Answer:Carbonic acid releases hydrogen ions, which combine with carbonate in seawater to form bicarbonate, a form of carbon that doesn't escape the ocean easily. As we burn fossil fuels and atmospheric carbon dioxide levels go up, the ocean absorbs more carbon dioxide to stay in balance.
Explanation:
Please Help me as soon as possible.
In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.
Answer:
The answer is; c
It is important to distinguish between codominance and incomplete dominance.
In incomplete dominance, the two alleles blend with each other in phenotype giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.
In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.
Explanation:
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answer:
u want step by step?
Explanation:
Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid
Answer:
Lipid is the most likely answer.
Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae
Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.
What are brown algae?Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.
Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.
Learn more about brown algae, here:
https://brainly.com/question/8717436
#SPJ2
What would be the temperature at a depth of 2500 km?
Answer:
4700 Degrees Celsius
Explanation:
In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion
Answer:
Facts that is right
Explanation:
In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion
The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.
These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion
Learn more about:
https://brainly.com/question/7135096
fill in the complementary bases according to the base-pair rule.
a | t | c | c | g | a | t | a | g | c | t | t | a | g
What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.
Answer:
Cells reproduce without limit. Cells reproduce with multiple cells
what is the percentage of thymine in wheat ?
Answer:
27.1% or 27% if rounded
Explanation:
Hope this helps ya!!
100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content
Answer:
B
Explanation:
YOOOOOOOOOOOOOOOOOOOOOO
ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:
glycogen is to glucose.
testosterone is to a steroid hormone.
a phospholipid is to a plasma membrane.
a nucleotide is to a nucleic acid.
Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?
Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?
Answer:
Wedging (for the first one)
Explanation:
What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?
question one : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other
question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other
question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age
SOMEONE I NEED HELP!! I'M STUCK 30 POINTS!!!!!
PART A
An advantage of mitosis is the result of genetically____________.
A. Different
B.Identical
PART B
cells being reproduced
A. slowly
B. Quickly
hurry due in five min plz help
Answer:
b
Explanation:
Answer:
d
Explanation:
I hope that helped!
Which name is best for my new bearded dragon?
1. Chili
2. Mushu (dragon from Mulan)
3. Blue (dino from Jurassic Park)
Answer:
Mushu
Explanation:
ASAPPPP!!!!
Write step by step instructions for making a protein
Which of the following is a pluton?
A. Pyroclast
O
B. D*ke (it's a type of rock not the slur)
O
C. Lahar
O
D. Lava flow
Answer:
The correct answer is d*ke
Explanation:
I tried the other answer and got it wrong, this was the right one on the test.
What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?
Explain how one celled organisms get oxygen in water.
Answer:
n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.
Explanation:
The law of___________explains how traits are inherited through generations.
Answer:
the law of inheritance
........ produces hormones and enzymes that aid digestion.
Liver
Gall bladder
Pancreas
Urethra
Answer:
urethra
Explanation:
Answer:
Pancreas and liver
Explanation:
Give two examples each of centripetal force
Answer:
Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.
Explanation:
If you were to leave a pan of water outside for several days what would happen
Write a scientific report on the what would happen, and how would they relate to the tree states of water: solid, liquid and gas.
At least 3 paragraphs.
Answer:
the water would evaporate and the water would be gone
Explanation:
hope this helps
A substance only composed of one kind of atom is a(n) *
Transcription: DNA to mRNA: 1. How many strands of mRNA are transcribed from the two "unzipped" strands of DNA? 2. If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C 3. If DNA Is described as a double helix, how should mRNA be described? 4. How are the accuracy of DNA and mRNA codes assured?
( help please)
Answer:
what are u taking this on
Using the diagram below, how many electrons will Be have if it is a neutral atom?
4) How does climate affect ecosystems and the life within them?
Answer:
Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.
A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.
I Am Not Sure What Your Asking?
Answer:
Black Fur & Black Eyes: 4/16
Black Fur & Red Eyes: 4/16
White Fur & Black Eyes: 4/16
White Fur & Red Eyes: 4/16
4 is 1/4 of 16
Explanation:
I hope this helps