Which of the following is not an example of work being done on an object?

Pushing on a rock that will not move

Paddeling a canoe down a river

Lifting a bag of groceries

Throwing a ball across a field​

Answers

Answer 1

Answer:

Lifting a bag of groceries

Answer 2

Answer:

paddeling a canoe down a river :D or throwing a ball across a field

Explanation:


Related Questions

Introduction to Simple Machines
This activity will help you meet this educational goal:
You will compare and contrast information from a video with information from a text.

Directions
Read the instructions for this self-checked activity. Type in your response to each question, and check your answers. At the end of the activity, write a brief evaluation of your work.
Activity
Watch this video and then answer the following questions based on what you learned.

Part A
How does a bicycle make work easier?





Part B
Which two examples of levers are mentioned in the video?








The picture shows a bicycle’s pedals. Look at the shaft that the pedals are attached to. Do you think the shaft is a lever? Why or why not?

Answers

Answer:

word for word answers!

Explanation:

1) Part A: By pedaling a bicycle lightly, the rider can go a long way

2) Part B: The two examples mentioned in the video are the handlebars and the brakes

3) Yes, it’s a type of lever because the two pedals rotate around a fixed point

A string with mass per unit length of 0.003 kg/m is plucked with an amplitude of 2 cm. The string is 30 cm long, and under a tension of 30 newtons. What are the frequencies of the first 5 harmonics?

Answers

Answer:

First harmonics = 333.33N

Second harmonics = 500.01N

Third harmonics = 666.68N

Fourth harmonics = 833.35N

Fifth harmonics = 1000.02N

Explanation:

The formula for calculating the fundamental frequency in string is expressed as;

[tex]F_0 = \frac{1}{2L}\sqrt{\frac{T}{m} }[/tex] where;

L is the length of the string = 30cm = 0.3m

T is the tension in the string = 30N

m is the mass per unit length of the string = 0.003kg/m

Get the fundamental frequency first by substituting the given values into the formula;

[tex]F_0 = \frac{1}{2(0.3)}\sqrt{\frac{30}{0.003} }\\F_0 = \frac{1}{0.6}\sqrt{10,000}}\\F_0 = \frac{1}{0.6} * 100\\[/tex]

F0 = 166.67N

Harmonics are the integral multiples of the fundamental frequency.

First harmonics F1 = 2F0 = 2(166.67) = 333.33N

Second harmonics F2 = 3F0 = 3(166.67) = 500.01N

Third harmonics F3 = 4F0 = 4(166.67) = 666.68N

Fourth harmonics F4 = 5f0 = 5(166.67) = 833.35N

Fifth harmonics F5 = 6f0 = 6(166.67) = 1000.02N

Which objects cannot be observed in detail without a microscope?

Answers

Answer:

partecls

Explanation:

because they are to small to see with plain eyes

____________ is an individual sport that helps develop your hand-eye coordination.


Table Tennis


Ice Skating


Swimming

Answers

Answer:

Answer option A) Table Tennis helps develop your hand-eye coordination.

Answer:

table tennis

Explanation:

Describe how radiant energy, light energy, and solar energy are related. ( Please ❤️ )

Answers

Answer:

L’énergie solaire récolte l’énergie radiante portée par la lumière de notre soleil en la convertissant en électricité.Biomasse des plantes. Les plantes sont capables d’exploiter et d’utiliser l’énergie lumineuse dans un processus appelé photosynthèse.

Answer:

Radiant energy, light energy, and solar energy are related because The Sun produces a lot of radiant energy that is transmitted to Earth as light. Plants convert the electromagnetic energy in sunlight into chemical energy for their food, through a process called photosynthesis. Waves of radiant electromagnetic energy can be visible or invisible.

