Which characteristic would you find in an advanced organism?
A acoelum organism
B protostome organism
C pseudocoelum organism
D deuterstome organism

Answers

Answer 1

Answer:

Deuterosome

Explanation:

This because deuterosome are organisms which posses both mouth and anus. The mouth is in the opposite side as anus. These is normally found in advance organism compare to prostosome which have mouth only.

The deuterosome are mainly chordates, echinoderms e.t.c.


Related Questions

a mutation in the HBB gene,which codes for hemoglobin , produces red blood cells that are rigid and sickle shaped (is that beneficial, neutral, or harmful

Answers

Answer: harmful

Explanation:


Normally, red blood cells are flexible and oval-shaped, which allows them to move easily through the blood vessels and deliver oxygen to the body's tissues. However, sickle-shaped red blood cells are inflexible and can become stuck in small blood vessels, blocking the flow of blood and oxygen. This can cause a range of serious health problems, such as pain, infection, organ damage, and even death.

Describe the four layers of the Earth and the response of at least three sentences name at least one important quality of each layer

Answers

Answer: the four layers of earth are: the inner core, the outer core, the mantel, and the crust. The inner core contains the heaviest elements and solid metals. The outer core is liquid and not as hot than the inner core. The mantel is the densest its solid but moves and that causes the earth quakes on the surface. The crust is the thinnest which is different under the ocean and on the continents. Its the coolest of all four  and it consists of plates that are moving.

Explanation:

Which of the following statements about dinoflagellates is false?
A) They possess two flagella.
B) Some cause red tides.
C) their walls are composed of cellulose plates.
D) Many types contain chlorophyll.
E) Their fossil remains form limestone deposits.

Answers

The false statement about dinoflagellates is their fossil remains form limestone deposits.

Thus, the correct answer is E.

What are dinoflagellates?

Dinoflаgellаtes аre motile unicellulаr аlgаe chаrаcterized by а pаir of flаgellаe. Mаny dinoflаgellаtes аre photosynthetic, whereаs others аre mixotrophic. Whereаs most аre strictly mаrine, some dinoflаgellаtes occupy brаckish аnd freshwаter environments.

Dinoflаgellаtes аlso exhibit remаrkаble trаits: In аddition to chlorophyll, some possess cаrotenoid pigments (dinoxаnthin аnd peridinin), giving them а flаmboyаnt red colorаtion, whereаs others аre bioluminescent. Some species form blooms in the oceаns, а phenomenon cаlled “red tide” due to colorаtion of the wаter resulting from the intense concentrаtion of аlgаl cells. Dinoflаgellаtes аre encrusted with plаtes mаde of а cellulose-like mаteriаl аnd silicа.

For more information about dinoflagellates refer to the link:

https://brainly.com/question/28902387

#SPJ4

What was one strength of Darwin's theory?

a. He knew about genetics.
b. He knew that species change quickly in spurts.
c. A large amount of data supported his work.
d. He knew that some organisms reproduce at a greater rate than others.

Answers

Answer: C. A large amount of data supported his work.

Darwin did not know that genetics existed, but he did collect evidence from birds with a common ancestor and theorized that they split because of evolution.

Have a good day!

The one strength of Darwin's theory is the large amount of data which is supported by his work. Thus, the correct option is C.

What is Darwin's theory?

Darwin proposed a theory which describes that a species can change over time, that a new species come from the pre-existing species, and that all the species share a common ancestor. In this model of Darwin, each species has its own unique set of heritable or genetic differences from the common ancestor, which have been accumulated gradually over a period of very long period of time.

Darwin used multiple lines of evidence to support his theory of evolution of population through natural selection such as fossil evidence, biogeographical evidence, and anatomical evidence. The one strength of Darwin's theory is the large amount of data which is supported by his work.

Therefore, the correct option is C.

Learn more about Darwin's theory here:

https://brainly.com/question/25718754

#SPJ2

The life supporting zone of the earth is *
A) Lithosphere
B) Hydrosphere
C) Atmosphere
D) Biosphere

Answers

Answer:

The correct answer is D) Biosphere. The biosphere is the part of the earth that supports life. It includes all of the living organisms on earth, as well as the air, water, and soil that they depend on. The lithosphere, hydrosphere, and atmosphere are also important parts of the earth, but they do not directly support life in the same way that the biosphere does.

