:

Answers

Time is always independent. Time depends on nothing, no matter what other quantity is changing time will continue to move, and it will always move in the same way (seconds, minutes, hours, and so on never change their duration).

The dependent quantity would be temperature. How hot the tea is depends on how much time has passed.

Let g be a polynomial function of x where g(x) = 2x^3+ 3x^2-5x-6 . If (x+2) is a factor of g, write an equation for g as the product of linear factors

Answers

Answer:

[tex]2x^3+ 3x^2-5x-6 = (x+2)(x+1)(2x+3)[/tex]

Step-by-step explanation:

Given polynomial [tex]g[/tex]:

[tex]g(x) = 2x^3+ 3x^2-5x-6[/tex]

A factor of polynomial is [tex](x+2)[/tex].

To find:

Equation of the polynomial as the product of linear factors.

Solution:

First of all, let us divide the polynomial [tex]g[/tex] with [tex](x+2)[/tex] to find the other factors.

As degree of polynomial is 3, when divided by a linear equation, it will result in a quadratic.

That quadratic will have 2 solutions.

Solving the quadratic in linear will give us the answer.

Result of division:

[tex]\dfrac{2x^3+ 3x^2-5x-6}{x+2} =2x^2-x-3[/tex]

Now, solving the quadratic:

[tex]2x^2-x-3 = 2x^2-3x+2x-3 \\\Rightarrow x(2x-3)+1(2x-3)\\\Rightarrow (x+1)(2x-3)[/tex]

So, the linear equation can be written as:

[tex]2x^3+ 3x^2-5x-6 = (x+2)(x+1)(2x+3)[/tex]

Will give BRAINLIEST The two points and (–3, –2) and (4, 8) are part of a line with a slope of:

Answers

Answer:

slope of 10/1 or simplified to 10

Step-by-step explanation:

Answer:

slope is 10/7

Step-by-step explanation:

use the formula or plot the points on a graph to get the slope is 10/7

At a football stadium, 4% of the fans in attendance were teenagers. If there were 120 teenagers at the football stadium, what was the total number of people at the stadium?

Answers

1200 divided by 4%= 3000

A 20,000 gallon swimming pool contains 5000 gallons of water when a hose is placed in the pool and begins adding water at a rate of 1250 gallons per hour.



Use the Segment tool to plot a graph representing the volume of water in the pool over time from when the hose is placed in the pool until the pool is full.

Answers

Answer:

The volume of water in the pool over time from when the hose is placed in the pool until the pool is full is defined by the equation  and its graph is given below.

Explanation:

The total capacity of the pool is 20,000 gallon.

It is given that the pool contains 5000 gallons of water when a hose is placed in the pool and begins adding water at a rate of 1250 gallons per hour. So the initial volume of water is 5000.

Let the time is defined by t. So, the volume of water in the pool after time t is defined as,

The capacity of the pool is 20,000 gallon, therefore the maximum value of V(t) is 20,000.

The maximum value of t is 12, since the time is always positive, therefore we can say that,

The below graph representing the volume of water in the pool over time from when the hose is placed in the pool until the pool is full. The initial point is (0,5000) and the other point is (12,20000).

Answer:

the two points will be (0,5000) and (12,20000

Step-by-step explanation:

The sum of the digits of a two-digit number is 12. The number formed by reversing the digits is 54 more than the original number. What is the original number?

Answers

Answer:

39

Step-by-step explanation:

let the 2 digit number be ab = 10a + b ( considering place value )

The reversed  2 digit number is ba = 10b + a

The sum of the 2 digit number is

a + b = 12 ( subtract b from both sides )

a = 12 - b → (1)

Expressing as an equation

ba = ab + 54 , that is

10b + a = 10a + b + 54

Substitute a = 12 - b into the equation

10b + 12 - b = 10(12 - b) + b + 54 , simplify both sides

9b + 12 = 120 - 10b + b + 54

9b + 12 = - 9b + 174 ( add 9b to both sides )

18b + 12 = 174 ( subtract 12 from both sides )

18b = 162 ( divide both sides by 18 )

b = 9

Substitute b = 9 into (1)

a = 12 - 9 = 3

Thus

the original 2 digit number = ab = 39

The reversed 2 digit number = ba = 93

which is 54 more than the original number

74 is a rational number but not a whole number. 74 is a whole number but not a rational number. 74 is a whole number and a rational number. 74 is not a rational number, and it is not a whole number.

Answers

Answer:

Option C: 74 is both a whole number and a rational number.

Step-by-step explanation:

A rational number is defined as a number which can be written as a fraction of two integers, an integer, a whole number and a natural number. The integer could be positive or negative.

Examples include -1/4, 1/2, 12

So it's obvious that the given number of 74 is a rational number.

Now, a whole number is simply a non - negative integer.

An integer is a number that is not a fraction.

Thus, examples of whole numbers are 0, 1, 2, 3, 4...

So 74 is clearly a whole number.

Therefore, we can conclude that 74 is both a whole number and a rational number.

You buy 2.6 pounds of grapes for $1.40 per pound. You hand the cashier a $5 bill. How much change will you receive?

Answers

$1.40*2.6= $3.64

$5-$3.64=

Answer is $1.36

Kaley and Tom both work at Publix as cashiers for $7.68 per hour. This week Kaley worked 5 more hours than Tom in overtime. Write an expression that represents the weeks' wages for Kaley and Tom combined if h represents the number of hours Tom worked?

Answers

Answer:

X=5+h

Step-by-step explanation:

for the function f(x) = 2(8)^x evaluate f(2)

Answers

Answer:

f(2)=128

Step-by-step explanation:

f(x) = 2(8)^x evaluate f(2)

f(2)= 2(8)^2

f(2)=2(64)

f(2)=128

Review the graph of complex number z.

On a coordinate plane, the y-axis is labeled imaginary and the x-axis is labeled real. Point z is at (5, negative 5).

What is the polar form of z?

Answers

Answer:

It is D

Step-by-step explanation:

Looking at the Graph the point is at 5-5i

the only polar form that solves to 5-5i is D.

Also I did it on Edge.. Good Luck!

The complex number z represented on the graph (5, -5) is given as 5√2[cos(-π/4) + isin(-π/4)] in polar form

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables.

Given the complex number z represented on the graph as (5, -5). Therefore:

r = √(5² + 5²) = 5√2

Ф = tan⁻¹(-5/5) = -π/4

The complex number z represented on the graph (5, -5) is given as 5√2[cos(-π/4) + isin(-π/4)] in polar form

Find out more on equation at: https://brainly.com/question/2972832

#SPJ2

Write an equation in standard form of the line that passes through the given point and the given slope. (-9, -4); m = -1/3

Answers

Answer:

First, we must determine b using slope-intercept form*, the given point, and the given slope.

[tex]-4 = -\frac{1}{3}(-9) + b\\\\-4 = -3 + b\\\\-1 = b[/tex]

Second, we need to set up the equation of the line in slope-intercept form.

[tex]y = -\frac{1}{3}x - 1[/tex]

Third, we convert the above equation to STANDARD FORM**.

[tex]y = -\frac{1}{3}x - 1\\\\\frac{1}{3}x + y = -1[/tex]

We now have our equation: [tex]\frac{1}{3}x - y = -1[/tex]

*Slope-intercept form: y = mx + b

**Standard form: ax + by = c

HELP ASAP. ABC is an isosceles triangle.

Answers

Answer:

please make it more clear

Step-by-step explanation:

what you are asking

Please ask your question full not sure what you mean by this

help ill give you brainliest

Answers

16x^0=16(1)=16
2(2)^2=8
(4)^-1=1/4
8•1/4=2
16+2=18
The answer will be 18.
USE PEMDAS!
Other Questions
What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text? Describe your closet figuratively The equation f equals 9/5 C + 32 relates temperature measured in degrees celsius C to degrees Fahrenheit f Determine whether there is a proportional relationship between C and F explain your reason According to the following reaction, how many grams of sulfur are formed when 37.4 g of water are formed? 2HS(g) + SO(g) 3S(s) + 2HO(l) Explain reasons for 13 colonies 2. What are the two types of deeds that make up the hero's journey? what plan has been made for the HRD in nepal? I do not breathe, but I run and jump. I do not eat, but I swim and stretch. I do not drink, but I sleep and stand. I do not think, but I grow and play. I do not see, but you see me every day. What am I? Both pieces of writing attacked the practices of the Catholic Church. Yet one led to a complete break, while the other did not. What in Luthers words seems uncompromising, and what in Erasmus words leaves more room for reform? What is the main function of the small intestine?(use terms : villi, surface area,blood capillaries,why must large molecules be broken down, high concentration and low concentration.) can anyone just explain how to do a distant rate time problems because I'm confused about them -4/9 divided by 2/3 what would the answer be? (First to answer gets brainiest)What three languages did theRosetta Stone, discovered in AncientEgypt, contain?A. Arabic, Baltic, and EnglishB. hieroglyphic, English and SomaliC. hieroglyphic, demotic and EnglishD. hieroglyphic, demotic and Greek What enrionmental factor can people with pku control to prevent building up extra phenylalanine in thier brains "God lends a helping hand to the man who tries hard". Justify the quote with reference to the lesson Weathering the storm in ersama Read and choose the correct option to complete the sentence.Antes de viajar el viernes, voy a ________ la ropa en la maleta. (1 point) aempacar bhacer cplanificar dpoder Pls help me8th grade English Can Anybody Help With Geometry Work? Please help with this question; I need to prove to my parents I am not as much of a disappointment to them as they think I am.