What is the role of religion, or faith for Aunt Queen? What does Aunt Queen’s physical condition indicate about her faith and resiliency?

Answers

Answer 1

Answer:

Aunt Queen dies of a heart attack

Explanation:


Related Questions

Bright flowers were jewels gleaming in the sunlight.

Answers

Bright flowers were jewels gleaming in the sunlight

->Metaphor

Meaning: the flowers were so vibrant ot was like they were glistening under the light of the sun

Hope this helped you-have a good day bro cya)

Answer:

The meaning:

This is a metaphor to express that flowers were so beautiful and vibrant that they seemed to be jewels gleaming under the sun

Explanation:

Let's remember that metaphors are used to make comparison; a metaphor is a figure of speech in which a word or phrase is applied to an object to which it is not literally acceptable.

In this case, for example, flowers are not capable of gleaming, but the comparison with the shining jewels under the sun is made in order to express how beautiful, vibrant and shining they were.

Flowers were so vibrant it was like they were glistening under the light of the sun!

Pleaseee helpp! I dont understand!
No linkssss

Answers

The answer is

"I laughed to myself, wondering which one I would go by."

Explanation:

She is amused by the fact that she has so many nicknames and wonders which one people in the United States will refer to her as.

What do you do in the minutes bsfore you sleep?​

Answers

Answer:

It scientifically proven that one has to either be pretending to sleep or is fatigued so as to be able to sleep. I love thinking of all the things I've done and any mistake I could have avoided or something I could have improved

I tend to fall asleep without actually trying to. I’ll lay down and think about something and then just fall asleep, so I usually think in the minutes before I sleep.
(And, yes, I do fall asleep in my clothes more often than I fall asleep in my pajamas.)

PLEASE HELP ASAP 100 POINTS!!!- In Edgar Allan Poe's ''The Raven,'' the speaker is feeling down because of his lost love, Lenore. How does the symbol of the raven contribute to the theme of the poem?

Answers

Answer:

The titular raven represents the speaker's unending grief over the loss of Lenore. ... Therefore, the primary action of the poem—the raven interrupting the speaker's seclusion—symbolizes how the speaker's grief intrudes upon his every thought.

Explanation:

hope it help^^

Answer:

The raven symbolizes the grief the narrator feels, and how he is constantly reminded of her death. This is why the raven keeps repeating "Nevermore". As in he will never see lenore again.

PLEASEEEEE HELPPPP 50 POINTS!!

Answers

Answer:

#3

Explanation:

How many letters are in the abcs

Answers

Answer:

26

Explanation:

too smart!

Answer:

26

Explanation:

Which statement best summarizes the passage? Swift criticizes parents for not paying their rent. Swift criticizes landlords for exploiting families. Swift criticizes merchants for charging too much for food. Swift criticizes the government for not supporting families.

Answers

Answer:

Swift criticizes landlords for exploiting families

Answer:

Swift criticizes landlords for exploiting families.

Explanation:

B on edge 2022

Which type of multimedia presentation would this image best enhance? an informative presentation about the rules of chess a persuasive presentation about joining chess club an informative presentation about the history of chess a persuasive presentation about the world’s best chess player.

Answers

This image can best be described as a persuasive presentation about joining chess club.

The presentation in question:

Shows students playing chess as shown by the uniform Aims to present chess as a game many can play

The presentation can best to said to be a persuasive presentation directed at students because it is trying to appeal to students. These students would then be more interested in chess which would lead them to the chess club.

In conclusion, this is a persuasive presentation to join the chess club.

Find out more about persuasive presentation at https://brainly.com/question/1309497.

What makes a thing what it is? Is the way it is seen/perceived by others or is it something else?

“The blind men and the elephant”

Answers

Answer:

  What makes anything unique is the way others see/perceive it. These blind men, blind peasants, blind monks, or blind sages symbolize "those in the dark," or individuals who lack a complete vision or understanding of a "thing." Each guy in these tales feels a different aspect of the elephant, but just that one part, such as the tail or the trunk.