Explanation:

When weather predictions are incorrect what is the most likely cause
A: measurements of the initial conditions may have been very in accurate

B: small differences in models can lead to large differences in complex systems

C: The person predicting the weather may have had a bias

D: The elevation of different landforms I have been significantly in accurate

Answers

Answer:small differences in models can lead to large differences in complex systems

Explanation:   this is the  most accurate phrase  

If a body having mass 40kg started moving initially with rest and it takes a velocity of 20m/sec in time 4 seconds. Find the value of force​

Answers

[tex]{\mathfrak{\underline{\purple{\:\:\: Given:-\:\:\:}}}} \\ \\[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Mass \ of \ the \ body \ (m) = 40 \ kg}[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Final \ velocity \ of \ the \ body \ (v) = 20 \ m/s}[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Initial \ velocity \ of \ the \ body \ (u) = 0}[/tex]

[tex]\\[/tex]

[tex]{\mathfrak{\underline{\purple{\:\:\:To \:Find:-\:\:\:}}}} \\ \\[/tex]

[tex]\:\:\:\:\bullet\:\:\:\sf{Force \ exerted \ by \ the \ body \ ( F)}[/tex]

[tex]\\[/tex]

[tex]{\mathfrak{\underline{\purple{\:\:\: Solution:-\:\:\:}}}} \\ \\[/tex]

Using 1st equation of motion

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{v = u + at}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{20 = 0 + a(4)}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{20 = 4a}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{\dfrac{\cancel{20}}{\cancel{4}} = a}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{a = 5}[/tex]

[tex]\\[/tex]

Now, Finding the force exerted

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{F = ma}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{F = 40 \times 5}[/tex]

[tex]\\[/tex]

[tex]\dashrightarrow\:\: \sf{F = 200 \ N}[/tex]

[tex]\\[/tex]

Hence, [tex]\\[/tex]

[tex]\:\:\:\:\star\:\:\:\sf{The \ force \ exerted \ by \ the \ body \ is \ 200N}[/tex]

What is the approximate distance from the sun to the astroid belt?

Answers

Answer:

The asteroid belt lies between 2.2 and 3.2 astronomical units (AU) from our sun. ( i looked this up because nobody of the top of their head knows this)

Explanation:

You throw a baseball (mass 0.145 kg) vertically upward. It leaves your hand moving at 12.0 m/s. Air resistance can be neglected.
A. At what height above your hand does the ball have half as much upward velocity?
B. At what height above your hand does the ball have half as much kinetic energy as when it left your hand?

Answers

Answer:

Explanation:

A ) initial velocity u = 12 m /s

final velocity v = 6 m /s

height = h

acceleration = - g = - 9.8 m /s²

v² = u² - 2gh

6² = 12² - 2 x 9.8 x h

h = 5.51 m

B )

Let the final velocity when energy becomes half be V at height H

kinetic energy at height h = 1/2 m V²

Given ,

.5 x 1 / 2 m x 12² = 1/2 m x V²

V² = 12² / 2

V = 8.486 m /s

V² = u² - 2 gH

8.486² = 12² - 2 x 9.8 x H

H = 3.67 m .  

Changing which factor would NOT have an influence on the kinetic energy of a moving van loaded with 100 kg bags mulch of with a total mass of 1,500 kg. The vehicle is traveling across an open parking lot at a speed of 5 m/s.
Question 8 options:


A: direction the moving van is going across the parking lot.


B: increasing the rate of speed without altering the mass of the vehicle or its contents.


C: emptying the moving van one bag at a time at a constant rate.


D: adding more contents (increasing the overall mass) to the van while the van is in motion traveling 5 m

Answers

Answer:

A. The direction

Explanation:

I did the test lol

Answer:

A

Explanation:

i took the test

Find the binding energy per nucleon for the plutonium isotope 239Pu. The mass of the neutral atom is 239.05216 u.

Answers

Answer:

The answer is "[tex]\bold{7.56 \ Me\ V}[/tex]".

