which elements have two valence electrons​

Answers

Answer 1

Answer:

Calcium is a group 2 element. It's Calcium :)

Answer 2

Answer:

hope it helps:)

Explanation:

Element:                                                                                                             Calcium is a group 2 element with two valence electrons


Related Questions

Romeo and Juliet How can love bring both joy and pain?

Answers

Answer:

Explanation:

How can love bring both joy and pain?

love can be bittersweet an example of this is imagine you fall in love with someone you want to be with them forever and they make you happy, but the people around don't like it they find it disgusting you have to keep your loved one a secret from everyone in fear people might disown you.

love can be bittersweet an example of this is imagine you fall in love with someone you want to be with them forever and they make you happy, but the people around don't like it they find it disgusting you have to keep your loved one a secret from everyone in fear people might disown you.

Who was Romeo and Juliet?

A long-standing feud between two wealthy families turns violent. A gang of masked Montagues break into a Capulet celebration, risking additional strife.

A young Romeo Montague who is infatuated with love falls in love right away with Juliet Capulet, who is about to wed the man of her father's choosing, the County Paris.

The women set up the wedding for the following day with the aid of Juliet's nurse, but Romeo is exiled after killing Tybalt, Juliet's own cousin, when intervening in a street fight. Juliet follows the Friar's plan and pretends to die in an effort to reconnect with Romeo.

Therefore, love can be bittersweet an example of this is imagine you fall in love with someone you want to be with them forever and they make you happy, but the people around don't like it they find it disgusting you have to keep your loved one a secret from everyone in fear people might disown you.

To learn more about Romeo, refer to the link:

https://brainly.com/question/19605913

#SPJ5

sort Desk Clerk Work
According to O'NET, what are common work styles
needed by Hotel, Motel, and Resort Desk Clerks?
Check all that apply.
concern for others
stress tolerance
aggressiveness
cooperation
avoidance of others
dependability

Answers

Concern for others. Stress tolerance. Cooperation. Dependability.

Answer:

Concern for others. Stress tolerance. Cooperation. Dependability. abde

How many nitrogen atoms are there in 5 molecules of N2H4

Hint: The symbol for nitrogen is N​

Answers

10

In one molecule of N2H4 (Hydrazine), there are two nitrogen atoms.

So, to find how many there are in five molecules, multiply by five.

2 x 5 = 10

Please solve this lab reportJohn had a science fair project that he needed to do. He wanted to test the effects that organic and chemical fertilizers had on plant growth. John predicted that the organic fertilizer would make the plants grow taller. He used three pots, three of the same type of seed, soil, organic fertilizer, chemical fertilizer, water, and a ruler. John put soil in the pots. He added chemical fertilizer to the first pot, organic fertilizer in the second pot, and no fertilizer in the third pot. He then planted one seed in each pot. John had to water the pots daily. He also checked for growth and took measurements for a period of 10 days. He measured the height of the plants. FIll out this templatePractice Writing a Lab Report Instructions: Use the lab example given to complete the Practice Writing a Lab Report activity. Please fill in this lab report with the appropriate information and data. Title: Include your name, instructor’s name, and the name of the lab Objecti

Answers

Answer:

This question is incomplete; the complete part is: what are the independent, dependent, and controlled variables?

Independent variable: ORGANIC AND CHEMICAL FERTILIZERS

Dependent variable: HEIGHT OF PLANT

Controlled variable: Same type of seed, water

Explanation:

Independent variable is the variable that is changed or manipulated by the experimenter. In this question, John wanted to test the effects that organic and chemical fertilizers had on plant growth. Hence, the independent variable is the ORGANIC AND CHEMICAL FERTILIZERS used.

Dependent variable is the variable that responds to changes made to the independent variable. The dependent variable is the variable that is measured in an experiment. In this case, the HEIGHT OF PLANTS MEASURED is the dependent variable.

Controlled variable or Constant is the variable that is kept unchanged throughout the experiment in order not to influence the experimental result or outcome. In this case, the controlled variable is the SAME TYPE OF SEED USED, WATER.

Independent Variable: organic + chemical fertilizers
Dependent Variable: height of the plants
Controlled Variable: seed, soil, water

When an object is not in motion, it can still have a form of energy. What form of energy does an object have due to its distance from Earth?

