Which division of the autonomic nervous system returns the body to a relaxed condition after an emergency?.

Answers

Answer 1

When the body is at ease, resting, or eating, the parasympathetic nervous system controls the body's response to digestion and relaxation.

It essentially undoes the effects of sympathetic division following a trying circumstance. The parasympathetic nervous system enhances digestion while decreasing breathing and heart rate. The sympathetic nervous system and the enteric nervous system are the other two components of the autonomic nervous system, together with the parasympathetic nervous system (PSNS). [1][2] Sometimes the enteric nervous system is regarded as a component of the autonomic nervous system, while other times it is regarded as a separate system. The body's automatic functions are controlled by the autonomic nerve system. The stimulation of "rest-and-digest" or "feed-and-breed" is carried out in digestion via the parasympathetic nervous system.

Learn more about parasympathetic nervous system here

https://brainly.com/question/13487019

#SPJ4


Related Questions

The inheritance pattern of one gene will not affect the inheritance pattern of another gene. This is known as(1 point).

Answers

The inheritance pattern of one gene will not affect the inheritance pattern of another gene is known as the Principle of Independent Assortment.

This principle describes the random inheritance of genes that are present in independently reproducing organisms, and they separate when they develop. It was developed by Mendel and he explained it with the help of peas.  It normally occurs due to meiosis in eukaryotic cells.

This happens normally when chromosomes are divided into various genes. It mentions the genetic inheritance from both parents. It helps in recombination.

Recombination is a process that breaks and recombines DNA to form new genes. Independent assortment takes place during metaphase one  in meiosis.

To learn more about Independent Assortment,

brainly.com/question/25710344

brainly.com/question/12338476

Transport proteins in the cell membrane play an important role in cell transport because.

Answers

Membrane transport proteins fulfill an essential function in every living cell by catalyzing the translocation of solutes, including ions, nutrients, neurotransmitters, and numerous drugs, across biological membranes.

when some nail polishes have been sitting, untouched for a while, will start to show a layer of pigment on the bottom of the bottom, while others do not. when you shake the bottle long enough, the pigment layer disappears and the color of the nail polish becomes more vibrant. based on your knowledge of mixtures, what types of mixtures are these two different kinds of nail polishes? and why is it that the pigments settle out in some nail polished but not others?

Answers

There are two distinct phases in the nail polish because a layer of pigment has settled at the bottom. As a result, this kind of nail polish is an illustration of a heterogeneous composition.

The nail polish that has no layer separation is made up of one phase. Thus, it is an illustration of a homogeneous combination. Some nail polish contain pigments that settle. because they are either insoluble in the solvent being employed or have different solubility. Because nail polish has a consistent composition, we may categorize it as a homogeneous mixture. Nitrocellulose and isopropyl alcohol are two substances used in nail polish. In nail polish, a pigment is used to impart the desired color. Mica, fish scales, and different colorful minerals are common pigments found in polish.

learn more about nail polish here:

https://brainly.com/question/17229575

#SPJ4

The pull of Jupiter on its moons is a _________ force.

Answers

Answer:

the answer will be the Contact

Explanation:

hope this helps you

15) Imagine ordering a dozen chicken wings. You get a combination of different shaped pieces often called "legs"
and "wings." Explain why this is an incorrect description of your food. Use anatomical vocabulary to support
your answer.

Answers

Answer:

Hello ninipaw094,

Here is the difference between the legs/wings of a chicken, in anatomical terms of course.

My research + quick summary.

A whole leg is created by removing a whole leg at the tibia-femur joint. The thigh is removed. The leg is made up of both the limb and the patella. For reference, the patella is also known as a kneecap, and it is a round piece of cartilage, embedded in a tendon to protect a joint in the leg.

A whole wing is made by removing the wing from a whole bird, then separating it at the humerus-backbone joint. The joint between the humerus and backbone is a pneumatic bone.

Thanks for your wonderful question.

Warm Regards.