Explanation:

calculating the binding energy on per nucleon:

calculating number of proton and neutrons:

proton [tex]P_u=94[/tex]

neutron[tex]= 239-94=145[/tex]

calculating mass:

proton mass [tex]\ m_P=1.007825 \ amu\\\\[/tex]

neutron mass [tex]\ m_n=1.008665 \ amu\\\\[/tex]

neutral atom mass [tex]m = 239.05216 \ amu\\\\[/tex]

mass of prtons[tex]= 94 \times 1.007825 = 94.73555 \ amu\\\\[/tex]  

mass of neutrons[tex]= 145 \times 1.008665= 146.256425 \ amu\\\\[/tex]

Total nucleons mass formula:

[tex]\to m_n = (P+n)[/tex]

          [tex]= 94.73555+ 146.256425\\\\= 240.991975 \ amu[/tex]

calculating the mass of defect:

[tex]\to \Delta m= m_n-m\\\\[/tex]

           [tex]= 240.991975 - 239.05216\\\\= 1.939815 \ amu\\\\[/tex]

calculating the total of the binding energy:

[tex]\to BE=\Delta m\times 931.5 \ mev[/tex]

          [tex]= 1.939815 \times 931.5\\\\=1806.938 \ Me \ V\\\\[/tex]

BE in per nucleon [tex]=\frac{BE}{239}= 7.56 \ Me\ V[/tex]

The voltage provided by the battery of a circuit was 12 V, if the total
resistance in the circuit was 6 ohms, calculate the total current present.
options:
72 A
2A
0.5 A
7.2 A​

Answers

Answer:

2 Amps

which agrees with the second option in the list of answers

Explanation:

Use Ohm's law:

V = R * I

which with the information given to us becomes:

12 = 6 * I

then solving for I we get:

I = 12 V / 6 Ω = 2 Amps

Is a seashores diverse or uniform?

Answers

Answer:

uniformes

Explanation:

Why are u asking this

A cannonball is fired at a 45.0° angle and an initial velocity of 670 m/s. Assume no air resistance. How high did the cannonball travel?
9935 m
11454 m
754 m
13200 m

Answers

13200 m , hope this help

Pretty simple physics :) will give brainliest
pls dont just use me for points

Answers

Answer:

meter per second(m/s)

Explanation:

What is the initial vertical velocity of the ball?
A.
0 m/s


B.
9.81 m/s


C.
20.0 m/s


D.
60.0 m/s

Answers

I think that it is B hope this helps

A 100 kg man stands still. Gravity pushes on him with an acceleration of 9.8 m/s^2. What it the force the man feels from gravity? *
0 N
98 N
90 N
980 N

Answers

Answer:

980 N

Explanation:

The force acting on an object given it's mass and acceleration can be found by using the formula

force = mass × acceleration

From the question we have

force = 100 × 9.8

We have the final answer as

980 N

Hope this helps you

The glowing dot represents the transmission of a nerve impulse along the nerves that make up the neural pathway. A nerve impulse is an electrical signal that travels from one nerve cell to another.

Which part of the brain processes this signal?

Answers

Answer:

The answer is "Cerebral Cortex"

Explanation:

The neurotransmitter diffuses across the short distance of the synapse and ties to a receptor protein of the objective neuron. At the point when the sub-atomic sign ties to the receptor, the cell film of the objective neuron changes its electrical state and another evaluated expected starts. On the off chance that that evaluated potential is sufficiently able to arrive at limit, the subsequent neuron produces an activity potential at its axon hillock. The objective of this neuron is another neuron in the thalamus of the mind, the piece of the CNS that goes about as a transfer for tactile data.

At another neurotransmitter, synapse is delivered and ties to its receptor. The thalamus at that point sends the sensory information to the cerebral cortex, the furthest layer of dark issue in the brain, where cognizant view of that water temperature starts.

A region of the cortex is particular for imparting signs down to the spinal cord for development. The upper engine neuron is in this area, called the precentral gyrus of the frontal cortex, which has an axon that broadens right down the spinal cord. At the degree of the spinal cord at which this axon makes a neurotransmitter, a reviewed potential happens in the cell membrane of a lower engine neuron.