  The narrative of the Six Blind Men and the Elephant contradicts this theory since the lesson of the story is that all faiths are striving toward the same objective, even though they disagree with each other on many levels. Major Religions' Disagreements.

write a paragraph (120-150 words ) about your favourite music band

Answers

The question above requires a personal answer. For that reason, I can't answer it for you, but I'll show you how to answer it.

First, you must think and decide which is your favorite musical band. Also, you should identify the reasons that make you like so much of this musical band.

Then write your paragraph as follows:

Introduce your favorite musical band.Show the type of music this band plays.Show what makes you like this musical band so much.

More information on how to write a paragraph on the link:

https://brainly.com/question/24460908

Vocabulary workshop Level a unit 3 answers

Answers

Here You Go <3 Please mark me Brainliest :)

A person can usually tell how popular a new movie is by the length of the _____ in front of the box office. (queue)

Even before the new president took office, he _______ the men and women who were to serve in his cabinet. (designated)

Because the show is scheduled to end after midnight, the management will _________ admission to people over sixteen years old. (restrict)

For better or for worse, as you become older and more experienced, you will lose many of the comforting ______ of youth. (illusions)

Nothing ______ my boss more than an employee who is late for work and then offers a foolish excuse for not arriving on time. (infuriates)

Our hike was not very long, but the _______ was so rocky and hilly that we were exhausted by the time we reached our goal. (terrain)

As he greatly enjoys woodworking and also makes a living from it, his hobby and his ________ are one and the same. (vocation)

I came to regard my grandmother as a(n) ________ whose wisdom helped solve many family problems. (sage)

The pollution problem, far from being limited to the United States, is truly ________ in scope. (global)

As she was sworn in, she made a(n) __________ that she would never use the powers of her office for selfish or unworthy purposes. (vow)

The police now believe that the mugger ________ the victim as she entered the elevator of her apartment house. (waylaid)

No decent or kind person will ______ over someone else's failures or misfortunes. (gloat)

 

The desire to be the world's top tennis player _________ the young woman to spend hours every day improving her game. (motivates)

Is it possible to be a _______ in a world where so many people are using force to take unfair advantage of others? (pacifist)

The deadly _________ of shells from our guns pinned down the enemy troops on the narrow beach where they had landed. (barrage)

The animals in the drought area traveled for many miles to reach a body of water where they could ________ their thirst. (slake)

The rich _______ of plant and animal life in a tropical rain forest never ceases to amaze me. (terrain)

How sad it is to see such beautiful flowers _______ and die! (wither)

I don't understand what he is aiming at or why he behaves as he does; in fact, his whole personality is a(n) _______ to me. (enigma)

Like a typical _______, he believes that any customs different from his own are "wrong" and "uncivilized." (bigot)

Hope this helps it took forever sorry for being late!!!

Write a 500- to 1,000-word personal narrative with a simple plot. Include enough exposition that the reader knows what's going on, some rising action to let the reader know what led up to the main event, a climax, and a short conclusion that reflects on the experience in some way.

Answers

Answer:

Jason had first seen Mia at the sandlot playground close to their homes. They were both 10-year-olds who still perceived the opposite sex as the enemy. She grouped up with a bunch of squeaky girls who made faces and laughed at the boys while they played ball on the street. The girls had taken over the swings as their domain, reigning undefeated, proudly. At one point, the soccerball ran toward them. Jason was the one to be sacrificed since he was closer to where they were. He ran to the ball, picked it up with the tips of his fingers and glanced at the girls. They were staring at him as if he were some nasty intruder who deserved the guillotine.

They all attended the same school; maybe a couple of boys and girls had to move to a different neighborhood over the years. But, essentially, they all remained. Of course, with time, they dynamics changed. Around the age of 13, boys and girls were no longer adversaries, but a strange and exotic foreign land to be discovered. Laughter transformed into giggles. The same boys who once shouted, “You can’t play with us, you’re a girl!” were now struggling to invite those long-haired nymphs out - an ice cream, or the movies, if their mothers were more lenient and foolish enough.

Mia was the one left behind, though. She didn’t grow as tall, as curvy, as mischievous as the others. So, they left her behind. Mia was no longer invited to come over. Why have her attend slumber parties when she couldn’t talk about boys? She had never kissed anyone on the lips, the poor thing. Had never had a boy trying to explode her phone with texts filled with jokes and compliments. She would stay home, watching her shows, reading her books, dreaming of fictional boys, wondering why the real-life, flesh-and-bone ones didn’t fancy her. The quirky girls on movies always got the guy in the end. Her end didn’t seem to be in sight yet.

Jason paid attention, though he pretended not to. He couldn’t let the guys know he liked Mia. She wasn’t attractive enough for him to be allowed to say something. So, he kept the childish infatuation he believed to be love deep within him. When the school trip came, each one of the boys sat next to their favorite girl on the bus, grabbing every chance to touch their hands, desperately trying to get them sufficiently flattered to grant them a kiss later. Jason had to sit beside Mia. Or at least that is how the others saw it. As if poor Jason had had no choice, since no other seats were available. Someone patted him on the back, wished him good luck. Jason offered a faint smile back while bursting with joy on the inside. Still, he was too popular, too handsome, too athletic to let his feelings show. Sitting down next to Mia was all he did. He saw his chance come and go, wishing she were just a little more like the other girls, just a little more ordinary, so that he could like her in public.

Two years later, Mia showed up holding Steve’s hand. Jason’s smile was wiped out off his face for a split second. It came back though, as faint as it had been on that bus. Mia hadn’t changed much. She was taller, perhaps, but still annoyingly different. And Steve… Steve was the prince of the boys, the kind of guy who is good at everything without threatening the others’ confidence. Steve never tried to be the king, never wished to rule it all by being the best, the most athletic, the smartest. He had that natural wisdom that prevented ambition from becoming a barrier instead of a weapon. Jason always thought Steve would end up with one of the cooler girls, but not Mia. He had been hoping she would wise up and transform into a girl he, Jason, would be allowed to publicly love.

Jason approached Steve just as Mia disappeared somewhere for a couple of minutes.

“So”, he was able to say. “You and Mia?”

“Yeah!” exclaimed Steve, beaming.

“How did that happen?” he softly gasped at the end.

“She’s a great girl, you know? Cute, sweet, smart… I’m lucky.” Jason explained humbly, as if Mia’s noticing him had been a divine deed. She returned from the restroom, and they resumed their lives.

As they walked into the classroom, Jason felt an envious thorn sting his heart. He saw Mia smile at Steve, a smile Jason had never thought she had to offer. He also saw some of the boys looking at Steve as if he were an outcast, some type of Robin Hood opposing their kingdom’s status quo. And, much to Jason’s astonishment and jealousy, he realized Steve couldn’t care less. He carried on being himself, unafraid, unapologetic. He never lost his rank, never quit being a prince. He smiled, said his hi’s, played ball, got good grades, kept living his life as he had always done. The other boys couldn’t help but accept it, accept him. If they could not destroy his confidence, they might as well learn to admire it. Jason, on the other hand, was condemned to the dungeons of his cowardice, feeling that strange pain one feels when they realize someone had the guts to achieve what they believed to be impossible.

Explanation:

what were the 4 visits in the past that Scrooge and the Ghost make

Answers

Answer:

In Charles Dickens's A Christmas Carol, Ebenezer Scrooge is visited by four ghosts on Christmas Eve: Jacob Marley, and the spirits of Christmas Past, Present and Future.

Explanation:

why is it important to give back

Answers

Answer:

anything you give it will come back to you or when you do the right thing if you don't give to the person in need bad things will happen to you

The writer should _____ to the reader that a flashback is occurring.
withhold
signal
suppress
mask

Answers

Explanation:

signal makes the most sense in this case

Answer:

signal

Explanation:

Signal is the only answer that makes sense here in this context. Signal in the context of this sentence means that they are "prompting" or "alerting" the reader that a flashback is occurring.

define photographyㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤㅤ​

Answers

The art of taking beautiful pictures of sceneries, people, animals etc. for visual pleasure or to give ideas is known as photography.

 

I NEED ANSWER NOW PLEASE ITS DUE IN 3 MINS

Answers

Answer:

Explanation:

The answer C or 3

Jerry learns an important lesson about proving himself in 'Through the Tunnel.

“Desperate to fit in and relieve his lonely feeling, Jerry slips away from his mother and finds the company of native boys near an arrangement of rocks away from the main beach.”

PUT THIS IN YOUR OWN WORDSSS PLZZZ!

I’ll give brainlest and pointsss to the person who answers my question!

Answers

Answer:

Jerry portrays his feelings about him being alone and sad. He feels upset and decides to do something about this. He moves away from his beloved mother and gathers his courage to hangout with a couple of boys near some rocks away from the main beach. At the start he shows himself as desperate and alone, but after a while he's being accompanied by some native boys he has started a conversation with.

Hope that helps..? x

Read the passage, then use the drop-down menus to
answer the questions.
What is the author's purpose in this passage?
How does the author achieve his purpose?

Answers

Answer:

To convey the importance of lqbal's life

Answer:

The correct answer is B and A.:)

Explanation:

Hope this helps! :)

In "Encounters With Julie Jones," how do Jamie's feelings change over the
course of the story? Write a paragraph to explain. Use details from the story
to support your response.

Answers

Answer: Jamie feeling's were over in course.

Explanation:

Describe your favorite piece of clothing How do you feel when you wear it? Do you have a favorite memory connected to this piece of dothing, and if so, what is it?​

Answers

I believe my favorite piece of clothing is shorts. I feel very comfortable wearing them due to the fact that I play lots of sports. Yes, I do have a memory connected to this piece of clothing and it was the time that I won a soccer tournament in my high school! Good times.

Hope you find this helpful!
Brainliest and a like is much appreciated!

6. I took them ___ hours to clean the. court.
7. ___people are jobless because of the pandemic.
8. Do not live yet and wait for ___ name to be called.
9. We don't have ___ choice but to accept what happened.
10. We should take good care of ___ parents even if they are already old. ​

Answers

Answer:

1. few

2. some

3. any

4. one

5. every

6. many

7. several

8. your

9. much

10. our

Explanation:

hope this helps! should be correct.

they wanted to build a holiday resort here but the owners of those beach front cottage.( refused- denied-rejected) to play ball.​

Answers

Answer:

They wanted to build a holiday resort here, but the owners of those beach front cottages refused to play ball.​

Explanation:

The correct word is "refused." "They wanted to build a holiday resort here but the owners of those beach front cottage refused to play ball.

The owners of those beachfront cottages refused to play ball. This means that they declined or said no to the proposition of building a holiday resort in that location. "Refused" implies a deliberate rejection or denial of the request or proposal.

In this context, the owners of the cottages did not agree to the idea of constructing a holiday resort there, possibly due to their own reasons such as personal preferences, concerns about the impact on the area, or other considerations. The word "refused" accurately conveys the sense of the owners declining the offer or not giving their consent for the resort construction.

To know more about word , click here.

https://brainly.com/question/22631753

#SPJ2

------------The given question is incomplete, the complete question is:

"CHOOSE THE CORRECT WORD:
They wanted to build a holiday resort here but the owners of those beach front cottage.( refused- denied-rejected) to play ball.​"----------------

What did the Duchess bothered her husband

Answers

Answer:

I don't know why but they need to resolve that problem

Explanation:

Mabey she ate his food

BRAINLIEST PLUS 100 ANSWER

Answers

Answer:

AGAIN LOLLLLLLLLLL OFC ITA FREE

Answer:

:))

Explanation:

I need help with my work please help me with:

this: ( Valentina says that the only type of animals that use a river ecosystem are fish. Hector disagrees. Who is right and why? )

Answers

Answer:

Hector is right

Explanation:

The river ecosystem is one of the most dynamic ecosystems on the planet. this is mostly due to the unique nature of the rivers in their life as they change and transform along their courses from the sources to their mouths. River ecosystems change their characteristics in terms of composition and characteristics as they flow over different terrains, climates and regions. they vary according to their chemical composition, their exposure to light, their temperatures, their discharge, and the load that they carry. All these factors or a combination of these influence the type of species that will be found in a river ecosystem. However, the most common types include:

Bacteria, found in larger numbers in flowing than stagnated water. Bacteria exist in many forms such as free-living forms decomposing organic material, bio-film found on the surfaces of rocks and vegetation, suspended within the water column in the guts of parasites and other organisms and many more forms.

Primary producers mostly vegetation, phytoplankton and periphyton.

Other more complex organisms such as insects and other invertebrates can be found within the river ecosystem such as snails clams and crayfish. Fish and other vertebrates including amphibians, mammals and birds. In many rivers that connect the inland waters to the oceans, you might find fish and other species adopted to living in both salty and fresh water conditions during different stages of their development such as the salmon.

Answer:

plz mark me as brilliant please please please please please please please please

THE COST OF 10 PENCLILS IS 8 WHAT IS THE COST OF 20 PENCIL

Answers

The cost of 20 pencil is 16

Answer:

16, the cost of 20 pencils is 16

Explanation:

10=8$

20= 10x2

16=8x2

Identify two examples of situational irony from the text to story of an hour.​

Answers

Answer:

Perhaps, the most salient example of situational irony is in the turn of events in the hour that suggest that Bently Mallard is dead and Mrs. Louise Mallard has fully come alive. For, incongruously the narrative abruptly changes and it is Bently Mallard who yet lives while Mrs.

Explanation:

Which of the following options are written using correct grammatical form? Select all that apply.

A.I am absolutely thrilled with my new shoes and I am going to wear them everywhere.
B.I am absolutely thrilled with my new shoes. I am going to wear them everywhere.
C.I am absolutely thrilled with my new shoes, and I am going to wear them everywhere.
D.I am absolutely thrilled with my new shoes I am going to wear them everywhere.

Answers

Answer:

B & C

Explanation:

Answer:

B.I am absolutely thrilled with my new shoes. I am going to wear them everywhere.

C.I am absolutely thrilled with my new shoes, and I am going to wear them everywhere.

Explanation:

Which of the following is stated explicitly in the poem?

Answers

The author's purpose simply means the reasons an author has for writing a selection or a poem.

Your information is incomplete. Therefore, an overview will be given. Authors may have more than one purpose for writing. The purpose of a poem can be stated explicitly or readers may have to infer the intent.

The mood of the poem is the atmosphere of the poem, and the tone is the poet's attitude towards the topic. They can identify by looking at the setting, characters, details, and word choices. These are important in knowing the purpose or theme of the poem.

Learn more about themes on:

https://brainly.com/question/11600913

Other Questions
Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology. (PHOTOGRAPHY) Rebecca is planning to take photographs on her trip to see the California redwoods. The California redwoods are very, very large trees. She wants to make sure that everyone who sees her photographs understand how giant the trees are. What might she do to help her audience see the scale of the redwoods?Group of answer choicesAsk her parents to park their car near the base of the tree so that it will be in the photograph, too.Take a closeup of the trees bark so viewers get a sense of the level of detail the tree has.Take a photo with more than one redwood tree in the frame.Position herself so that she captures the sky and clouds behind the redwood tree.PLEASE HELP ASAP if the telephone was invented in 1876 how old was it in 1991 how long had it been around 5. My classmate will ask questions to our teacher nor plz help me..In my town, the Chinese Cultural Center offers language lessons on Saturday mornings from 9 to noon. My parents were born in China, but I wasnt. My parents were educated in a Chinese language called Mandarin, but I go to a school where we all speak English. As a result, my family worries that even if we speak Chinese together at home (and we usually do), I might not truly understand our culture or learn how to read or write enough Chinese characters to be literate and fluent.The narrator's parentsI. were born in ChinaII. spoke Mandarin at schoolIII. never learned EnglishAI onlyBII onlyCI and II onlyDI, II, and III In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction Divide 63.5 0.25 round the quotient to the nearest ten-thousandth PLZZZZZZZZZ HELPABC Order and Definitions1.React2.Shift3.Specify4.Thesis5.audience6.format7.purpose8.introduction9.focus10.conclusion11.influence12.fleeting13.mentorship14.normal15.participate16.positive17.circumstantial18.emotional19.contagion20.fleetingABC Order and DefinitionsWrite down 45 affixes containing the sufffix:-or-ment-ness