In the culinary industry, calling wings and legs by their proper names is inappropriate, but using terms like "drumettes" and "flats" to refer to them is acceptable. The anatomy of the wings is made up of the humerus bone, the radius and ulna bone, while the leg has the femur bone.

What is the significance of the bones in the body?

There are bones in the body to support the animals, and some of them share similar types while others are totally different. In the chicken, the wings are made up of the humerus bone, the radius and ulna, and the wrist and hand bones, and the leg is made up of the femur bone, the tibia and fibula bones, and the ankle and foot bones.

Hence, in the culinary industry, calling wings and legs by their proper names is inappropriate, but using terms like "drumettes" and "flats" to refer to them is acceptable. The anatomy of the wings is made up of the humerus bone, the radius and ulna bone, while the leg has the femur bone.

Learn more about chicken bones here.

https://brainly.com/question/29486557

#SPJ2

Check every statement about cells that is true. Cells come in different shapes and sizes. All cells perform the same function in a multicellular organism. Cells are considered the basic structural unit of life. Cells are found in every living thing. Check every statement about the use of energy by living things that is true. Plants perform chemical reactions that require energy. Animals can use energy from the sun to produce their own food. Plants receive their energy from water in the soil. Animals can receive their energy by consuming plants or other animals.

Answers

The correct statement about cells are:

Cells come in different shapes and sizes.

Cells are considered the basic structural unit of life.

Cells are found in every living thing.

What are cells ?

Prokaryotic cells lack a nucleus but still have a nucleoid region, while eukaryotic cells do. Cells fall into either of these two categories. In contrast to eukaryotes, which can be either single-celled or multicellular, prokaryotes are single-celled organisms.

The smallest unit of life in biology, comprising all living things as well as the body's tissues. The cell membrane, nucleus, and cytoplasm are the three major structural components of a cell. A cell's membrane, which encloses it and regulates what enters and leaves it, controls the flow of chemicals.

To know more about cells you may visit the link:

brainly.com/question/19999524

#SPJ4

While performing a cross using a Punnett square, Nicholas assumes that both parents have the genotype Gg. Based on the law of segregation, what is the expected ratio of offspring genotypes?

Answers

Answer:

1:2:1

Explanation:

It describes the number of times a genotype would appear in the offspring after a test cross. For example, a test cross between two organisms with the same genotype, Rr, for a heterozygous dominant trait will result in offspring with genotypes: RR, Rr, and rr. In this example, the predicted genotypic ratio is 1:2:1.

Where does assimilation occur in the human body?

Answers

Answer:

small intestine

Explanation:

as the food enters the stomach, very strong acids and enzymes break the food further into various nutrients such as carbohydrates, proteins, and fatty acids. hence, the digestion of food is partially complete and then it is pushed into the small intestine where the assimilation of nutrients occurs.

In human bodies, assimilation takes place in the small intestine.

In biology, assimilation is the process by which living things incorporate nutrients from various external sources into their bodies and use them to meet their metabolic needs for energy.

Assimilation also refers to the process of absorbing nutrients from meals through the intestinal tract, including vitamins, minerals, and other substances.

Assimilation is frequently used to refer to the process of breaking down complex chemicals found in meals into smaller, more manageable units and then moving those units to locations in the live body where they are needed, like active cells.

In comparison to plants and insects, humans have a very complicated digestive system that allows them to absorb food and water. The digestive process begins in the stomach when food is introduced into the mouth.

The larger food particles are digested into smaller ones that are carried into cells, and hydrochloric acid kills the pathogenic germs. Following the stomach, the food is propelled into the small intestine, where it is combined with pancreatic and liver juices.

After the food has been adequately digested, the nutrients are subsequently given to the body's numerous cells, where they are needed for energy. The leftover mesh is then sent to the big intestine after the distribution of nutrients.

Therefore, it may be deduced that assimilation takes place in the small intestine in human beings.

For more details on assimilation: https://brainly.com/question/2102615

which is the largest cell in your blood?