A solid CUBE has a side of 4cm and is 192 grams in mass. What is the density?

Answers

Answer:

3g/cm³

Explanation:

Given parameters:

Length of the side  = 4cm;

  Volume of the cube  = L³  = 4³  = 64cm³

Mass of the cube  = 192g

Unknown:

Density = ?

Solution:

The density of a body is its mass per unit volume;

 Density = [tex]\frac{mass}{volume}[/tex]  

Insert parameters and solve;

Density  = [tex]\frac{192}{64}[/tex]  = 3g/cm³

Students had two batteries and two different resistors. During four trials, they build four different circuits and measure the circuit’s current in Amps according to the following table.



Trial Number

Voltage (V)

Resistance (Ω)

Current (A)

1

1.5

200


2

1.5

100


3

3.0

200


4

3.0

100




For which trial would the students measure the smallest current in the circuit? (AKS 10a)



A.
Trial 1

B.
Trial 2

C.
Trial 3

D.
Trial 4

Answers

Answer:

bhi jo bhi of gp oh oh gi IG 7u to uff do if goo td to yd do FP ae rt 7g hi pic vo icon

Explanation:

bh hi h bhi vc di oh x At jb jo iv hp of di of dr hi o hc x gh ki vc hi jo

plz help asap.

1. Describe the methods by which an electric potential develops in primary cells and dry cells.
2. Describe the methods by which an electric potential develops in generators and thermocouples.
3. Identify the scenarios below as to whether they would increase or decrease the resistance of an electric current through a body.

a. Increase the length of the conductor
b. Utilize a conductor with a larger cross-section
c. Cool the conductor to lower its temperature

4. If 0.8 Wh of electrical energy is lost as heat, how much heat energy (in Btu) is produced?
5. How many kilowatt-hours of energy would be used by a 40 W bulb that runs for 10 hours every day during the course of one year?

Answers

Not my answer but nevertheless

Answer:

Electric potential develops in primary/dry cells through a chemical reaction between the cell plates of the cell. free electrons move from the zinc plate to the copper plate through a conducting material.  

Electric potential develops in Generators via magnetic induction i.e. the movement of a conducting rod through the magnetic field between the poles of the horseshoe magnets produces Electric potential in Generators.

Electric potential develops in thermocouples via heat transfer ; A heat source is applied to the connecting end of the thermocouple strips and this will cause the production electric charges ( potential ) at the free ends

3) Identifying effect of each scenerio

a) The resistance of an electric current will increase when the length of the conductor increases

b) The resistance of an electric current through a body will decrease when the conductor has a larger cross-section

c) The resistance of an electric current through a body will decrease when the temperature of the conductor is cooled

4) The amount of heat lost as heat in Btu = 2.73 Btu

amount of heat lost = 0.8 Wh

convert to Btu = 0.8 Wh / 0.293 = 2.73 Btu   ( note : 1 Btu = 0.293 Wh )

5) The amount of of energy used by a 40 W bulb for 365 days = 146 kWh

Power of bulb = 40 W

Run time = 10 hours * 365 days

∴ amount of energy used = 3650 * 40 = 146 * 10^3 Wh = 146 kWh

The wavelengths corresponding to the harmonics of an organ pipe that is open at one end and closed at the other can be found by saying that the length of the pipe must be equal to:___________.
A. an integer number of wavelengths.
B. an odd number of half-wavelengths.
C. an integer number of half-wavelengths.
D. an odd number of quarter-wavelengths.

