which inventory system responds to a channel member's inventory needs by drawing the product through the distribution channel

Answers

Answer 1

Reactive/Pull Inventory System responds to a channel member's inventory needs by drawing the product through the distribution channel.

What is a pull inventory system?In a lean manufacturing technique known as the pull system, products are produced in response to real demand rather than expectations. In this type of strategy, businesses merely maintain an inventory and create enough product to fulfil current client requests.A neighbourhood coffee shop that prepares coffees and other hot beverages based on client requests is an example of a pull system. The procedure of making hot beverages doesn't start until a consumer places an order.Advantages. The pull method is customer-focused, has a little inventory, may enhance cash flow, and makes products to order. In contrast, the Push system has a long list, is producer-centric, can manufacture to order, and bases demand on forecasts.

Learn more about pull inventory system refer to :

https://brainly.com/question/13122704

#SPJ4


Related Questions

when stock is issued in exchange for a noncash asset, the value recorded for the shares issued is best determined by

Answers

The market value of the shares is the greatest indicator of the value recorded for the shares issued when stock is issued in return for a non-cash asset.

What process does the market use to issue stocks?

Identification of the investors who received shares during a secondary offering or at the company's founding allows one to calculate the ownership percentage of a corporation. The fully diluted computation, which counts all shares issued, outstanding, and those that might be issued if all authorized stock options are exercised, is another way to calculate ownership. The position shareholders may be in at a later time can also be predicted by using the issued and authorized stock as a measure of ownership. This is called the working model calculation. All board members must use the same calculation when making decisions or plans for the business.

To know more about stock visit:

brainly.com/question/29992015

#SPJ4

which of these can you combine to develop a custom head? a. industry-standard open-source technologies b. sitegenesis c. home-grown frameworks d. a and b e. a and c

Answers

You can combine these to create a unique head. open-source technologies that are common in the industry.

What are some examples of technology?

All of these items are examples of technology, whether they are useful (like washing machines, dryers, refrigerators, vehicles, flooring, windows, or door knobs) or amusing (like televisions, Blu-ray discs, games consoles, recliners, or toys).

What is the technology's future?

Future technological subjects will include: emerging technologies, which are thought to be able to alter the status quo. Technology that is hypothetical, or that may one day exist but does not currently. Modernizing industries depends heavily on emerging technologies. Enterprises are being transformed into a digital environment with the aid of new technologies. Specifically, the manufacturing, energy, and mobility sectors benefit from this technology.

To know more about technologies visit:

https://brainly.com/question/29650738

#SPJ4

demand is elastic over a particular price-change range if the change in price causes no change in total revenue the change in price causes total revenue to change in the same direction the change in price causes total revenue to change in the opposite direction trick question: demand is never inelastic over any price-change range.

Answers

Demand is elastic over a particular price-change range if the changes in price causes total revenue to change in the opposite direction.

Option C is correct.

Elastic Demand:

When the percentage change in quantity demanded exceeds the percentage change in price, demand is said to be elastic. That is assuming the interest is flexible over a specific cost range, a proportionate expansion in cost causes a more proportionate fall in amount requested, making the all out income fall ( Complete revenue=Price×Quantity requested).

In a similar vein, a proportionate decrease in price results in a proportionate increase in the quantity demanded, thereby increasing total revenue.

If the change in price is proportional to the change in quantity demanded, then demand is said to be unitary. For this situation the adjustment of cost causes no adjustment of absolute income.

If the change in quantity demanded is less than the change in price, demand is said to be inelastic. In this instance, total revenue shifts in the same manner as price does.

Question is incomplete. Missing option are:

Demand is elastic over a particular price-change range if

A: the change in price causes no change in total revenue

B : the change in price causes total revenue to change in the same direction

C : the change in price causes total revenue to change in the opposite direction.

D :demand is never inelastic over any price-change range.

Learn more about elastic demand:

brainly.com/question/24596748

#SPJ4

By being realistic, you can accurately determine the cost and ______________for projects' completion. (9 letters).

Answers

By being realistic, you can accurately determine the cost and Resources for projects' completion.

What are Resources?

