Which American in the early 20th century would most likely oppose antitrust acts?

Answers

Answer 1

The American in the early 20th century that would most likely oppose antitrust acts would be Andrew Carnegie.

What is Antitrust Act?

This refers to the law that was made to stop monopolistic businesses from merging and emerging.

Hence, we can see that the Sherman antitrust acts wanted to prevent monopoly and they went after such businesses, and a key opposition of this in the 20th Century would have been Andrew Carnegie due to his monopoly of the steel company.

Read more about antitrust acts here:

https://brainly.com/question/26696794

#SPJ1

Answer 2

The American in the early 20th century that would most likely oppose antitrust acts would be Andrew Carnegie .


Related Questions

Which of these Jewish sacred texts is also known to Christians who as the old testament

Answers

Answer:

Tanakh

Hebrew Bible

Explanation:

hope this helps

Analyzing an author's use of descriptive words and phrases can reveal________
A. vernacular
OB. tone
OC. rhetoric
D. logos

Answers

Answer:

I would say tone

Explanation:

I think it is tone.

social darwinism depends on what government factor in the economy?

Answers

Social Darwinism depends on government factor in the economy which includes tax, imperialism, and stability in the government.

What is Social Darwinism?

According to social Darwinism, only the plants and animals that are best adapted to their environment will be able to breed and pass their genes on to future generations.

It emphasizes the concept that "Survival of the fittest,". The belief of this theory states that certain people rise to prominence in society because they are simply stronger. Imperialism, racism, discrimination, and social inequality have all been explained by social Darwinism.

Learn more about social darwinism, here:

https://brainly.com/question/2000364

#SPJ1

A free enterprise system provides individuals the opportunity to make their own economic decisions, without restrictions from the govern

Answers

It is TRUE that a free enterprise system provides individuals the opportunity to make their own economic decisions, without restrictions from the government.

What is a free enterprise system?

A free enterprise system is characterized by:

Unrestricted business activities and ownershipFree tradeLack of government interventionMarket forces demand profits and prices.

In a free enterprise system, investment, production, and distribution are guided by the forces of supply and demand.

Thus, it is TRUE that a free enterprise system provides individuals the opportunity to make their own economic decisions, without restrictions from the government.

Learn more about free enterprise systems at https://brainly.com/question/3369578

#SPJ1

In 1914, who controlled the shaded areas on the map?
A. Spain
B. Germany
C. France
D. Great Britain

Answers

Answer:

c.France

in this year 1914 France controlled most of the areas

In 25 words or fewer, explain why you think there are so many
independent nation-states in the world.

Answers

Answer:

Because when you are independent you get to abide by your own rules and you aren't governed by someone else.

There are so many independent nation-states because the demands of various peoples vary depending on their unique histories, cultures, and geographic locations.

What is a nation-state?

In a nation state, the state and the country are one political entity. Since a nation does not always need to have a dominating ethnic group, it is a more specific definition than "country".

A form of government characterized by geography, politics, and culture is known as a nation state. The state is the organ of government, while the country is the collective cultural identity of the people.

In comparison to earlier models of state structure, nation states offer three major benefits. They are the only setting in which democracy can emerge, they do not tend to expand their area, and their absence of a centralized government has allowed their cultures and economy to grow.

To learn more about nation-state

https://brainly.com/question/19725615

#SPJ2

What was Scott's argument for freedom?

Answers

Scott became constrained by the freedoms of citizenship he had believed he was given, despite the fact that he became visible as a free man withinside the north.

What became the Dred Scott decision?

The Dred Scott selection became the U.S. Supreme Court’s ruling on March 6, 1857, that having lived in a free country and territory did now no longer entitle an enslaved person, Dred Scott, to his freedom.

In essence, the selection argued that, as someone's property, Scott became now no longer a citizen and couldn't sue in a federal court.

Therefore, Scott became constrained by the freedoms of citizenship he had believed he was given, despite the fact that he became visible as a free man withinside the north.

Learn more about Dred Scott decision here:

https://brainly.com/question/315266

#SPJ1

Use the excerpt from Lyndon Johnson's “war on poverty” speech to answer the question.

Which of the following characteristics of modern American liberalism does this excerpt from Johnson BEST reflect?

A.
support for civil rights

B.
support for Affirmative Action

C.
support for women’s rights

D.
support for government programs

Answers

Answer:

D support for government programs.