1.plasma
2.platelets
3.wbc
4.rbc​

Answers

The largest cell in my blood is plasma

a small population of salamanders lives on an isolated island in the pacific ocean. they mate randomly and have no predators or competition for food resources. is this population in hardy-weinberg equilibrium?

Answers

In a population, a novel allele is introduced that boosts the fitness of creatures that possess it (for example, by a random mutation).

Hardy Weinberg Law: What Is It?

In the absence of any evolutionary impacts from one generation to the next,  and allele frequencies in a sizable random-mating population stay constant.

Calculating the genetic diversity of a population at equilibrium may be done using the Hardy-Weinberg equation.

After one cycle of random mating, if the allele frequencies differ from their initial values, the population is no longer in Hardy-Weinberg equilibrium, indicating that evolution has taken place within it.

haphazard mating, a sizable population, the absence of gene flow into or out of the population,  reproduction, or the absence of mutations

learn more about Hardy-Weinberg equation refer

https://brainly.com/question/16823644

#SPJ4

phenylketonuria is an inherited disease caused by a recessive allele. if a woman and her husband are both carriers, what is the probability that their first child will have the disease?

Answers

The answer is ¼. Probability of having a child with a healthy phenotype: Aa x Aa = 3/4 Healthy (half AA, half Aa): 1/4 affected (aa). The sickness will affect one or more of the three kids. All potential outcomes' probabilities must sum up to 1.

If both of them are carriers, PKU must be a hereditary condition with a recessive gene, and the parents must be heterozygotes (Pp).

Pp x Pp

The phenotypes of the genotypes PP and Pp would be typical. The PKU disease's phenotype would be expressed by the genotype pp. Phenylketonuria is a genetic condition known as PKU, and those with it have excessive quantities in their blood. The phenylalanine hydroxylase (PAH) gene mutation is to blame for this. The gene is in charge of the body's breakdown of phenylalanine.

Carriers are heterozygous people who have one copy of the trait's dominant allele and one copy of its recessive allele. The likelihood that kids from two heterozygous individuals would have either a homozygous recessive or dominant genotype is 25% for each. whereas there is a 50% chance of getting heterozygotes.

So, we can say the answer is 1/4. Chance of having a child with a phenotype that is healthy: Aa x Aa = 3/4 Healthy: 1/4 impacted (half AA, half Aa) (aa). One or more of the three children will be impacted by the illness. Probabilities of all possible outcomes must equal 1.

Learn more about phenylketonuria here:

https://brainly.com/question/29237543

#SPJ4

the secretion of enzymes from the trophoblast cells causes the blastocyst to burrow into the endometrium in a process called

Answers

The secretion of enzymes from the trophoblast cells causes the blastocyst to burrow into the endometrium in a process called implantation.

A zygote is created during fertilization when the sperm and egg combine in one of the fallopian tubes. The zygote then descends the fallopian tube, where it develops into a morula. The morula develops into a blastocyst after it enters the uterus. The blastocyst subsequently penetrates the uterine lining, a process known as implantation.

It takes many days for the fertilized egg to make the final leg of its journey to the uterus. Six to twelve days after the egg is fertilized is when the actual implantation generally takes place.

Three steps make up the implanting process: apposition (where the blastocyst meets the endometrium at the site of implantation); adhesion (where the blastocyst's trophoblast cells adhere to the receptive endometrial epithelium); and invasion (where the blastocyst's invasive trophoblast cells penetrate the endometrial epithelial basement membrane and infiltrate the endometrial stroma) (invasion).

Learn more about the implantation process here:

https://brainly.com/question/1154065

#SPJ4

What type of neuron carries impulses from all parts of the body to the central nervous system?.

Answers

Answer:

Motor neurons

Explanation:

Motor neurons of the spinal cord are part of the central nervous system (CNS) and connect to muscles, glands and organs throughout the body. These neurons transmit impulses from the spinal cord to skeletal and smooth muscles (such as those in your stomach), and so directly control all of our muscle movements. There are in fact two types of motor neurons: those that travel from spinal cord to muscle are called lower motor neurons, whereas those that travel between the brain and spinal cord are called upper motor neurons.