All materials available in our environment that are technologically accessible, economically feasible, and culturally sustainable and help us to satisfy our needs and desires are referred to as resources. Resources are divided into two types based on their availability: renewable and non-renewable resources. They can also be classified as actual or potential based on their level of development and use, as biotic or abiotic based on their origin, and as ubiquitous or localised based on their distribution (private, community-owned, national and international resources). With the passage of time and the advancement of technology, an item becomes a resource. The advantages of resource utilisation may include increased wealth, proper system operation, or improved well-being.

So, The required answer is Resources.

To learn more about Resources:

https://brainly.com/question/24514288

#SPJ4

a.they have too many possibilities for how they will spend their time b.they will miss their coworkers and the routine of going to work c.they are worried about their finances d.they do not have as close of a relationship with others outside of their work

Answers

For individuals, retirement may be difficult since there are so many options for how to spend their time.

What function does a coworker serve?

A coworker is someone that an employee collaborates with while doing their job duties. When other people are dealing with troubles involving exceptional circumstances, friends can offer their skills and experience; this could be especially helpful when other options are not easily accessible.

Who manages a coworker?

Anybody you works with in such a business or organization is referred to as a colleague. Your team's customer support representative, administrative assistant, and human resources specialists are all teammates, as is your supervisor.

To know more about Coworkers visit:

https://brainly.com/question/15086062

#SPJ4

The complete question is-

Retirement can be overwhelming for adults because:

a. they are worried about their finances.

b. they have too many possibilities for how they will spend their time.

c. they will miss their coworkers and the routine of going to work.

d. they do not have as close of a relationship with others outside of their work.

what is the term for when a merchant gives a written, signed assurance that he or she will not revoke an offer for a stated period of time?

Answers

Firm offer is the term for when a merchant gives a written, signed assurance that he or she will not revoke an offer for a stated period of time.

A merchant firm is an assurance of a new product or service to the public. This offer is usually in the form of a sale, discount, or promotion. In order to attract customers, the merchant firm may use various marketing strategies such as advertising, public relations, or personal selling.

The goal of the offer is to generate interest in the product or service and encourage customers to purchase it. This a legal term used often in business.

To know more about Merchant, click here.

https://brainly.com/question/15263192

#SPJ4

1 euro would cost about in us dollars. 1 euro could be exchanged for 119 .

Answers

1 euro would cost about in us dollars. 1 euro could be exchanged for 119.

1 EUR = 1.035523 USD

What do you mean by currency?

A currency is a standardized form of money that is used or in circulation as a means of exchange, such as coins and banknotes.

A currency can also be defined more broadly as a system of money that has been used often over time within a particular setting, particularly by residents of a country state.

According to this definition, fiat currencies include the British Pound Sterling (£), Euros (€), Japanese Yen (), and US Dollars (US$).

Currency exchange markets, which establish the relative values of the various currencies, allow for the trading of currencies between countries and their use as repositories of value.

In this respect, currencies have limited acceptance ranges and are either chosen by users or established by governments.

Learn more about currency, here

https://brainly.com/question/14372075

#SPJ1

Answer:

1 euro would cost about

✔ $1.28

in US dollars.

1 euro could be exchanged for 119

✔ Japanese yen

.

Explanation:

under international accounting standards board rules, what method is required to account for foreign currency transactions?

Answers

The one-transaction viewpoint method is required by the International Accounting Standards Board to account for foreign currency transactions.

Which accounting standard should be applied for accounting for foreign currency transactions?

IAS 21 The Consequences of Variations in Foreign Exchange Rates, which also covers how to account for currency transactions and activities in income statement and how to translate financial statements into the a presentation currency, discusses the effects of altering foreign exchange rates.

Which two approaches can you take when dealing with foreign currencies?

Unrealized foreign exchange gains and losses are accounted for using either the deferral technique or the accrual approach. The deferral method holds back unrealized foreign exchange gains and losses until cash is actually paid or received before showing them on the balance sheet.

Learn more about foreign exchange rates: https://brainly.com/question/14231622

#SPJ4

You are borrowing $17,800 to buy a car. the terms of the loan call for monthly payments for 5 years at 8.6 percent interest. what is the amount of each payment?