Explanation:

Which of the below terms would be different if the reflex were a balance reflex? What term would you substitute?
Pain receptor, sensory neuron, spinal cord, motor neuron, & effector muscle.

Answers

Answer:you i am minon pituf an red

Explanation:

Which of the following would be a reasonable conclusion if hair was found to have a drug in the middle of the strand but not in the rest of the hair strand?
Drug use is not identified.
Drug use is currently happening.
Drug use occurred several weeks ago.
Drug use has occurred for several months.

Answers

Answer:

drug use occurred several weeks ago.

Explanation:

Sudden infant death syndrome, preterm births and low birth weights, respiratory problems, and cardiovascular problems are more common among the offspring of mothers who ______ during pregnancy.

Answers

Sudden infant death syndrome, preterm births and low birth weights, respiratory problems, and cardiovascular problems are more common among the offspring of mothers who smoked during pregnancy.

Smoking during pregnancy can result in various different types of challenges during birth and mostly results in premature births, babies being born with low weights, or sudden infant death syndrome.

The lungs of infants whose mothers smoked during pregnancy are damaged which causes severe breathing problems in the child. It also causes the child to not develop properly and have respiratory or cardiovascular problems. Women who smoked during pregnancy can also cause severe complications to their own lives at the time of delivery.

To learn more about pregnancy, click here:

https://brainly.com/question/862356

#SPJ4

the feeling that ejaculation can no longer be controlled is called ejaculatory: a. intervention. b. inevitability. c. excitement. d. orgasm.

Answers

the feeling that ejaculation can no longer be controlled is called ejaculatory: b. inevitability

What is the name of the signaling molecules used in endocrine signaling?

Answers

Answer:

The signaling molecules used in endocrine signaling are called hormones. Hormones are chemical messengers that are produced by glands in the endocrine system and released into the bloodstream, where they can circulate throughout the body and regulate the function of various organs and tissues. Some examples of hormones include insulin, thyroid hormone, and estrogen.

Explanation:

The _____ control(s) the force of a movement, whereas the_____ control(s) the timing and accuracy of the movement.a.motor cortex; basal gangliab.basal ganglia; motor cortexc.basal ganglia; cerebellumd.cerebellum; basal ganglia

Answers

The basal ganglia A movement's force is controlled by the cerebellum, while its timing and accuracy are controlled by the cerebellum.

What determines a movement's force?

The Motor Complex The brain is in charge of all voluntary actions of the body. The motor cortex is one of the parts of the brain that is most crucial in regulating these voluntary movements.

What function does the basal ganglia play in motor control?

The network of brain cells and nerves that manages your body's voluntary motions includes the basal ganglia as a significant component. Your brain sends movement signals that they can either approve or reject, screening away erroneous or superfluous impulses.

To know more about basal ganglia visit :-

https://brainly.com/question/4109433

#SPJ4

I WILL LOVE YOU FOREVER IF YOU ANSWER THIS TONIGHT : Tall red-flowered plants are crossed with short white-flowered plants. The resulting F1 generation consists of all tall pink-flowered plants. Assuming that height is a simple case of dominance and flower color involved incomplete dominance, determine the results of an F1 cross of TtRW plants. Determine the gametes, then using a Punnett square, find the genotypes and phenotypes of the F2 generation.

Answers

When the dihybrid cross is made between two TtRW plants, then the ratio of genotype produced from this cross will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).

What is inheritance?

Inheritance is the process through which genetic information is passed on from the parents to their offspring. This is possible through the gametes which fuse together to form zygote (2n). This zygote have similar characteristics to both of the parents.

In mendelian inheritance, complete dominance is observed which states that an allele could be completely dominant or completely recessive there is no in between.

However, some exceptions like incomplete dominance and codominance have been found later where, the presence of two contrasting alleles will lead to development of a phenotype which is in between the two.

In the F2 generation of the cross between the TtRW plants. The phenotype ratio will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).