Motor neurons have the most common type of ‘body plan’ for a nerve cell - they are multipolar, each with one axon and several dendrites.

considering that sounds and odors both trigger changes in the patterns of action potentials in sensory neurons, how does the brain perceive which sense is which when the action potentials reach the brain?

Answers

When compared to action potentials induced by scents, those produced by sounds are distinct in size and form. The brain is approached by the action potentials.

What exactly are neurons? What do they do?

The fundamental building blocks of the brain and nervous system are neurons (also known as neurones or nerve cells). Neurons are the cells that receive sensory information from the outside world, send motor commands to our muscles, and transform and relay electrical signals at each stage along the way.

Only in the brain do neurons exist?

Neurons are the brain's electrical and chemical signal-sending cells. They function as the brain's building blocks and carry information to all of the body's tissues, muscles, and neurons.

To know more about Neurons visit:

https://brainly.com/question/29462317

#SPJ4

The sequence of amino acids was controlled by the information in the_____molecules.

Answers

The sequence of amino acids was controlled by the information in the RNA molecules.

The sequence of amino acids in a protein and its function is defined by the genetic code. Sequence in which amino acids are arranged in a protein is called primary structure.

The linear sequence of amino acids constitutes a protein's primary structure. The sequence that is written from the amino-terminal end to the carboxyl-terminal end. Sequence of bases in the DNA of the gene determines the sequence of amino acids in the polypeptide. In general , Proteins have either single polypeptides or more than one polypeptides linked together.

To learn more about amino acids , here

brainly.com/question/14583479

#SPJ4

21. For each bone shape, list the type of ossification that usually occurs during
its development:
a) long bones
b) flat bones
c) irregular

Answers

it will be an irregular

which factor was the major contributor to the rapid increase in the total human input of nitrogen between 1960 and 2000?

Answers

Rapid growth in fertilizer use and industrial processes are the main causes of the rapid increase in the overall human input of nitrogen between 1960 and 2000.

Explain about the nitrogen?

Nitrogen has a critical limiting role in plant growth and production. It is a key component of chlorophyll, the most important pigment needed for photosynthesis, as well as amino acids, which are the fundamental building blocks of proteins. It is also found in important biomolecules like ATP and nucleic acids.

Stone fruit trees require an adequate annual supply of nitrogen, which is essential for the production of amino acids, proteins, nucleic acids, and other compounds, for good growth and productivity. The fine roots of plants are the primary means through which ammonium or nitrate are absorbed by them.

Through a biogeochemical process called the nitrogen cycle, nitrogen is transformed into a variety of forms and successively moves from the atmosphere to the soil to living things and back into the atmosphere.

To learn more about nitrogen refer to:

https://brainly.com/question/11483365

#SPJ4

Someone please help me! ​

Answers

Answer:

It's A

Explanation:

Trust.

in cats, short fur is dominant over long fur. if two cats that are both homozygous dominant for fur length are bred, which combination of offspring best represents the likely outcome of the cross?

Answers

7 short fur, 3 long fur of offspring best represents the likely outcome of the cross

What is dominant and recessive trait ?

Even if there is only one copy of the dominant trait, it is always expressed when the connected allele is dominant. Only when the connected alleles are both recessive do recessive traits manifest. The associated trait is less likely to manifest if one of the alleles is dominant.

Dominant traits, to put it simply, are characteristics that are more frequently expressed and noticed in the population. Recessive traits, It is a trait brought about by a recessive gene. An expression-suppressing dominant gene is referred to as a recessive gene.