Answers

Answer:

The answer is "Option D"

Explanation:

Its ranges referring to the harmonic currents of its organ pipe which are open at one end and shut at another side could be noticed saying whether a strange amount of quarter-wavelengths should equal the length of its pipe. It's also the fourth wavelengths principle to have enough space and consume a minimum of 25% of our design frequency, as we're going to be taking 40 Hz.

find the vector parallel to the resultant of the vector A=i +4j-2k and B=3i-5j+k​

Answers

Answer:

2008

Explanation:

2000+3+5======2008

Answer:

[tex]8\hat i-2\hat j-2\hat k[/tex]

Explanation:

Vectors in 3D

Given a vector

[tex]\vec P = P_x\hat i+P_y\hat j+P_z\hat k[/tex]

A vector [tex]\vec Q[/tex] parallel to [tex]\vec P[/tex] is:

[tex]\vec Q = k.\vec P[/tex]

Where k is any constant different from zero.

We are given the vectors:

[tex]\vec A = \hat i+4\hat j-2\hat k[/tex]

[tex]\vec B = 3\hat i-5\hat j+\hat k[/tex]

It's not specified what the 'resultant' is about, we'll assume it's the result of the sum of both vectors, thus:

[tex]\vec A +\vec B = \hat i+4\hat j-2\hat k + 3\hat i-5\hat j+\hat k[/tex]

Adding each component separately:

[tex]\vec A +\vec B = 4\hat i-\hat j-\hat k[/tex]

To find a vector parallel to the sum, we select k=2:

[tex]2(\vec A +\vec B )= 8\hat i-2\hat j-2\hat k[/tex]

Thus one vector parallel to the resultant of both vectors is:

[tex]\mathbf{8\hat i-2\hat j-2\hat k}[/tex]

Two cylinders each with a 60 cm diameter, thatare closed at one end, open at the other, are joined to form asingle cylinder, then the air inside is removed.
How much force does the atmosphere exert onthe flat end of each cylinder?
Suppose one cylinder is bolted to a sturdy ceiling. How many 90 kg football players would need to hang from the lower cylinder to pull the two cylinders apart

Answers

Answer:

a

The force is  [tex]F = 2864561.4 \ N[/tex]

b

The number is [tex]N = 3248 \ players[/tex]

Explanation:

From the question we are told that

    The  of each cylinder is  [tex]d = 60 \ cm = 6 \ m[/tex]

     The mass of the players is  [tex]m = 90 \ kg[/tex]

Generally the cross-sectional  area of the cylinder is mathematically represented as

     [tex]A = \pi * \frac{d^2}{4}[/tex]

=>  [tex]A = 28.3 \ m^2[/tex]

Generally force exerted on the flat end of each cylinder is mathematically represented as

      [tex]F = A * P[/tex]

Here P  is the atmospheric pressure with value  [tex]P = 101300 \ Pa[/tex]

So

       [tex]F = 28.3 * 101300[/tex]

=>    [tex]F = 2864561.4 \ N[/tex]

Generally the weight of a single football player is  

        [tex]W = m * g[/tex]

=>     [tex]W = 90 * 9.8[/tex]

=>     [tex]W = 882\ N[/tex]

Generally the number of player required to pull the two cylinders apart is mathematically represented as

       [tex]N = \frac{ F }{W}[/tex]

=>     [tex]N = \frac{ 2864561.4 }{882}[/tex]

=>     [tex]N = 3248 \ players[/tex]

what is the need of force in our life​

Answers

Answer:

A force is a push or a pull and it affects our daily lives because without force,people would not be able to open and close stuff or lift up our arms or legs .....or anything, for that matter.

Explanation:

brainly

Without forces, we couldn’t live. If you push or pull on an object a force is being applied. Forces can also make objects stay
where they are

What is causing the boat to move toward the shore?
A
The moving water applies a force on the boat, which results in the boat pushing
back on the water, propelling the boat forward.
B
The moving wind applies a force on the boat, which results in the boat pushing
back on the wind, propelling the boat forward.
с
The boy applies a force on the oars, which results in the water pushing back on
the oars, propelling the boat forward.
D
The boy applies a force on the oars, which results in gravity pushing back on the
oars, propelling the boat forward.