Learn more about Dominance here:

https://brainly.com/question/14053639

#SPJ1

Name the main layers of a tropical rain forest. What kinds of plants grow in each
layer?

Answers

Answer:

Most rainforests are structured in four layers: emergent, canopy, understory, and forest floor.

In the process of , DNA is used as a template for making another type of nucleic acid called . The process begins when the enzyme binds to a region called the .


Answers

In the process of transcription, DNA is used as a template for making another type of nucleic acid called RNA. The process begins when the enzyme RNA polymerase binds to a region called the promotor.

What is transcription?

Transcription is a genomic process in which RNA is generated from DNA. This will generate an mRNA that will contain the genetic information of the protein that the gene encodes.

Transcription will be generated in the nucleus of the cell, there the RNA polymerase will bind to the DNA in the promoter to begin to generate the RNA copy, generating a transcription bubble to generate the RNA.

The transcription is preceded by the traduction that will take place in the cytoplasm of the cell to generate proteins from the mRNA.

Therefore, we can confirm that in the process of transcription, DNA is used as a template for making another type of nucleic acid called RNA. The process begins when the enzyme RNA polymerase binds to a region called the promotor.

To learn more about transcription visit: https://brainly.com/question/14136689

#SPJ1

More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause

Answers

A sharp increase in capillary hydrostatic pressure would directly cause an increase in fluid movement to the interstitial spaces.

Capillary hypertension causes the production of a protein-poor ultrafiltrate, which when it enters the interstitial space increases the amount of the interstitial fluid.

A rise in small artery, arteriolar, or venous pressure raises capillary hydrostatic pressure, which favors filtration. Fluid filtration will be reduced if the hydrostatic pressure gradient (PC - Pi) reduces due to an increase in interstitial pressure. Large rises in tissue interstitial pressure, on the other hand, can cause tissue damage and cellular death.

Edema occurs when plasma oncotic pressure falls, hydrostatic pressure rises, capillary permeability rises, or a combination of these variables occurs. When lymphatic flow is impeded, edema can develop.

For more information on capillary hydrostatic pressure, visit :

https://brainly.com/question/28274088

#SPJ4

Down syndrome can be observed in a karyotype/karyogram Xray frameshift point mutation

Answers

Down syndrome can be observed in a O karyotype/karyogram O X ray O frameshift point. DNA replication is necessary for all the responses are correct O growth

If a strand of hair has a continuous medulla pattern, and the Medulla Index is 42, what species would it most likely be from?
Cat
Insect
Human
Polar Bear

Answers

Polar bear because it’s white

Answer:

It's a cat

Explanation:

I got it correct on my exam.

When the medulla index is above 33 and has a continuous pattern it's animal hair.

where would you except to find the most of the sedimentary rocks on earth

Answers

Chemical sedimentary rocks can be found in many places, from the ocean to deserts to caves. For instance, most limestone forms at the bottom of the ocean from the precipitation of calcium carbonate and the remains of marine animals with shells.

NEED HELP DUE TOMORROW

Answers

Dependent variable is the amount of dirt and independent variable is the type of detergent used.

What are variables?

Variables are defined as any characteristics, number or quantity which can be measured . It can also be called as a data item . It is called as variable because they can vary and can have variety of values.

There are three types of variables 1) manipulated variable where in a condition is specified, 2) responding variable which is dependent on manipulated variable 3)controlled variable which do not change

Example of manipulated variables are number of hours spent by a student studying , that of responding variable is result of a student and temperature is an example of controlled variable.

Learn more about variables,here:

https://brainly.com/question/15740935

#SPJ1

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Answers

Anwser: Methionine-Proline-Glutamate.

The chain of amino acids would be produced by the given sequence of mRNA is as follows:

Tyr-Tyr-Ala, Val-Asn-Cys.

What do you mean by Amino acids?

Amino acids may be defined as the building blocks or monomers of proteins. They usually consist of an amino group, a carboxyl group, a hydrogen atom, and a distinctive side chain. These monomers are held together by peptide bonds in order to make a protein.

