Which of the following is a living organism?
Å virus
A piece of wood
A stone
0 0
A tree

Answers

Answer 1

Answer:

The answer to this question is Tree


Related Questions

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

1. Why is cell an open dynamic system?​

Answers

The exchange of matter or substances between the cell and its environment is dynamic as it varies in direction and rate as per the requirements of the cell. Thus,a cell attains a stead -state wherein the internal conditions of the cell remain constant. Hence, cell is considered to be a open dynamic system

Is fermentation as efficient as aerobic cellular respiration? Multiple choice question, yes or no?

Answers

Answer:

NO

EXPLANATION :

Aerobic cell respiration is roughly 18 times more efficient than anaerobic cell respiration. Your cells require a lot of energy and are dependent on the high efficiency of aerobic respiration. They quickly die if deprived of oxygen.

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Answers

Answer:

Nervous system signal conduction in muscular movement

Explanation:

Hope i helped :)

Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.

Answers

Answer: Products from animals include meat and meat products, poultry products (meat and eggs), fish, shellfish, dairy products (milk and cheese), and non-food products such as fiber (wool, mohair, cashmere, and leather).

Explanation:

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

Answers

Answer:

it is 736

Explanation:

me big brain

Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.

The effects of road salting on the environment

Road salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.

The types of salt used for road salting include:

rock salt,

salt brine,

winter sand,

a mix of sand and salt.

The impact of road salting on the environment include the following:

Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.

Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.

Learn more about aquatic ecosystems here:

https://brainly.com/question/1023703

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Answers

The cas because they are not vegan and they are not good enough for me and I’m not like that what

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Answers

Answer:

C. Ss

Explanation:

One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Where does carbon dioxide come from during photosynthesis?

Answers

Answer:

Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest

Answers

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

pls help click the link answer​

Answers

Answer:

1. Transfer

2. Share

3. Subscript

4. Positive

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

Answers

False
Should be the right answer because we can see mutations in humans can kill some and do nothing to others

An insulator the loss of heat energy.

slows down or speeds up

I WILL MARK YOU BRAINLYSS PLUS 40 POINTSSS

Answers

The heat slows down.

Answer: Slows down

Explanation: Insulation slows does the transfer of heat energy. think of it like this. a puffer jacket (more insulation) keeps you warmer longer than a t-shirt (less insulation).

:)

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!

muscle cell labelled diagram ​

Answers

Explanation:

Here is a diagram, let me know if this is what you needed.

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

Why animals reproduce? A. To become many B. To become food C. To enjoy D. To grow​

Answers

Question:

Why animals reproduce?

Answer;

(A) To become many

why?

because if no animals in the world you will not enjoy of your childhood

that is my answer I hope it helps to you

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

Answers

a. the distribution of sand on an ocean floor
C. The speed at which a hummingbird flies

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

Answers

A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.

The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.

Flagellated protists are microorganisms having a tail-like projection known as flagellum.

The flagellum is a structure used for motion, thereby, in general,  flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).

Learn more about the Protista kingdom here:

https://brainly.com/question/5186929

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Answers

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

Other Questions
Please give help and label them giving brainiest Mark the sums of the integers as either positive or negative. -8+(-9)7+(-3)5+(-12)-12+15 10. Flora rented a space at the flea market.Her space included electricity.Booth Spaceeach day:$25Electricity:$2Which expression gives the total cost ofthe day's rental if she used h hours ofelectricity?A. 25-2hB. 25 + 2hC.(25+2) x hD. 25h+2 what are 2 achievements of the Mauryan Empire? Please don't look it up and say it in your own words also just name them don't put a whole sentence if you do that I will give you brainliest. write in point slope form an equation of the line that passes through point (6,5) with slope 3 Susan loaned Marcel $19,080 at an interest rate of 17% for 5 years. How much will Marcel pay Susan at the end of 5 years? Round your answer to the nearest cent, if necessary. Help!!So I think that someone is tracking my truck with an apple airtag but I don't know for sure. The only apple product I have is an iPad and I don't know how to check if an airtag is near by!! (6, 10)(a, 8)(4,5)(2, 2)1. Find the slope of the line. Explain or show your reasoning2. Write an equations for the line.3. Find the values for a and b. Explain or show your reasoning4. What is the y-coordinate when x = 0? Explain or show your reasoning. In Chapter 16 of Hatchet, a tornado directly hits Brian's shelter and Brian is left with nothing but the hatchet. How does Brian respond to this setback?1. Brian has a sense of humor about the tornado, and he feels motivated to rebuild his shelter.2. Brian remembers the decisions he made earlier and uses them to guide how he rebuilds his shelter.3. Brian's anger causes him to shut down at first, but he quickly realized the importance of recreating his shelter.4. Brian experiences despair because he is hurt and has nothing left without his shelter. Your salary is one thing to consider when reviewing a job offer but benefits are also important. Which of the following would NOT be a part of your benefits package? Please help me with this question ! : Sarah works for 8 minutes and for every 8 minutes she gains 23 coins everytime she works and she is saving for 2,000 coins in total. How many hours will it take Sarah to get 2,000 coins? Hi! I'm looking for some proficient actually (accurate) responses. depending on the responses ill probably give brainliest to the most accurate one. Last week antione had a begging balance of $90 in his account he wrote 3 checks for $10 each from his checking account , withdrew another $20 and finally made a deposit of $100. Write an expression that shows his final account balance at the end of the week Which leadership skill do you feel is most important for a small business to succeed for along time? Explain your answer using examples. It's depends on the business that they are doing because they all have strengths and weakness. The change in direction that occurs when a light ray bounces off of a surface What is prejudice and discrimination against Jewish people called?anti-SemitismgenocideKristallnachtNuremberg laws !!!SOMEONE HELP !!!PLEASE HELP ASAP 10 POINTSWhich coordinates are the best estimate of the solution to the system of equations?Hint: Which coordinate is closest to where the lines meet?Question 4 options:(6,0)(0,5)(1,4)(1,5) tissue respiration, location in the cell and sequence of reaction