Answers

To purchase an automobile, you are borrowing $17,800. The loan's conditions stipulate monthly payments for five years at an interest rate of 8.6 percent. Payment Due Each Month: $366.05

What does the term interest mean?

The fee you charge to borrow or the fee you ask to lend money is called interest.Interest is frequently calculated as an annually percentage of the total borrowed. The cost of borrowing on the loan is known as this percentage.

Briefing

Purchase value of car = $17,800

Loan Period = 5 years

Annual Interest rate = 8.6%

Calculating Monthly Payment of the Loan:

(Using Formula);

                         PV = C × {1-[1/(1+r)t]}/r

$17,800 = Monthly Payment × {1-[1 ÷(1+0.086/12)⁵ˣ¹²]} ÷ 0.086

$17,800 = Monthly Payment × {1-[1÷ (1.00716667)⁶⁰]}  ÷ 0.00716667

$17,800 = Monthly Payment × {1-0.651507293} ÷ 0.00716667

$17,800 = Monthly Payment × [0.348492707 ÷ 0.00716667]

$17,800 = Monthly Payment × 48.6268667

Monthly Payment × $48.6268667 = $17,800

Monthly Payment = [$17,800 / $48.6268667]

Monthly Payment = $366.05

To know more about interest  visit:

https://brainly.com/question/29065197

#SPJ4

Keesha is the ceo of a publicly-owned company. She was informed by the cfo that the company's earnings were down 30 percent from the prior year due to the recession. The company's stock price has declined by 20 percent. The cfo comes up with a scheme to hide debt and inflate revenues by selling underperforming assets to a special purpose entity affiliated with the company. Keesha is concerned about possible effects on the creditors but ultimately she agrees to the accounting. Keesha is reasoning at.

Answers

Keesha, the CEO of a publicly-owned company, is reasoning at Stage 3, which is fairness to others.

Describe Kohlberg's phases of moral development.

In 1958, while a graduate psychology student at the University of Chicago, Kohlberg started researching this issue. Pre-conventional, conventional, and post-conventional moral reasoning are three separate levels that Kohlberg established. In order to describe how moral thinking develops, Lawrence Kohlberg created the "Kohlberg phases of moral development" planes of moral sufficiency.

The idea was developed at the University of Chicago while the author was a psychology student. It was motivated by a concern with children's responses to moral quandaries and by the work of Jean Piaget. In 1958, he composed a Ph.D. dissertation at the institution explaining what is now referred to as his stages of moral development.

To learn more about publicly-owned company, visit:

https://brainly.com/question/28579552

#SPJ1

The complete question is:

Keesha is the CEO of a publicly-owned company. She was informed by the CFO that the company's earnings were down 30 percent from the prior year due to the recession. The company's stock price has declined by 20 percent. The CFO comes up with a scheme to hide debt and inflate revenues by selling underperforming assets to a special purpose entity affiliated with the company. Keesha is concerned about possible effects on the creditors but ultimately she agrees to the accounting. Keesha is reasoning at:

Stage 1

Stage 2

Stage 3

Stage 4

select the highlighted passages that represent accurate descriptions of susan shepler’s fieldwork in sierra leone.

Answers

The postwar efforts of human rights initiatives in rehabilitating the child soldiers of Sierra Leone are briefly discussed in Susan Shepler's Childhood Deployed: Remaking Child Soldiers in Sierra Leone.

Write a short note on Susan Shepler.

An anthropologist with substantial experience working in West Africa devastated by war, Susan Shepler is an associate professor in the School of International Service at American University. The goal of Susan Shepler's research is to comprehend how local communities interact with foreign interventions and the nuances of those local responses, including the micropolitics of gender, age, religion, and ethnicity.

Shepler traveled to Sierra Leone to do ethnographic fieldwork for her upcoming book, provisionally titled "Power You Can Trust: Fractal Sovereignty." It examines the conclusion reached by the international health community in the wake of the Ebola outbreak in 2014–2016. Shepler wrote the well-regarded book Childhood  Deployed: Remaking Child Soldiers in Sierra Leone and her articles have appeared in a number of scholarly journals.

To learn more about scholarly journal, visit:

https://brainly.com/question/28900702

#SPJ1

true or false? choosing to not use the marketing hub blog tool to host your blog will make your marketing hub campaign reporting less comprehensive.

Answers

The answer is true.  I've worked with a car sales company while using this and another CRM. My personal opinion is that HubSpot's user interface and simplicity of usage are outstanding.

The application is quite straightforward and simple to use. Not just with Microsoft Office, but also with LinkedIn Sales Navigator, the functionality is incredible. Marketing Center. You sales create effective inbound marketing campaigns that generate interest in your company and satisfied customers with HubSpot's marketing tools. All of your marketing resources are available in one location. HubSpot uses a cookie from your website that is already present in the visitor's browser to recognise the visitor and retrieve data from the relevant contact record.

To learn more about sales, click here.

https://brainly.com/question/29436143

#SPJ4

Andrea displays different pairs of shoes in her showroom. Many customers visit her showroom during the weekends. What role does Andrea perform?
A. wholesaler
B. broker
C. distributor
D. retailer

Answers

If Andrea displays different pairs of shoes in her showroom. Many customers visit her showroom during the weekends. The role that Andrea perform is : D. Retailer.

Who is a retailer?

A retailer can be defined as the person that sells directly to final user or end user which are the customers.

This retailer buy this goods from the wholesaler as the wholesaler buy directly from the manufacturer or producer.

Andrea can be classified as a retailer as he sells the pair of shoes to end user.

Therefore the correct option is D.

Learn more about retailer here:https://brainly.com/question/25376778

#SPJ1

in the secondary mortgage market for commercial loans, separate tranches normally allocate what kind of risk? ch20

Answers

In the secondary mortgage market for commercial loans, separate tranches normally allocate credit risk.

What is mortgage?

When you and a lender enter into a mortgage, the lender is granted the power to seize your property if you are unable to pay back the loan amount plus interest. To purchase a property or borrow money against the value of a home you currently own, you can use a mortgage loan. In plainer terms, a mortgage is an agreement that a person enters into with a bank when they borrow money from the institution (bank loans) and pledge a piece of real estate as security for the bank until the full amount is repaid. There are two other categories of mortgages: 1) Conventional mortgages Second-lien mortgages 3) Mortgages with government insurance 4) Fixed-rate mortgages 5) Mortgages with adjustable rates

To learn more about mortgages click,

https://brainly.com/question/1318711

#SPJ4

Use the Internet to find an article that presents a forecast of the economy's performance in the next three months to a year. Once you have found and read your article, record your summary using the following format in the box below and include the link. Be sure to include the URL links you used as resources in the space below.

Paragraph #1 - Summary of article including the link.
Paragraph #2 - How it relates to entrepreneurship.
Paragraph #3 - Your opinion of whether or not you agree with the prediction and the evidence provided to support the forecast.

Answers

I'm gonna take an educated guess and say that your answer is Paragraph #2.

The demand for a good or service that considers only the private benefits of its consumption is called.

Answers

Answer:

Private Demand

Explanation:

The market demand for private goods at a given price consists of counting how many units will have marginal utility that is at least equal to that price. Here, we have 3 consumers, each with a different demand schedule for a private good.

g what are the two defining characteristics of a public good? please define the two characteristics.

Answers

A public good has two distinguishing features: it is nonexcludable and nonrivalrous. Because of these features, market producers find it difficult to offer the product to individual customers. It is costly or impossible for one user to exclude others from utilizing a good if it is non-excludable.

What is a non-excludable public good?

Non-excludable products are public goods that cannot be withheld from a specific individual or group of individuals. As a result, restricting access to non-excludable product consumption is almost difficult. A public road is an example of a good that cannot be excluded. Even if they are only strolling, almost everyone has access to a public road.

The inverse of a non-excludable item is an excludable good, which is one that some individuals are not permitted to use. Private commodities are excluded, whereas non-excludable items are public goods. A competitor good is a form of excludable good in that it may only be owned or consumed by one person.

To learn more about public good, click

https://brainly.com/question/29922306

#SPJ4

many organizations combine the disaster recovery and business continuity plans into a single comprehensive document called the service resumption plan. true false

Answers

The correct answer is false. This single documentation is called business resumption plan.