Learn more about Dominant and Recessive here:

https://brainly.com/question/20639307

#SPJ4

Which class of molecules functions as chemical signals? A:water B:carbohydrates C:hormones D:proteins

Answers

Answer:

HOMONE(especially lignand)

Explanation:

Chemical signals between cells are called ligands. A ligand is a molecule that binds another specific molecule. In the case of cell signaling, the ligand binds a receptor, a protein in or on the target cell. Examples of ligands include hormones and neurotransmitters.

i hope this helped

check all that apply when there is an increase in aldosterone secretion in response to an increase in renin by the juxtaglomerular apparatus.

Answers

There is an increase in aldosterone secretion in response to an increase in renin by the juxtaglomerular apparatus.

Potassium secretion increases.Sodium reabsorption increases.

Macular compact cells detect changes in the potassium concentration of fluid within the DCT lumen. Calcium is a substance that is regulated by absorption. Indicates whether each of the following substances is reabsorbed from or excreted into the filtrate.

The female urethra is shorter than the male. As plasma osmolarity decreases the glomerular filtration rate increases. Aldosterone stimulates the distal tubule and proximal collecting duct to reabsorb Na+ and water and excrete K+.

Learn more about Aldosterone secretion here:- https://brainly.com/question/4383817

#SPJ4

what is the transfer of oxygen and carbon dioxide between the environment and the bloodstream in the lungs called?

Answers

The process of breathing involves the exchange of oxygen and carbon dioxide.

What is the term for the exchange of gases between the blood and the body's cells?

The process through which gases are exchanged between blood and bodily tissues is called diffusion. Blood carries respiratory gas to every cell in the body. Even the most remote areas of the body's tissue are supplied with blood flow by tiny capillaries.

What does gas exchange mean between the blood and tissues and between the lungs and blood?

The circulation receives oxygen from the lungs during gas exchange. The blood and lungs exchange carbon dioxide at the same time. This occurs in the lungs between a network of microscopic blood arteries known as capillaries and the alveoli.

To know more about oxygen visit:-

https://brainly.com/question/13370320

#SPJ4

rotenone has no effect on succinate oxidation, but does lead to the accumulation of nadh. which step in the respiratory chain is rotenone likely to inhibit

Answers

Rotenone interrupts aerobic cellular respiration by blocking electron transport in mitochondria through the inhibition of the enzyme NADH ubiquitone reductase, it also prohibit the availability of oxygen for cellular respiration.

Rotenone, a botanical pesticide, is an inhibitor of one of the enzymes of Complex I of the electron transport chain.

This insecticide, blocks electrons from NADH and stops its entry inside electron transport chain, resulting in the an inability to produce ATP from the oxidation of NADH. Rotenone acts as a strong inhibitor of complex I of the mitochondrial respiratory chain (MRC).

To learn more about Rotenone, here

brainly.com/question/25254934

#SPJ4

Describe how high-energy electrons are ultimately responsible for driving the reactions of photosynthesis.

Answers

The high-energy electrons help in the transformation of NADP and ADP into NADPH and ATP in the light-dependent reactions. And this is how they contribute in driving the reactions of photosynthesis.

Photosynthesis is the process of capturing the sunlight energy in order to prepare food for the plant. This occurs in two phases in the plants: the light-dependent reactions and the light-independent reaction.

The light-dependent reaction is the one that captures the sunlight energy in order to excite an electron that helps in the synthesis of usable form of energy for the plant. This energy form is then used in the light-independent reactions for the synthesis of food.

To know more about photosynthesis, here

brainly.com/question/1388366

#SPJ4

two species of closely related squirrels both feed on acorns produced by oak trees. one species feeds exclusively near the top of the tree and the other feeds exclusively toward the bottom of the tree. this is an example of

Answers

Two species of closely related squirrels both feed on acorns produced by oak trees. One species feeds exclusively near the top of the tree and the other feeds exclusively towards the bottom of the tree. This is an example of resource partitioning.

Resource partitioning is the division of resources in an ecosystem to avoid interspecific competition for limited resources. It is an evolutionary adaptation that allows different species to coexist in the same ecological community. Resource partitioning studies aid in determining the impact of adding or removing a species from a specific habitat on the functioning of an ecosystem.