Answers

Answer:c

Explanation:because when u push the oar back u go forward

Answer:

It's C. Because this is a Newton's 2nd Law about force and acceleration and he's putting force on the oars which is making the boat goe forward due to the water and the movements.

Explanation:

Sb +
Cl2 →
SbCl3
Balance chemical equation

Answers

Answer:

Cl2 + Sb → SbCl3

Cl2 + Sb → SbCl5

Cl2 + Sb → SbCl

Cl2 + Sb → SbCl2

Cl2 + Sb → SbCl3 + SbCl5

Explanation: Hope it will help

To balance the chemical equation Sb + Cl₂ → SbCl₃ on further simplification The final balanced chemical equation is Sb + 3Cl₂ → SbCl₃.

Let's start by balancing the antimony (Sb) atoms:

On the left side, we have 1 Sb atom, and on the right side, we also have 1 Sb atom. The antimony is already balanced.

Next, let's balance the chlorine (Cl) atoms:

On the left side, we have 2 Cl atoms, and on the right side, we have 3 Cl atoms. To balance the chlorine, we need to multiply the Cl₂ on the left side by 3:

Sb + 3Cl₂ → SbCl₃

Now, the chlorine atoms are balanced.

The final balanced chemical equation is:

Sb + 3Cl₂ → SbCl₃

To know more about balanced chemicals equation:

https://brainly.com/question/34199830

#SPJ6

Which of the following statements are true of cancer types? Check all that apply. --
- Cancer is named according to the color the cells turn.
- Skin cancer is considered a very common type of cancer.
- Cancer is often named according to what body type it affects.
- Skin cancer is the least common type of cancer.

Answers

the answer is cancer is often named according to what body type it affects

Answer:

B,C

Explanation:

skin cancer is considered a very common type of cancer. Cancer is often named accordingly to a body type it affects.

which of the following is true of phototsythesis but not of cellular respiration.

A- Photosynthesis releases oxygen gas as a product
B- Photosynthesis occurs in all organisms
C- Photo synthesis is a process in which glucose i broken down
D- Photosynthesis requires glucose as a reactant

Answers

Answer:

B. Photosynthesis occurs in all organisms

Hope this helps!! :)

A fluid of density rho = 900 kg/m3 flows along a pipe of constant diameter from point A to point B. Gauge pressure at point A is equal to zero, and absolute pressure at point B is 30% lower than pressure at point A. What is the height difference, Δh, between points A and B?
a. Δh = 8.09 m with point A above point B.
b. Δh = 344 m with point B above point A.
c. Δh = 303 m with point B above point A.
d. Δh = 3.44 m with point A above point B.

Answers

The height difference between points A and B is : ( B ) Δh = 3.44 m with point B above point A.

Given data :

fluid density = 900 kg/m³

Diameter of pipe = constant

Gauge pressure at Point A = 0

Gauge pressure at point B = 30% lower

Determine the height difference between points A and B

first step : determine absolute pressure

Pa (absolute pressure )= gauge pressure + atmospheric pressure

                                      = 0 + patm

Therefore : Pa = Patm

Also;

Pressure at point B ( Pb ) = Pa - 30%Pa

                                          = 0.7 Patm

Hence ; Pa - Pb = 0.3 Patm ----- ( 1 )

Final step : Determine the height difference

we will apply the formula below from equation ( 1 )

p *g * Δh = 0.3 * 1.013 * 10⁵      ( note : Patm = 1.013 * 10⁵ )

900 * 9.81 * Δh = 0.3 * 1.013 * 10⁵

therefore :

Δh = ( 0.3 * 1.013 * 10⁵ ) / ( 900 * 9.81 )

     = 3.44 m

Hence we can conclude that The height difference between points A and B is Δh = 3.44 m with point B above point A.

Learn more about height difference in fluids : https://brainly.com/question/17200230

Other Questions
25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation