Answer:
It's a non-polar covalent bond.
Explanation:
Non-polar means they do not interact with water. Carbon dioxide and Oxygen bonded together by sharing electrons equally.
what is the role of microfilaments in cell division
Answer:
. Microfilaments help the cell lay down new membrane and divide into two daughter cells.
Explanation:
Which of the following refers to the transformation of stimulus energy into neural impulses?
A) Perception
B) Bottom-up processing
C) Top-down processing
D) Transduction
E) Psychophysics
The conversion or the transformation of the stimulus energy into the neutral impulses is know as transduction referring to the five senses. The perception s the process that leads tp the stimulus energy into the neutral impulses.
For example the hue or color and its dimension are determined by the wavelength of light that is perceived.Hence the option A is correct.
Learn ore about the refers to the transformation of stimulus.
brainly.com/question/18958345.
#5 and 6 pleasee I will give you 100 points
6)it is bigger then we ever thought and that we wont beable to explore it all..
CORRECT ME IF I AM WRONG
6) it is bigger then we ever thought and that we wont beable to explore it all
sorry if this didnt help
all female mammals have one active x chromosome per cell instead of two. what causes this?
Answer:
maybe its because of pregnancy
Explanation:
74 POINTS!!!!
How could addressing market failure help make an economy more environmentally sustainable?
Answer:
If companies are held accountable upfront for the consequences their actions will have on the environment, their actions may be more environmentally friendly from the beginning.
How does a substance cross the cell membrane in diffusion?
a- flowing down the concentration gradient
b- binding to a carrier protein
c- going through a pump
d- going through a channel protein
(ck-12)
Answer:
A
Explanation:
skeletal muscle exhibits alternating light and dark bands called
Skeletal muscle exhibits alternating light and dark bands called a sarcomere
Skeletal muscle is having sarcomere having myofibrils which appear dark and light in the microscope.
What is skeletal muscle?Only thin filaments containing actin are present in isotropic bands, anisotropic bands are the darker bands (A bands).
Repeating sarcomere sections, which are visible under the microscope as alternating dark and light bands, make up myofibrils.
When a muscle contracts or relaxes, long, fibrous protein filaments called sarcomeres glide past one another. Because of this, skeletal muscle is also known as striated muscle.
Therefore in appearance due to myofibrils composed of the sarcomere look light and dark bands in the skeletal muscle under a microscope.
Learn more about skeletal, here:
https://brainly.com/question/29215804
#SPJ2
easy - one giving brainly if correct AND DETAILED!
please give me at least 2.
Well you see theres this guy named MrBeast thats taking little kids money and is having one of his slaves eat a water bottle for every dollar
Answer:
Well recently Team Seas has come out for every dollar donated I think it's 1 pound of trash so by donating would be one.
The second would be volunteering to help clean up for example a beach.
For more lasting impact would be to have a machine that collects the trash at where the rivers and streams meet the ocean this will lead to less trash in the ocean. There is a great example of this machine by Mark Rober gives a detailed explanation.
where are the proteins of the electron transport chain located in a eukaryotic cell?
Answer:
In eukaryotes, the electron transport chain is located in the inner mitochondrial membrane. In prokaryotes, it is located within the plasma membrane
which term describes the ability of neurons to process information, store and recall it, and make decisions?
Answer:
Neural Integration
Explanation:
:)
A bar graph and a pie graph are the same thing.
A. True
or
B. False
Explain your observations. What did you observe as you added phenolphthalein to the ammonia solution? What did you observe when vinegar was added?
Answer:
Liquid ammonia is liquefied ammonia and is basic in nature. It dissolves in water to give ammonium hydroxide which ionizes to give hydroxyl ions. Therefore it turns red litmus blue and phenolphthalein solution pink.
The cell membrane is said to be semipermeable because
Answer:
The membrane is selectively permeable because substances do not cross it indiscriminately.
Explanation:
quién me ayudaría a hacer este crusigrama
gracias
Answer:
Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:
Explicación: 1.Venezuela
2. Sanclemente
3. Marroquin
me das corona plis chau
Explanation:
21. Three different processes are occurring in the drawing below. Name each process and describe it.
Answer:
Process A is diffusion
- diffusion is the random movement of molecules from the area where there is more of them to an area where there is a few of them without the input of energy.
Process B is facilitated diffusion
- facilitated diffusion is the transport of substances across a cell membrane from an area of higher concentration to a lower concentration with the help of Transport protein
Process C is active transport
- A ctive transport is when an input of energy is required to move materials through a cell membrane .
What are characteristics that are unique to wetlands?
Answer:
Wetlands must have one or more of the following three attributes: 1) at least periodically, the land supports predominantly hydrophytes; 2) the substrate is predominantly undrained hydric soil; and 3) the substrate is saturated with water or covered by shallow water at some time during the growing season of each year.
Explanation:The minimum essential characteristics of a wetland are recurrent, sustained inundation or saturation at or near the surface and the presence of physical, chemical, and biological features reflective of recurrent, sustained inundation or saturation.
how can an understanding of osmosis be important in developing methods for the same storage of food?
Osmosis is also used for preserving fruits and meats, though the process is quite different for the two. In the case of fruit, osmosis is used to dehydrate it, whereas in the preservation of meat, osmosis draws salt into it, thus preventing the intrusion of bacteria.
Whales and hippos are thought to have evolved from a common ancestor around 54 million years ago. Which of the following is also true about these species?
Answer:
Both whales and hippos have almost no hair on their bodies. They do not have sweat glands.
Explanation:
Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:
Answer:
y is there so much letters?
How are male and female reproductive organs similar?
Answer: They are the same in that most of the reproductive organs of both sexes develop from similar embryonic tissue, meaning they are homologous. Both systems have gonads (male have testes and female have ovaries) that produce gametes (testes produce sperm and ovaries produce egg or ovum) and sex organs.
easy question - giving brainly if correct !!
Answer:
i think its C
Explanation:
i would go with c
hii everyone i have question again which substances made gages
What is the question???
nucleic acids are assembled in the _____ direction.
Nucleic acids are assembled in the 5' to 3' direction during DNA replication. DNA replication is the process of duplication of DNA molecule.
What are Nucleic acids?Nucleic acids are the biomolecules occurring in the chemical compounds which serve as the primary information-carrying molecules in the cells. Nucleic acids play an important role in directing the process of protein synthesis. The two main classes of nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).
Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction and these can be assembled in the same direction in cell, as the polymerases which assemble various types of new strands generally rely on the energy which is produced through breaking the nucleoside triphosphate bonds to attach these new nucleoside monophosphates to the 3′-hydroxyl (−OH) group, through a phosphodiester bond.
Learn more about Nucleic acids here:
https://brainly.com/question/11309892
#SPJ6
5. What natural phenomenon converts nitrogen into the form which organisms can use?
Answer:
the nitrogen cycle
Explanation:
what does the doctor inject into the child to make the child immune to measles
Answer:
MMR vaccine
Explanation:
CDC recommends that children get MMR vaccine to protect against measles, mumps, and rubella.
How is the word Representation used in a sentence
Answer:
A graphical representation of results is shown in figure 1. 17. He gave a talk on the representation of women in 19th-century art. ... He is writing a book on the representation of woman in medieval art
what do you call an organism that has been genetically engineered to contain a gene from a different species?
Answer:
A transgenic, or genetically modified, organism is one that has been altered through recombinant DNA technology, which involves either the combining of DNA from different genomes or the insertion of foreign DNA into a genome.
Explanation:
Answer:
This would be called a transgenic or genetically modified organism.
Explanation:
A transgenic or genetically modified organism is one that has been altered through something called recombinant DNA technology. Which involves either the combining of DNA from different genomes or in another case the insertion of foreign DNA into a genome.
the age of a woolly mammoth can be determined by examining what?
Answer:
examining the tusks, bones, teeth, (carbon levels in tissues depends)
Explanation:
Carbon-14 can be used to date the remains of dead organisms because all living things use carbon to build tissue.
The biological age of mammoths (also known as the "age at death") is usually estimated by comparison to correlations between the biological age and the wear stages of grinding teeth in extant elephants. As tusks grow, they continually incorporate ingested strontium (Sr), and the incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to investigate proboscidean movements
scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends)
What are Mammoth?All living things need carbon to create tissue, making carbon-14 a useful tool for dating the remains of deceased species.
Mammoths' biological age, also known as the "age at death," is typically calculated by comparing it to correlations between that age and the phases of tooth wear in living elephants.
The incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to study proboscidean movements as tusks continuously integrate ingested strontium (Sr).
Therefore, scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends).
To learn more about Mammoth, refer to the link:
https://brainly.com/question/24163999
#SPJ2
what is occurring during the s phase of the cell cycle?
Concentration of water in a solution outside the cell is 30% The concentration of
water inside the cell is 70%. In what direction will the solvent move if diffusion
occurs? Is energy required?
Answer:
water will move out of the cell,energy is required
Explanation:
water moves through osmosis which is the movement of water molecules from a region of higher concentration to a region of lower concentration.