Organisms in an ecosystem require resources such as nutrients and habitats to grow, reproduce, and survive. In a habitat, there are limited resources for which all organisms compete. An ecosystem is home to thousands of species and is rich in biodiversity.

Interspecific and intraspecific competition are the two main types of competition. Interspecific competition is resource competition between individuals of different species, whereas intraspecific competition is competition within a species. Similar species have similar needs and compete for the same resources.

To know more about the Resource partitioning, here

https://brainly.com/question/15902942

#SPJ4

where is dna gyrase normally positioned as it changes positively supercoiled dna into negatively supercoiled dna in the replicating circular, bacterial chromosome?

Answers

DNA gyrase is normally positioned as it changes positively supercoiled DNA into negatively supercoiled DNA in the replicating circular, bacterial chromosome : It travels along DNA ahead of the replication fork.

What is DNA gyrase?

DNA gyrase is an enzyme in the class of topoisomerase and is a subclass of Type II topoisomerases that reduces topological strain in ATP dependent manner whereas double-stranded DNA is being unwound by elongating RNA-polymerase or by helicase in front of progressing replication fork.

DNA gyrase is an important bacterial enzyme that catalyzes ATP-dependent negative super-coiling of double-stranded closed-circular DNA. Gyrase belongs to the class of enzymes that is known as topoisomerases, involved in the control of topological transitions of DNA.

To know more about DNA gyrase, refer

https://brainly.com/question/29517288

#SPJ4

which structures of the male reproductive system produce sperm prior to ejaculation?

Answers

Seminiferous tubules, coil-like organelles seen in the testes, are where sperm are produced. Each testicle has an epididymis running along its top. Here, the sperm develop and are retained in a structure like a cord.

As it moves from spermatogenesis to ejaculation, which structures do sperm pass through first?

Then, sperm pass through the vas deferens, up the spermatic cord into the pelvic cavity, over the ureter, and into the prostate, which is located behind the bladder. To create the ejaculatory duct, which travels through the prostate and empties into the urethra, the vas deferens and seminal vesicle connect here.

When moving from spermatogenesis to ejaculation, which structures do sperm pass through first?

Sperm leaves the testes via a network of ducts that includes (in order) the epididymis, ductus deferent, ejaculatory duct, urethra.

To know more about male reproductive system visit;-

https://brainly.com/question/20561437

#SPJ4

a bomb calorimeter can provide a close approximation for the amount of energy that will be produced by the body through the process of metabolism.

Answers

True, The amount of energy that will be generated by the body throughout the process of metabolism can be roughly predicted using a bomb calorimeter.

What consumes the majority of the daily overall energy expenditure?

The biggest daily energy expenditure is determined by the body's BMR (50–80 per cent of your daily energy use). Your body utilizes energy to breakdown the food and liquids you consume as well as to absorb, transport, and store their contents. This process is known as the thermogenic effect of food (also known as thermogenesis).

Which of the following is a plausible justification for men having a higher BMR than women?

Lean body mass is often higher in men. Because men typically have greater lean body mass than women do, gender has an impact on basal metabolic rate (BMR).

To know more about metabolism visit:-

https://brainly.com/question/19664757

#SPJ4

what are the methods of ossification that occur in the development of the skeletal system?

Answers

The two kinds of bone ossification are endochondral and intramembranous. Each of these procedures starts with a precursor of mesenchymal tissue, but they differ in how that precursor develops into

What sort of tissues are mesenchymal?

Cartilage: Collagen constitutes the majority of cartilage. In a cartilaginous matrix, chondrocytes are produced by chondroblasts, which are the source of this substance. Although robust, it is highly dense and strong. The chondrocytes, which are present within an extensive matrix in adult cartilage that has formed, are few in number.

Where does mesenchymal tissue reside?