The codon UAU codes for the amino acid tyrosine. While the codon GCC codes for the amino acid alanine. There are three stop codons that terminate the synthesis of proteins. They are UAA, UGA, and UAG. While the codons GUG, AAU, and UGC encode for valine, asparagine, and cysteine.

Therefore, the chain of amino acids would be produced by the given sequence of mRNA is well described above.

To learn more about Amino acids, refer to the link:

https://brainly.com/question/14351754

#SPJ2

4. As food travels through the digestive system, it is exposed to a variety of pH
levels. The stomach has a pH of 2 due to the presence of hydrochloride acid (HCI),
and the small intestine has a pH ranging from 7 to 9. HCI converts pepsinogen into
pepsin, an enzyme that digests proteins in the stomach. Which of the following most
likely happens to pepsin as
it enters the small intestine?
A. It becomes inactive.
B. It begins to replicate.
C. It's shape changes to engulf large proteins.
D. It's activity increases
to digest more proteins.

Answers

A, it becomes inactive, it is no longer effective in the small intestines


Body Systems
Which body system
transports oxygen and
nutrients to the body and
aids in the removal of
carbon dioxide and other
waste products?

Answers

Answer:

it would be The circulatory system

Explanation:

because it said transports oxygen and it the circulatory carry blood away towards the heart.

The region identified by location 4 on the map is classified as belonging to the tundra biome. Which of the following climate graphs most accurately depicts the conditions found in this biome?
A
B
C
D

Answers

Answer:

B

Explanation:

For more proof look at the second image

based on the information provided in the passage, which of the following best describes the effect of harmful algal blooms on otter populations?

Answers

'They are a density-independent factor that negatively affects the otter population regardless of its size' best describes the effect of harmful algal blooms on otter populations.

What are Algal blooms?

Algal blooms are large concentrations of aquatic microorganisms, primarily algae, that can occur in freshwater and marine ecosystems. They can range in color from green to yellow, brown, or red. Algal blooms are caused by an overgrowth of algae due to an abundance of nutrients, such as phosphorus and nitrogen, that are released into the water from sources such as agricultural runoff, sewage, and fertilizer. While some algal blooms are harmless, others can produce toxins that can be harmful to humans, wildlife, and the environment.

Hence, Option A is correct.

To know more about Algal blooms,

https://brainly.com/question/725774

#SPJ4

Complete question:

Based on the information provided in the passage, which of the following best describes the effect of harmful algal blooms on otter populations?

A) They are a density-independent factor that negatively affects the otter population regardless of its size.

B) They are a density-independent factor that increases otter mortality in larger populations.

C) They are a density-independent factor that reduces otter numbers at lower population sizes.

D) They are a density-independent factor that increases otter mortality in only larger populations.

This plant group does not require water for sexual reproduction. this plant group does not require water for sexual reproduction. nonvascular plants seedless vascular plants seed vascular plants all of the above none of the above

Answers

because it is having asexual reproduction

which of the following is not true about the cell membrane

Answers

Phospholipid heads are negative and attracted to water is not true about the cell membrane.

The heads aren’t the same thing they are a bit different than what you see at the end and the end but the head has a lot to do with the shape of the head and the shape of the body and the shape it is in the body and the body is the

sort the following protein complexes of the electron transport chain according to whether they are involved in pumping protons across the inner mitochondrial membrane or not.

Answers

A protein complex is a sub-atomic machine that comprises a few proteins (nucleic acids and different particles) that tight spot each other at a similar spot and time (e.g., record factors, histones, polymerases, and so forth.).

An electron transport chain is an assortment of protein edifices and different particles that utilize redox responses to energize an electron from electron givers to electron acceptors while likewise moving protons across a layer. Electrons are moved to start with one particle and then onto the next in the electron transport chain, and the energy delivered during these electron transporters is utilized to frame an electrochemical slope. The put-away energy in the angle is utilized to deliver ATP in chemiosmosis.

For more information on Electron Transport Chain, visit :

https://brainly.com/question/24372542

#SPJ4

Which two conditions will contribute to the stability of drug-target interactions?
Options:
-The potential energy of the drug-target complex is at its lowest

-The shape of the drug molecule fits into the binding pocket of the target molecule

-The diffusion coefficient of the cell is very small

-The internal energy of the molecule is lower than the ambient temperature

Answers

Answer:

Two conditions that can contribute to the stability of drug-target interactions are:

-The shape of the drug molecule fits into the binding pocket of the target molecule. This allows the drug to interact with the target in a specific, complementary way, which can increase the stability of the complex.