What is business resumption plan?

The recovery of your company following an emergency is covered by the business resumption strategy.

The BRP focuses on preventative measures and what happens after an emergency, unlike the disaster recovery plan and business contingency plan, which both feature continuity protocols used during an emergency.

The BRP assists you in getting your company back up and operating smoothly.

BRP preparations included insurance plans, evacuation plans for buildings, and agreements with data centres for mutual aid.

Your BRP must now include commercial data backup and restoration strategies due to the development of computer-based systems.

By the late 1980s, auditors were requiring backup plans for manual procedures and human users from any company using key information systems applications.

To know more about business continuity plan, visit:-

https://brainly.com/question/29837934

#SPJ4

deirdre sold 100 shares of stock to her brother, james, for $2,400. deirdre purchased the stock several years ago for $3,000. note: loss amounts should be indicated by a minus sign. leave no answer blank. enter zero if applicable. d. what amount of gain or loss does james recognize if he sells the stock for $2,000?

Answers

Common stock is the corporate security in which shareholders invest. In the statement of the company's financial position that was prepared at the conclusion of the fiscal year, it is listed under the heading "shareholder funds."

Calculation of gain or misfortune on special of offers is as per the following What gain or misfortune does Deirdre perceive on the deal?

How Does Common Stock Work?

A security that represents ownership in a company is called common stock. Common stockholders vote on corporate policies and elect the board of directors. Long-term returns are typically higher with this type of equity ownership.

An example of common stock is given below.

An illustration of common stock is 1,000 shares, which equals one percent ownership of the business. This stockholder will receive $100 (1,000 shares X $0.10) in dividends if the company declares a split of $0.10 per share.

To learn more about Common stock here:

https://brainly.com/question/13762106

#SPJ4

consider the capm. the risk-free rate is 5%, and the expected return on the market is 13%. what is the expected return on a stock with a beta of 1.3?

Answers

The expected return on a stock with a beta 16% = rf + (13% - rf) x 1.3 = A: 3%.

What are returns?

Return is the financial term for an investment's profit. It includes any variation in the investment's value as well as any cash flows the investor receives as a result of the investment, such as interest payments, coupons, cash dividends, stock dividends, or the payoff from a derivative or structured product. A return is the increase in value of a project, investment, or item over time. This increase in value can be expressed as a price increase or a percentage increase. A gain is shown by a positive return, whilst a loss is indicated by a negative return. Return measures the entire interest, dividends, and capital gains earned on an investment over a given period of time and is stated as a cash gain or loss. Return offers a peek of the investment's previous performance and aids in determining whether a specific investment has been profitable over time.

To learn more about returns click,

https://brainly.com/question/15726451

#SPJ4

which project scope requirement involves identifying the things you must achieve to complete the project successfully?

Answers

The procedures for ensuring that the project contains all of the work necessary, and only the work necessary, to execute the project effectively are defined under project scope management.

What is a project's straightforward definition?

A project is just a set of activities that must be finished in order to achieve a certain goal. A project may alternatively be described as a collection of inputs or outputs necessary to accomplish a certain objective. Projects can be handled by one people or one hundred, and they can be simple or complicated.

How does one define a project?

The projects start date, scope, limits of the task, resource and personnel restrictions, location of the project, deliverables, and budget are some of the project tasks that have to be determined.

To know more about Project visit:

https://brainly.com/question/29754970

#SPJ4

the revenue that is forgone from an alternative use of an asset, such as cash, is called a.differential profit b.sunk cost c.differential revenue d.opportunity cost

Answers

The revenue that is forgone from the alternative use of an asset, such as cash, is called opportunity cost.

What is the asset?

A resource having economic worth that a person, business, or nation possesses or controls with the hope that it would someday be useful is referred to as an asset. The balance sheet of a business lists assets. They are divided into four categories: tangible, financial, fixed, and current.

The opportunity cost is the amount of time spent learning and the money that could be used elsewhere. When a farmer decides to grow wheat, there is an opportunity cost associated with not doing so or using the resources in another way (land and farm equipment)

Therefore, Thus, option (D) is correct.