Answers

Answer:

Gravitational energy

Explanation:

An object's height above the ground (Earth) gives it gravitational energy.

Answer:

gravitational potential energy

Explanation:

correct on edge

How can plasmids differentiate species and can you tell by looking at it?

Answers

Answer:

Explanation:

In the event that you can recuperate enough DNA from a gel cut, you could attempt to think about the limitation condensations of the different species present in your examples. Naming the assimilation items with kinase and gamma-32P ATP may assist with expanding the affectability of recognition.

and no this is not copied :)

Which two words are the closest antonyms?
Hint
А
Phenomenon and occurrence
B
Observe and determine
C
Sudden and gradual
D
Tremendous and powerful

Answers

Answer:

(B)

Explanation:

what are skeskeleton bones​

Answers

Answer:

the bones that are inside your body

Answer: an internal or external framework of bone, cartilage, or other rigid material supporting or containing the body of an animal or plant. so like the domes help us stand up and do other stuff and without them we would be on the ground lol

Explanation:

Which of the following best describes a benefit of one type of non-renewable energy

Answers

Answer:

C

Explanation:

Answer:

Non-renewable sources are cheap and easy to use.

You can use small amount of nuclear energy to produce large amount of power.

Non-renewable have little or no competition at all.

They are considered as cheap when converting from one type of energy to another.

Explanation:

Which of the following is a biotic factor?

Α. Starfish
B. Salt
C. Sea water
D. Sand

Answers

Answer:

It would be Α. Starfish

If a cell in G1 has 20 chromosomes, then at the end of meiosis I there will be _________ chromosomes in each daughter cell, and __________ sister chromatids in each daughter cell.

Answers

Answer:

10 chromosomes

20 chromatids

Explanation:

Meiosis is the process by which sexually reproducing organisms produce gametes for sexual reproduction. Meiosis, which reduces the chromosomal number of the parent cell by half, occurs in two stages namely: meiosis I and meiosis II.

Meiosis I is where the actual reduction in chromosomal number takes place because homologous chromosomes are separated in this stage. For example, a cell in G1 that has 20 chromosomes will have 10 chromosomes in each daughter cell at the end of meiosis I.

Since, DNA replication occurs in the S-phase, sister chromatids are formed for each chromosome. Hence, there would be 20 sister chromatids joined together by a centromere at the end of meiosis I.

What’s da answer yalll I need help ...

Answers

Answer:

I believe the answer is a missense mutation.

Explanation:

As it is a point mutation, a single nucleotide will provide a codon for a different chain of amino acids from that point on. This is a type of non-synonymous substitution.

please help me with this question:)

Answers

Answer:

Pokaryote is the right answer.

Answer:

C: Prokaryote

Explanation:

This is not an animal or plant cell

Which are parts of a seed?

1.stigma, style, ovary

2.endosperm, embryo, seed coat

3.tube, generative nucleus, pollen grain

4.polar nuclei, sperm, egg

Answers

Answer:

2

Explanation:

endosperm, embryo, seed coat

Answer:

Endosperm, embryo, and seed coat

Explanation:

What methods would the body use to provide a
person with energy throughout a race?
DONE
C
Intro

Answers

Answer:

The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.

For the next 8 to 10 seconds, the body replaces the used ATP and produces more.

Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).

Therefore, during the whole process, the three energy systems used are:

the ATP-PC System

the Glycolytic system

the Oxidative system

Answer:

The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.

For the next 8 to 10 seconds, the body replaces the used ATP and produces more.

Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).

Explanation:

why are people scared of spiders?

Answers

Cause there little demon things ❤️

Predict what would happen if chemical energy is burned?
Energy is converted to mechanical energy.
The amount of chemical energy starts to decrease.
Energy is destroyed.
Sound energy can be created through an explosion.

Answers

Answer:

The amount of chemical energy starts to decrease.

Explanation:

Hope this helped

Identify the three types of neurons, and explain the function of each type

Answers

Answer:

Sensory neurons help you:

taste

smell

hear

see

feel things around you

Explanation:

Motor neurons

Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.

Interneurons

Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.

Binet created the first test to measure intellectual ability because he was trying to __________.

Answers

He was trying to Label students in school who needed extra help

Answer:

a on edge

Explanation:

About how many unique proteins are in humans?

Answers

Answer:

Between 80,000 and 400,000 proteins.

Explanation:

In humans, up to ten different proteins can be traced to a single gene. Proteome: It is now estimated that the human body contains between 80,000 and 400,000 proteins. However, they aren't all produced by all the body's cells at any given time. Cells have different proteomes depending on their cell type.

Answer

There are 10 different unique proteins

Explanation:

If there is a logarithmic relationship between stimulus intensity and action potential frequency in sensory neurons, how much will the action potential rate increase if the stimulus intensity increases by 100?

Answers

Answer:

The action potential rate will be doubled

Explanation:

The logarithm of a number for a given base is the power to which the base must be raised to give the number. Logarithm of a number can be in different bases. The base of common logarithm is the base 10.

For example, logarithm of 1000 to base 10 is 3 because 10 raised to power 3 equals 1000

Log₁₀1000 = 3 since 10³ = 1000

Therefore, if there is a logarithmic relationship between stimulus intensity and action potential frequency in sensory neurons and the stimulus intensity increases by 100, the action potential rate will increase thus:

Log₁₀100 = 2

Therefore, the action potential rate will be doubled

The commercial fishing industry uses large nets to capture fish. Often these nets catch many species of organism that are not used by humans. What Change could lessen the negative effect to this practice for the commercial fishing industry?


A. Designing nets that release unwanted species without harming them.

B. Using the net in deeper regions of the ocean where different organisms live.

C. Decreasing the size of the nets, but using more of them.

D. Exploring new and uncharted areas of the ocean where the nets can be used.

Answers

Answer:

A. Designing nets that release unwanted species without harming them.

Explanation:

Over-fishing is a negative human practice that leads to the over-exploitation of aquatic ecosystems (i.e., both marine ecosystems and freshwater ecosystems). In an aquatic ecosystem, the communities of organisms coexist in a delicate balance where they are dependent on each other in the food web, providing stability to the whole ecosystem. Therefore, the over-exploitation of any aquatic species is expected to impact the whole ecosystem, thereby also having a negative impact on other fish populations.

determine what foods you would take with you on your journey develop a supply list must by 2 paragraphs.

PLEASE HELP ​

Answers

On a Journey to and island i would take a Blade. The blade will he useful to cut tress to make various sorts of Things such as bark to start fires and Bamboo to make beds/tools. Also the blade will help me hunt Food and cut the meat to make it edible.
On the journey i would also take Fire starters because you need a fire for various of things. With the fire you made from the fire starters you can cook food and clean water for survival. Also you can Keep warm during the cold with said fire.

What is the most common weather patterns for the tropics?

Your answer

Send me a copy of my responses.

Submit

Answers

The general pattern of the tropical climate is warm temperatures. Depending on the type of tropical climate, humidity is variable with Equatorial climates experiencing large quantities of precipitation all year round and Tropical Wet and Dry and Tropical Monsoon climates expereincing seasonal shifts in rain patterns

SOMEONE PLZ HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Explanation:

the nucleus , it contain chromatin reticulum which later forms the DNA  

NEED HELP RLLY BAD!!!!!
Which of the following is not an example of a lipid?
a. triglyceride
b. steroid
c. enzyme
d. phospholipid

Answers

Answer:

c. enzyme

Explanation:  lipids are oily or wax-like   organic molecules found in living  things . They  are what make up fat  and oils

The answer is C. Enzyme

What is the length of a 0.2-mm object expressed in je m?

O 200 pm

O 0.02 pm

O 200.000 jem

Answers

Answer:

200.000 in je m

Explanation:

1 je m is equal to 1000 mm.

Therefore 0.2 mmm will be equal to 1000 × 0.2 mmm

This will give us 200 je m.

ligase nickname and function!

Answers

Answer:

Nickname=DNA or synthatese

Explanation:

Function =it is used in cells to join together the okazaki fragments which are form on the lagging strand during DNA replication.

Compare the exoskeletons of two invertebrates: a grasshopper (Arthropod) and a clam (Mollusca). How do they differ in relation to support and movement?

Answers

Answer:

Mollusca: Unsegmented exoskeleton, with no appendixes articulated to them. This skeleton has a calcareous origin. Arthropoda: Segmented exoskeleton, with different appendixes articulated to them, which develop different functions. This skeleton has a chitinous origin.

Explanation:

Clams are bivalves. Their calcareous exoskeleton has two valves dorsally articulated to each other. They do not articulate with any appendix, although. These animals also have a foot, a small head, and a developed mantle cavity. The valves are convex, oval, and unsegmented. They are composed of three layers: periostracum, prismatic, and pearly. En the dorsal portion of each valve, there is a bulge called the umbo, which is the oldest part of the valve. The articulation has some teeth-shaped structures that are intercalated, maintaining the valves together and fixed. Grasshoppers have a chitinous exoskeleton divided into three principal segments or regions that allow their movement: head, thorax, and abdomen. The head is orientated in such a manner that their feeding apparatus is heading down. Also, the head segment has composed eyes and antennae. The thorax is the medial region of the body. It has three segments: the prothorax, mesothorax, and metathorax. Each of these segments articulates with a pair of legs. Finally, the abdomen is composed of many segments that might reach up to 7 or 11.

What is the common name of plant #3 and what biome would it most likely grow in? Name one adaptation that helps it survive in its biome.

Answers

Answer:

B

Explanation:

Other Questions
1. la seora Trevio tiene el doble de edad que suhijo hace 9 aos la suma de su edades era 30cual es su edad actual? ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut Philosophies born out of ancient China include____.A. BuddhismB. DaoismC. JainismD. Hinduism On a map, the distance between NY and Washington D.C. is 3.6 inches. The scale is 1 inch: 55 miles. What is the actual distance between the two cities? 31. The observed regularities in the properties ofthe elements are periodic functions of their(1) atomic numbers(2) mass numbers(3) oxidation states(4) nonvalence electrons Which describes an altocumulus cloud?a.high, feathery cloudc.low storm cloudb.puffy mid-level cloudd.high cloud made of ice crystalsPlease select the best answer from the choices providedABCD PLZZ ANSWER THE QUESTION What point of view is the poem "The Song of the Storm -- Spirits" written in? The top of the saturated zone is known as A. the aquifer B. the water table C. the unsaturated zone D. spring rock How could you explain why soap is able to clean the oil and dirt off your bodies? Which of the following would be considered a derived unit? A) length B mass C) density D) temperature La hermana de mi hermana es mi ________. find y when y = 3x^2 -2x+5 and x = -1 What provides the energy that is stored in ATP molecules?A. PhospholipidB. FoodC. BloodD. Oxygen 72x2 + 39x + 207 = 0 does your faith is still visible even in the hardest part of life how? What developments brought new life to Lincolns 1864 presidential campaign Describe the ammonium ion, NH4+, and the sulfate ion, SO42-. What compounds would these ions form with potassium and fluoride ions? Write the formula units for the resulting compounds. Read the text below carefully and then answer the following question.Jennie : Bonjour. Je veux acheter des fruits et des lgumes.Chantal : Trs bien. Quest-ce que vous prfrez?Jennie : Je ne sais pas Quest-ce que vous avez aujourd'hui ?Chantal : Jai des oranges, des citrons, des pamplemousses, des bananesJennie : Je naime pas les pamplemousses. Mais les bananes sont belles. Je vais prendre des bananes, des fraises et des poires.Chantal : Ah, je nai plus de poires.Jennie : Je prends des pches alors.Chantal : Voulez-vous aussi des lgumes ?Jennie : Oui. Des carottes, des tomates et des avocats.Chantal : Est-ce que vous voulez aussi de la viande ?Jennie : Daccord. Donnez-moi du poulet et du jambon. Ah! Donnez moi aussi du jus dorange s'il vous plat.Chantal : Voil, merci. A la prochaine!Jennie : Merci beaucoup! A bientt.What does Jennie buy?A.pears, lemon and fishB.potatoes, bananas and pineappleC.blueberries, oranges and beefD.strawberries, bananas and peaches i need help on the last part!