-The potential energy of the drug-target complex is at its lowest. This means that the drug and target molecules are interacting in a way that minimizes the overall energy of the system, which can increase the stability of the complex.

pls award brainliest!

Explanation:

eweeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeewewee

Answers

Answer:ewe

Explanation:

ewe.

yup exactly true so true

review the relationship between genotypes and phenotypes by clicking and dragging the labels to the correct location to correctly complete each statement.

Answers

Genotype alludes to the alleles you have for a specific quality or set of qualities. phenotype is the actual quality itself, which might be affected by genotype and natural variables.

The term "phenotype" alludes to the detectable actual properties of a life form; these incorporate the organic entity's appearance, improvement, and conduct. An organic entity's not entirely set in stone by its genotype, which is the arrangement of qualities the living being conveys, as well as by natural impacts upon these qualities.

A singular's genotype is the blend of alleles that they have for a particular quality. A singular's aggregate is the mix of perceptible attributes or qualities. While a living being's genotype is straightforwardly acquired from its folks, the phenotype is just impacted by the genotype.

To learn more about genotypes and phenotypes here

https://brainly.com/question/20730322

#SPJ4

Other Questions
3CompletarFill in the blanks with the appropriate form of the verbs.1. T(seguir) el partido por la radio.2. Csar y yo(preferir) jugar al voleibol.3. Los Pumas de la UNAM(jugar) en el estadio.4. El jugador(pedir) una pelota de tenis.5. Sofa(empezar) a ver una pelcula.6. Mariana(or) la radio por la tarde. )) A line's slope is 6, and its y-intercept is 6. What is its equation in slope-intercept form? Classify each of the following based on the macroeconomic definitions of saving and investment. Saving Investment Edison purchases a certificate of deposit at his bank. Maria purchases stock in NanoSpeck, a biotech firm. Hilary purchases new ovens for her cupcake-baking business. Kevin takes out a loan and uses it to build a new cabin in Montana. Why were the Nuremberg Laws so effective in discriminatingagainst German Jews? What were the benefits of purchasing Alaska? 2. Which agricultural specialist is most likely to perform research to understand factors impacting the pH of soil?A. EntomologistO B. Animal scientistC. Plant pathologistD. Agronomist Im for real confused now lol LOOK AT THE PHOTO Which of the a-values satisfy the following inequality? 7 + a < 11 Choose all answers that apply: a = 3 B a = 4 a = 5 What is the genetic relationship between individuals Level 1 - 2 and LevelIII - 4 How does an amino acid-based hormone changes a cells activity Any drug that also acts as a respiratory depressant willthe effect of alcohol.A. intensifyB. weakenC. negate HELP PLEASE I DONT KNOW WHAT TO DO There are 378 calories in 7 servings. Find the unit rate. HELLPPP 2. If you drank two 12-ounce cans of soda each day for a year, how much money would you have spent? The power went out. Lightning struck the electrical lines. What is the value of the expression below?[(3 (-5)) - 10] = |2 + (-7)| I am well known amongst students .U might be familiar with me bcos am easy to grab.My calculations involve a geometric figure with a number of sides .Remembering SOH , CAH , TOA alone is not a clue to find me Who am I ? What is an overly broad reference?A. It is a reference that occurs when the antecedent of a pronoun isassumed.B. It is a reference that occurs when the antecedent of a pronoun isunclear.C. It is a reference that occurs when the antecedent of a pronoun isone or more general ideas or concepts instead of a single noun orsimple noun phrase.D. It is a reference that occurs when there are two or more nouns in asentence that a pronoun could replace. Which of the following Mauryan top advisors took over a kingdom and exiled the King for insulting him?AshokaBindusaraChanakyaChandragupta Regular physical activity is important for maintaining a healthy weight, boosting mood, and reducing risk for diabetes, heart attack, and stroke.a. Trueb. False