Learn more about assets here:

https://brainly.com/question/13848560

#SPJ1

forecast error is the difference between actual demand and bias. is the statement true or false? (refer to chapter 12) group of answer choices true false

Answers

This statement is true. forecast error is the distinction between actual demand and bias.

What do you suggest via forecast error?

At its most basic, forecast error is the distinction between the forecast demand and the proper demand. A lot of calculations go into forecast error, however the bottom line is that the larger the difference between true demand and forecast demand, the increased the have an effect on on a distributor's bottom line

Is the distinction between the forecast and actual demand?

A forecast is a prediction of demand primarily based on numbers seen in the past. Demand graph starts with the forecast but then takes different things into consideration like distribution, where to maintain inventory, and so on.

Learn more about forecast error here:

https://brainly.com/question/13799105#SPJ4

true or false? if one horizon begins to underperform, you should reallocate resources to those initiatives until they start performing well.

Answers

It is false that you should reallocate resources to projects until they start doing well if one horizon starts to underperform.

What are resources?

A resource is any material that is available to us in our surroundings that is economically viable, technologically accessible, and culturally sustainable and that enables us to meet our needs and desires. Based on their availability, resources can be roughly classified into categories that are renewable and non-renewable. On the basis of their degree of development and application, they can also be separated into real and potential categories, biotic and abiotic categories, localized and universal categories, and categories depending on their origin. An item might develop into a resource over time as technology develops. Effective resource management can result in higher income, more effective system performance, or better wellbeing.

To learn more about resources, visit:

https://brainly.com/question/12748073

#SPJ4

The formal system of task and reporting relationships that coordinates and motivates an organization's members to achieve the company's goals is called the organizational _____.
A. structure
B. vision
C. culture
D. mission

Answers

The formal system of task and reporting relationships that coordinates   members to achieve the company's goals is called the organizational structure

What is your organization's formal system?

A formal organization is a social system built by well-defined rules, goals, and practices that operates on the basis of a division of labor and a well-defined hierarchy of power.

What is your organizational structure?

The system outlining how specific activities are handled to achieve a strategic mission is called an organizational structure. Rules, roles and duties are all part of these activities. The organizational structure also determines the flow of information between departments.

What is the purpose of the organizational structure?

The purpose of an organizational structure is to help an organization achieve its goals and to help its employees work effectively and efficiently. Organizational structures assign specific duties and responsibilities to employees and help managers coordinate and control activities.

Learn more about organisational structure:

brainly.com/question/2636977

#SPJ4

if a motorcycle dealer refuses to sell a motorcycle unless the purchaser also buys a helmet that would be a tying contract and a violation of the clayton act. if a motorcycle dealer refuses to sell a motorcycle unless the purchaser also buys a helmet that would be a tying contract and a violation of the clayton act. true false

Answers

Clayton Act. Is Real

The Clayton Act accomplished what?

Any merger or purchase that "may be materially to diminish trade, and to tend to establish a monopoly" is prohibited by Article 6 of the Section 70. The Roberts Act of 1936 modified the Clayton Act to outlaw a number of discriminatory prices, service, and concessions in business transactions.

What was proclaimed by the Clayton Act?

The Clayton Antitrust Act was implemented by the recently established Federal Trade Commission, which also stopped unfair business practices. The new law made strike, boycotts, and union workers legal outside federal law in addition to outlawing price gouging and anti-competitive mergers.

To know more about clayton act visit:

https://brainly.com/question/14904049

#SPJ4

the idea that protective tariffs are needed to preserve industries that produce the materials essential for national defense is called the

Answers

The idea that protective tariffs are needed to preserve industries that produce the materials essential for national defense is called the “national security argument,” also called the “national defense argument.”

What is national security argument?

The "national security argument," sometimes known as the "national defence argument," is one of the oldest and most popular justifications for protection. According to this viewpoint, a tariff must be used to protect specific industries in order to guarantee the continuation of local production in the case of a war.

Numerous items have been recognised as being crucial enough to merit protection for this reason. The industry that is most frequently mentioned is probably agriculture. Just think about the issues that would occur if a country didn't have enough food when it was at war with another country. Famine and other severe hardships could result from low food reserves.