While essential to formation during development, mesenchyme is typically a transitory tissue that is absent from adult organisms. Mesenchymal stem cells are the one exception, which are sporadicy present in marrow, lipids, muscles, and the dental pulp of infant teeth.

To know more about mesenchymal tissue visit:

https://brainly.com/question/4522715

#SPJ4

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?​

Answers

Original DNA Sequence: TACTTTAATCCCAAATTTACT

Mutated DNA Sequence: TACTATAATCCCAAATTTACT

mRNA Sequence: ATGGAACCGCTGGTGA

Amino acid sequence: UACCUUGGCGACCACU

The type of mutation is Frameshift mutation.

What is frameshift mutation?

The disruption of a DNA sequence's triplet reading frame due to an insertion or deletion involving base pairs that are not multiples of three.  A frameshift mutation causes the codons read after the mutation to code for alternative amino acids. The first stop codon (UAA, UGA, or UAG) that is met in the sequence will likewise be altered by the frameshift mutation.

What is mutation?

A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell division, exposure to mutagens, or viral infection can all cause mutations.

To know more about mutation visit

brainly.com/question/17130462

#SPJ1

Other Questions
In the summer of 1942, blacks began to train at Camp Lejune to serve in what branch of the military, overturning an exclusionary policy which was as old as the service itself?Marines Need an answer help please A football club sells, on average, 23000 tickets per match. In one season they play, on average, 46 matches.How many tickets do they sell, on average, each season? both peter singer and jeremy bentham hold that utilitarian calculations must take into account the pleasure and pain of all sentient creatures. What order doe von Galen ay Berlin i giving concerning the treatment ofpatient from mental aylum? What jutification doe the German governmenthave for thi practice? private markets are those like the nyse, where transactions are handled by members of the organization, while public markets are those like the nasdaq, where anyone can make transactions. group of answer choices true false the nurse is reviewing the record of a pregnant client and notes that the primary health care provider has documented the presence of chadwick's sign. which clinical finding supports the documentation of chadwick's sign? what allowed women farming in the north to be more successful than the women working on the small farms of the south during the civil war? All else being equal, an increase in government spending would shift the ______ line to the ______, causing interest rates to _______ and the trade balance to _______. according to content in recognizing and addressing mental health concerns, which of the following is an appropriate way to address substance misuse behaviors with a friend or family member? . Which of the following is a "simple sentence"?*1 pointLife under the sea is mysterious, because there is a whirlwind of activity we cannot see.Some marine biologists study ocean animals, and others study ocean plant life.If you are interested in sharks, you could become a marine biologist, or you could volunteer at an aquarium.There are many types of fish in the ocean, including cod, marlin, and sturgeon. The rate of which disease decreases with increasing acculturation of Japanese in America?a. cardiovascular diseaseb. type 2 diabetesc. stomach cancerd. obesitye. colon cancer One example of a civic responsibility that is not a requirement is Find the length of one leg of a right triangle if the length of the hypotenuse is 18 ft and the length of the other leg is 14 ft. Round to the nearest tenth What are some possible solutions for the following inequality?-3x+5x-2>-4x+1 Brad gave a boring presentation to the team. Valentina made fun of brad in front of everyone. This is an example of ____________. A rectangle has a length of 12 inches and a width of 2 inches whose sides are changing. The length is increasing by 10 in/sec and the width is growing at 4 in/sec. What is the rate of change of the perimeter? which drug increases the risk of colonization by candida albicans and the subsequent development of systemic infection? select all that apply. one, some, or all responses may be correct. which best describes the reason for increased european sailing voyages during the age of discovery? responses explorers were seeking to find the lost ark of the covenant. explorers were seeking to find the lost ark of the covenant. , , explorers were seeking to find new routes to australia and the philippines. explorers were seeking to find new routes to australia and the philippines. , , explorers were seeking to find new routes to the spice markets of asia. explorers were seeking to find new routes to the spice markets of asia. , , explorers were seeking to find the land bridge that connected europe to the americas. Enter segments in the blanks provided that would result in a true equation.