Explanation

What President Johnson's speech brought to pass was astonishing.

It got people moving at a pace that really is inspiring and they were all moving toward one goal, They started building more schools so kids could go and learn so they could get better jobs.

They built police academies so there would be more enforcement and they made way for a better stronger country where people could support themselves and support their families because now people had the education they needed to work at jobs that used only the rich could work at and that brought a stronger place that we now live in and still feel the effects of it.

Question 8 of 10
Which statement best describes an advantage of indirect democracy over
direct democracy?
A. It can make decision making more efficient.
B. It can better reflect the democratic principle of majority rule.
OC. It can help citizens feel more connected to government.
D. It can be more responsive to citizens' interests.

Answers

The statement which best describes the advantage of indirect democracy over direct democracy is it can be more responsive to citizens' interests. Thus the correct answer is D.

What is democracy?

Democracy is a process of selecting a governance body by choosing your own representatives with the help of public voting who work for the welfare and development of the country.

In an indirect democracy, as the representatives are elected by the people, for the people so they will better respond to the interest of citizens to provide the best facilities in the country.

Therefore, option D more responsiveness to citizens' interests is the correct answer.

Learn more about democracy, here:

https://brainly.com/question/13158670

#SPJ1


The Warsaw Pact was developed by the Soviet Union MAINLY as a response to which event?
A. the capture of American spy Francis Powers
B. the division of Germany into occupation zones
C. the Berlin airlift of 1948
D. the formation of the North Atlantic Treaty Organization (NATO)

Answers

D: the formation of the North Atlantic Treaty Organization (NATO)

d. The Maya repaid their g _s through​

Answers

Answer:

goods and coca beans

Explanation:

I know this since I learned it in I think 4th grade and I remember the Mayas.

11A
11A
11A
11A
Explain the political, economic, and social factors involved in the U.S. role in the world in
regards to the following events:
Social
Political
Economic
End of the Cold War
Persian Gulf War
Balkans Crisis
9/11

Answers

Answer:

seal team

Explanation:

yea so if 11a went hand and hand with the D\567 op SF , it would be almost imposs for iot to collide

The SALT agreement limited the arms race between the United States and

Answers

The SALT agreement limited the arms race between the United States and the Soviet Union.

What is SALT agreement?

This is an agreement that was out in place in order to restrain the arms race.

In this case, the The SALT agreement limited the arms race between the United States and the Soviet Union. This was around the 1970s.

Learn more about salt agreement on:

brainly.com/question/16001670

#SPJ1

What was George washington role in the french qnd indian war

Answers

Answer:

For Washington the French and Indian War started in late 1753, when he was selected as the British emissary to the French frontier establishment. It ended with the fall of Fort Duquesne to the combined British and colonial forces. He was a young and ambitious man when he volunteered.

Explanation:

Can someone please help me with these questions Im struggling with them!

Answers

1. He fell asleep under the oak tree, feeling free.
2. Tom tried learning a new tune.
3. Philipe hoped for a copper cup.

hope this helps!

According to Booker T. Washington, a people recently “from slavery to freedom”, had to make the best of their situation and “live by the productions of [their] hands” and “learn to dignify and glorify common labor” . . . in other words, “cast down your bucket where you are”.

True

False

Answers

It is A. True that Booker T. Washington urged the people who recovered “from slavery to freedom” to make the best of their situation.

Who was Booker T. Washington?

Booker T. Washington became an American intellectual after recovering from years of slavery and no formal education.

For Booker, black people should accept the following facts about their lives:

Racial discriminationNeed for self-helpRacial solidarity among blacks.

Indeed, Booker T. Washington as an intellectual urged African Americans to elevate their situation and recovery through hard work.

Thus, it is A. True that Booker T. Washington urged the people who recovered “from slavery to freedom” to make the best of their situation.

Learn more about Booker T. Washington at https://brainly.com/question/1155673

#SPJ1

WILL MARK BRAINILIEST
List the progression of acts and legislation between 1935 and 1941 and explain why the chronology is
significant in relation to America's involvement in WWII.

Answers

Answer:

First, a representative sponsors a bill. The bill is then assigned to a committee for study. If released by the committee, the bill is put on a calendar to be voted on, debated or amended. If the bill passes by simple majority (218 of 435), the bill moves to the Senate.

Explanation:

What was one major effect of urbanization on British citizens' lives during the Industrial Revolution?
O A. Governments cut taxes to encourage more migration to cities.
O B. Mortality and fertility rates in cities declined rapidly.
O C. Poor families generally gained access to better housing.
O D. Diseases spread rapidly through overcrowded cities.​

Answers

Mortality and fertility rates in cities declined rapidly major effect of urbanization on British citizens' lives during the Industrial Revolution. During industrial revolution there is hardship for workers.

What were the effects of urbanization during the Industrial Revolution?

Rapid urbanization, or the migration of citizens to cities, was an outcome of the Industrial Revolution. Agricultural changes, booming population development.

An ever-increasing demand for workers prompted a massive migration from farmland to cities. Small villages around coal or iron mines evolved into cities almost instantly.

Thus, option B is correct.

For more information about urbanization during the Industrial Revolution, click here:

https://brainly.com/question/14699263

#SPJ1

Now imagine you are leading a group of students around a museum and arrive at this image. Write a brief explanation of what you would tell the students to help them understand the history of this image. Use your interpretation of the image, information from the map above, the tutorials you've completed in this unit, and the sources linked above. Here are some questions to help you get started:

Where did the journey shown most likely begin?
Where are these people going, and why?
What challenges did the people on this journey face, and how did they overcome them?
What most likely happened to these people when they reached their destination?
What historical events motivated this journey?
How did this journey shape history after it?

Answers

Assuming you are leading a group of students to visit the Mona Lisa work, you can conduct an artistic analysis of the work for a better understanding of the painting.

What are the characteristics of the artwork?

The Mona Lisa painting was painted by Leonardo da Vinci between 1503 and 1506, located in the Louvre museum in Paris, this is one of the most visited works in the world. It is an oil painting on wood from the Renaissance period, which depicts the image of a mysterious woman.

Therefore, in a student visit to a museum, such as the Louvre, several cultural, social and artistic aspects can be identified, helping in a dynamic learning and expanding the students' vision of the historical periods of human civilization.

Find out more about Mona Lisa here:

https://brainly.com/question/13953479

#SPJ1

Most amendments to the Constitution proposed by Congress _____.

Answers

Answer:

passed

Explanation:

most of the amendments passed. How I know this is 4/5'ths of amendments proposed have passed congress and gone on the become amendments

Answer:

Never make it to the states

Explanation:

Hope this helps! :)

Which of the following roles does an introduction not play in an explanatory
essay?
O A. It gets the readers' attention and makes them want to read more.
O B. It gives readers something to ponder after reading the essay.
O C. It introduces the essay's most important claim.
O D. It provides background information about the essay's topic.

Answers

Answer:

C of Christ.

Explanation:

Font: Confidence.

1. State five importance of historial location​

Answers

Answer:

The Colosseum:

✎ it is the grandest amphitheater from the time of ancient Roman Empire.

✎a monument to ancient Rome's architectural and engineering prowess.

✎ a major source of tourism revenue for the Italian government.

✎ a site of the death of early Christians

✎ shows the early Roman's militaristic nature and elegant architecture.

Explanation:

Why is it important to consider the historical context surrounding an event
when making a historical interpretation?
A. A conclusion that does not consider context is a generalization
rather than an interpretation.

OB. Historical interpretations are only valid if they are written in a
similar context as the event.

C. Events happening at the same time might have influenced one
another.

OD. Every historical interpretation must consider political and social
consequences of an event.

Answers

The historical interpretation surrounding an event should be considered when interpreting it because the events happening at the same time may have influenced one another.

What is meant by a 'historical interpretation'?

Historical interpretation refers to describing, examining, valuating, and producing an explanation for past events. When understanding an event, the historical interpretation rounding it should be evaluated because events happening at the same time may have influenced one another.

Therefore, choice C is correct.

For further information on the historical interpretation, refer to:

https://brainly.com/question/8664399

#SPJ1

Discuss key leaders of Athenian democracy and their contributions. How does the United States practice these democratic ideas?

Answers

Athenian democracy developed around the 6th century BC in the Greek city-state of Athens. Solon (in 594 BC), Cleisthenes (in 508–07 BC), and Ephialtes (in 462 BC) contributed to the development of Athenian democracy.

What are their contributions?

Born in 638BC, Solon was a wise statesman and law maker and responsible for a number of important political reforms. Cleisthenes divided the citizens of the city into ten ’tribes’ and each tribe could elect 50 men to sit on the new ‘Council of 500’. Pericles believed in democracy and under his rule, the appointments were made using lots, to ensure fairness. Pericles wanted to unite Greece, but unfortunately Sparta -which was a rival city-state- did not and the Peloponnesian War began.

How does the United States practice these democratic ideas?

The United States practice legislative arm of government and therefore the country has law makers. The United States also have different states and are 50 in number.America also follows thorough screening through the legislative arm for appointment. Again, America is also a country where unity is fought for before the establishment of the United States.

Therefore, the correct answers are as given above.

learn more about democracy: https://brainly.com/question/3710021

#SPJ1

Regulating the national military is an enumerated power of Congress.
true or false

Answers

Regulating the national military is an enumerated power of congress is a true statement.

What are enumerated powers?

The enumerated powers of the congress include laying and collecting taxes, paying debts and borrowing money, regulating commerce, establishing lower courts, and raising and supporting the military and navy.

Therefore, "Regulating the national military is an enumerated power of congress" is a true statement.

Learn more about Enumerated powers here:

https://brainly.com/question/22603155

#SPJ1

Using evidence explain George Washington's presidency and what the first President brought to the office of Presidency. WRITE 3-5 SENTENCES

Answers

George Washington's presidency brings strong changes in the government for the welfare of the citizens of the country.

Who was  George Washington?

George Washington was the first president of the United States of America from 1789 to 1797. He bought to the office of the presidency and signed the policy to protect the publications of authors by introducing the United States copyright law.

Beyond being the first president, George Washington's presidency was remarkable. His activities helped to develop a strong central government and a plan to address the nation's fiscal problems.

Learn more about  George Washington, here:

https://brainly.com/question/354943

#SPJ1

Read this quotation from President Kennedy about James Meredith’s stance.

This is as it should be, for our Nation is founded on the principle that observance of the law is the eternal safeguard of liberty and defiance of the law is the surest road to tyranny.

–Address on the situation at the
University of Mississippi,
John F. Kennedy

Based on this quote, Kennedy wants Southern states to

(A)set their own rules when it comes to segregation.
(B)follow national law when it comes to segregation.
(C)use the court system if they want to fight the law.
(D)continue to fight against desegregation of schools.

THE ANSWER IS B- follow national law when it comes to segregation.
(got it right on Edge. 2022)

Answers

The inference deduced from the quote is that Kennedy wants Southern states to B. Follow national law when it comes to segregation.

What is an inference?

An inference simply means the conclusion that can be deduced based on the information given in a literary work.

In this case, the inference deduced from the quote is that Kennedy wants Southern states to follow national law when it comes to segregation.

Learn more about inference on:

brainly.com/question/25280941

#SPJ1

What region did algebra originate from
during the Middle Ages?
A. Africa
B. Asia
C. Middle East
A
D. North America

Answers

Answer:

C. middle East Gooddddd

Match each thinker with the correct description.
Galileo
Bacon
Kepler
Newton

Discovered the three laws of planetary
motion.
Discovered the law of gravity and
developed the use of calculus.
Was persecuted for his support of the
heliocentric theory.
Pioneered the scientific method.

Answers

Kepler- Discovered the three laws of planetary motion

Newton- Discovered the law of gravity and developed the use of calculus

Galileo- Persecuted for his support of the heliocentric theory

Bacon- Pioneered the scientific method

What was true regarding the structure of the government under the Articles of the
Confederation?

Answers

The only federal institution was congress, and there was no president or national court system
Other Questions
Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map (3x-2)(3x-2)(3x-2)(2x+1) Read the excerpt from Brown v. Board of Education.Therefore, we hold that the plaintiffs and others similarly situated for whom the actions have been broughtare, by reason of the segregation complained of, deprived of the equal protection of the laws guaranteed bythe Fourteenth Amendment.Why does the Supreme Court conclude that the plaintiffs have been denied their rights?O The plaintiffs' schools have neglected their responsibilities.O The Fourteenth Amendment fails to reference education.Segregation is inherently unequal and unfair.The plaintiffs' children have endured racial stereotyping. Tengo que hacer una historia de un mundo distopico ayuda