To learn more on national security argument from the link:

https://brainly.com/question/27525816

#SPJ1

Lillian purchased a violin from smash music stores. It regularly sold for $670, but was on sale at 10% off. She also had to pay 8% sales tax. She bought it on an installment plan and paid 15% of the total cost with tax as a down payment. Her monthly payments were $58 per month for one year.

Answers

The sales tax after deducting the discount amount of 10% i.e. $63 is $48.24.

How do you solve sales tax math problems?

Add the purchase price to the sales tax rate to calculate the total. A decimal number should be used instead of a percent when converting the sales tax rate. The price is increased by the amount of sales tax after it has been calculated. The final cost, which the customer must pay, is the result.

Given that:

Selling price = $670

Discount = 10%

Tax rate = 8%

Required to calculate the purchase price =?

Net offered price = (1 - 0.10) * 670

Net offered price = 0.90 * 670 = $603

Hence, the purchase price = $603

Required to calculate sales tax amount =?

Hence, sales tax = 8% of the purchase price

Sales tax amount = 8% of $603

Sales tax amount = 0.08 * 603 = $48.24

Thus, the amount of sales tax is $48.24.

Learn more about sales tax here:

https://brainly.com/question/29442509

#SPJ1

Your question seems incomplete, most probably the completed was;

Lilian purchased a violin from smash music stores. It regularly sold for $670, but wa son slaw for 10% off. She also had to pay 8% sales tax. She bought it on the installment plan and paid 15% of the total cost with tax as a down payment. Her payments were $58 per month for one year. What is her sales tax?

Net marketing contribution reveals what is left after the manufacture and sale of the product to cover marketing, fixed costs and profit.

a. True
b. False

Answers

Net marketing contribution reveals what is left after the manufacture and sale of the product to cover marketing, fixed costs and profit.True

Manufacturing is the making of goods by means of hand or by means of machine that upon final touch the business sells to a consumer. items used in manufacture can be uncooked substances or thing components of a larger product. the producing typically happens on a massive-scale production line of machinery and professional exertions.A manufacturer is someone or employer that produces finished items from raw substances with the aid of using numerous gear, gadget, and methods, and then sells the goods to clients, wholesalers, distributors, outlets, or to other manufacturers for the manufacturing of more complex items.

Manufacturing is described because the creation of new products, both from raw materials or additives. Examples of manufacturing consist of car businesses, bakeries, shoemakers and tailors, as they all create merchandise, in preference to presenting offerings.

Learn more about Manufacturing here:

https://brainly.com/question/13440987

#SPJ4

what type of lease would be used when one farmer leases land to another farmer so that the second farmer can plant and harvest on it?

Answers

Land lease would be used when one farmer leases land to another farmer so that the second farmer can plant and harvest on it.

What do you mean by farmer?

⇒ A farmer is someone who works in agriculture and raises living things for food or raw materials. The phrase typically refers to individuals who raise a variety of field crops, orchards, vineyards, poultry, or other livestock. A farmer may be the owner of the farmland or may perform labor services on land that belongs to others. A "farmer" is often a farm owner (landowner) in most developed countries, whereas farm labourers are the farm's workforce (or farmhands). However, in some earlier definitions, a farmer was someone who worked hard and paid care to cultivating plants, improving the growth of crops, or raising animals (such as livestock or fish).

To learn more about farmer, visit:

brainly.com/question/18339869

#SPJ4

Other Questions
The width of a claroom i 4meter le than the length. It area i 45cm*45cm. Find the dimenion of the claroom sonata form consists of three main sections, exposition, development, andquestion 10 options:introductionrecapitulationmotivestransition a nurse teaches an adolescent client with asthma to independently administer breathing treatments. which principle should the nurse keep in mind when planning the teaching session? 1. compute total variable cost per unit. 2. compute total fixed costs. 3. prepare a flexible budget at activity levels of 12,000 units and 16,000 units. Can anyone help me out. Really need this turned in Solve x for this diagram why did the framers of the constitution put the principles of checks and balances and separation of powers in the constitution? can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope.