What is the definition of by-product?

Answers

Answer 1

Answer:

something produced in a usually industrial or biological process in addition to the principal product Sulfured molasses is a by-product of sugar refining

Explanation:

hope it helps you and give me a brainliest


Related Questions

A narrator may be unreliable because he or she is...

Answers

a narrator may be unreliable because he or she is biased and states their opinion instead of fact.
Biased and they state opinion rather than facts

How do the phrases “star-crosse’d lovers” and “death-cross’d love” introduce the themes of love and fate in the prologue to Romeo and Juliet? Support your response with evidence from the prologue.

Answers

The  lovers' stars crossed meant that the tragedy was inevitable because, as they saw it, the stars controlled human destiny.

Death-cross’d love primarily 'marked out for death', but also with a sense that, from the start, their love is stained and diminished by their future death.

Who were Romeo and Juliet?

Romeo and Juliet is the most famous love story in the English literary tradition. Love is naturally the play's dominant and most important theme. The play focuses on romantic love, specifically the intense passion that springs up at first sight between Romeo and Juliet.

Romeo and Juliet were lovers from Verona from Shakespeare's play Romeo and Juliet. They belonged to families that hated each other, which eventually led to their demise.

Learn more about Romeo and Juliet here,

https://brainly.com/question/1556509

#SPJ1

A writer would most likely use these verbs in an essay that includes

foretold, overtook, will inflict, will petition

Answers

Answer:

what is the question?

Can you mske it clear?

Why would an immigrant decide to naturalize?

Answers

Answer:

1. Reduced risk of removal (deportation)

2. Easier travel and reentry into the United States

3. No loss of status after long trips outside the United States

Explanation:

how is third person omniscient narrator used in a story?

Answers

Answer:

Omniscient means "all-knowing," and likewise an omniscient narrator knows every character's thoughts, feelings, and motivations even if that character doesn't reveal any of those things to the other characters.

Explanation:

What would be an appropriate thesis statement for an essay about Hercules?

Hercules is an important character in Greek mythology because he shows many traits valued by Greek culture.
Many Greek myths are still read today, and studying them will help you understand history.
Hercules, Zeus, and Pandora are all important mythological figures because their stories are still read today.

Answers

Answer:

A

Explanation:

Answer:A-Hercules is an important character in Greek mythology because he shows many traits valued by Greek culture.

Explanation:egde 2022

(100pts.) Creating a Mood: Writing a Paragraph
Write a paragraph describing a SETTING that creates a MOOD. Word choice, or diction, will be important. Tell how the setting looks, smells, sounds, perhaps even tastes and feels (note: this is called "imagery"). Use many adjective and adverbs to help establish the mood you want. (Minimum length: 12 sentences)

Answers

It was a dark, rainy night. I couldn't see, but I could feel the mud seeping in through my shoes. The clouds were so thick, they even blocked out the moonlight. I couldn't tell if I was going deeper into the forest or closer to my house. I fell down, tripping on what I hope was a tree branch, right into the wet, sticky mud. It got in my mouth, though all I was able to taste was the same texture as wet carpet. I tried to get up, but it felt as if someone or something was trying to shove me under. I was having trouble breathing, and I could feel the mud going down my throat. I gagged, almost throwing up. But I had to push through. When I finally got out of the swamp, my clothes were drenched. I started running again, the mud and dirt being washed off by the cold, hard rain. I couldn't see where I was going, not until the edge. Then I saw a giant rock seeming to get closer and closer to me as I fell off.

What is the difference between a magazine and a newspaper?
A. Newspapers focus on current events, while magazines contain articles that aren't time-related.
B. Newspapers can be bought in local stores and shops, but magazines have to be mailed to homes.
C. Newspapers focus only on a town or city, while magazines have a wider audience appeal.
D. Newspapers are much cheaper to buy while magazines are much more expensive to purchase.

Answers

Answer:

.....its D as far as I could say

The answer you’re looking for is A. The content in a newspaper aims to disclose current news and ongoing issues globally with short articles. On the other hand, magazines have specific content, including, but not limited to, fashion, medicine, sports, and long articles. Hope that help!

Assessment started: undefined.
item 1
why does sherlock holmes knock on mr. jabez wilson's door at the start of part 2 of "the red-headed league"?

he wants to speak with mr. wilson himself.

he wants to ask for a tour of mr. wilson's home.

he wants to see the knees of his assistant's trousers.

he wants to see the face of mr. wilson's assistant

Answers

Sherlock holmes knocked on Mr. Jabez Wilson's door because he wanted to see the knees of his assistant's trousers. Therefore, Option C is the correct statement.

Why does Mr. Holmes knock on Mr. Wilson's door?

Holmes pounded at the sidewalk outdoor Wilson's save to decide whether or not the floor became a hole underneath, and he knocked at the door for instructions in order that he ought to see whether or not the knees of Spaulding's pants had been worn away.

Therefore, Sherlock holmes knocked on Mr. Jabez Wilson's door because he wanted to see the knees of his assistant's trousers. Therefore, Option C is the correct statement.

Learn more about Sherlock holmes "the red-headed league":

https://brainly.com/question/1277710

#SPJ1

Answer: A

Explanation:

15 points please dont guessssssssss

Answers

Answer:

The character

Explanation:

He adapt to the enviroment.

What is the author’s viewpoint about the experience in the passage? the author believes the experience dehumanizes people both on and off the train. The author believes much-needed rations are being shared with hungry prisoners. The author believes this is a great kindness on behalf of the workmen and passersby. The author believes the experience shows neither group of people understands the other.

Answers

The author's viewpoint about the experience in the passage is the author believes the experience dehumanizes people both on and off the train.

What does dehumanize people means?

Dehumanize people are those which are inhuman, or does not have qualities and dignity of humans. It is a psychological process, in which people see other people less than them.

The story is "A night" by Elie Wiesel. Thew story shares a memoir of her experiences about other humans.

Thus, the correct option is A, the author believes the experience dehumanizes people both on and off the train.

Learn more about dehumanize people

https://brainly.com/question/23282368

#SPJ1

Answer:     The answer is... A

Explanation:

Just Got it right on Edge

Ah, love, let us be true
to one another! for the world, which seems
to lie before us like a land of dreams,
so various, so beautiful, so new,
hath really neither joy, nor love, nor light,
nor certitude, nor peace, nor help for pain;
and we are here as on a darkling plain
swept with confused alarms of struggle and flight,
where ignorant armies clash by night.
the connotation of the word "struggle" gives the poem a
tone.

Answers

The word struggle gives the poem a tone of despair. Related contextual clues is "confused alarms of struggle and flight, where ignorant armies clash by night."

What is a tone?

A tone is the attitude or mood of the author as communicated by the choice of words that he or she uses in a text.

Thus, it is right to state that The word struggle gives the poem a tone of despair.

Learn more about tone at;
https://brainly.com/question/15447799
#SPJ1

ASAP PLS!! (midsummer's night dream)
What kind of play does Bottom think the play-within-a-play is? O A Comedy. O A Tragedy. O A Ballad. A Greek Myth.​

Answers

Answer:

A Tragedy.

Explanation:

Bottom is given the part of 'a lover that kills himself, most gallant, for love.' And he's thrilled to be part of it. Thus, he believed it was a tragedy.

Enumerate both the major and the minor characters in the selection. Write the name of the character at the center. On the right side, write his/her good qualities while on the left side, write his/her bad qualities. Make sure to explain briefly why you consider such attributes good or bad.​

Answers

A major character is the main character in a novel while the minor character is the minor character is other characters that are being mentioned in the story.

Who is the major and minor character?

The main character: The main character in the story of Alibaba and the forty thieves is Alibaba.

Alibaba good qualities: He is a very clever man.

Alibaba bad qualities: He is a cunny man who was able to bury cassian without anyone knowing.

The minor character: The minor character in the Alibaba and the forty thieves is Cassin.

Cassin good qualities: He is a wealthy man

Cassin bad qualities: He is a greedy man.

Learn more about characters here:

https://brainly.com/question/1393329

#SPJ1

Read the following quote. What do you believe it means? How does it relate to the play in general OR to specific characters in Julius Caesar? “Power doesn’t corrupt people, people corrupt power”

Answers

This quote means that when power is there only people can corrupt it for there own personal desires and power cannot make someone corrupt because it is not a physical thing. His point is to prove that people can only make things corrupt and you cannot blame the system.

Which sentence best reflects the idea that Sandra Cisneros wanted to be a voice of the Mexican American experience?

(6) The first impulse when I realized I was wearing my pajamas was, "I don't belong in this club." My first reaction was to go home and lock myself in my bedroom for the weekend and consider coming home and quitting the program.
(7) But Mexican women are very strong women, and the opposite side of sadness is rage. It took me only a weekend to get to the opposite side of my sadness. Why had I never seen literature written about my community with love and honesty? Why have I never seen my house in newspapers or magazines or in ads or cinema? It's never been portrayed. My community has never been portrayed with honesty. So I got angry. This is a wonderful thing you can do with rage if you know how to transform it: You can either light up Las Vegas, or you can create a Chernobyl. I had been wanting to create Chernobyl all weekend. Then I realized I'm going to stay here and write that book I haven't seen. I wrote The House on Mango Street on the side for no credit, while I was in poetry workshop, to keep my spirit alive.

Answers

The sentence, "Then I realized I'm going to stay here and write that book I haven't seen" best reflects the idea that Sandra Cisneros wanted to be a voice of the Mexican American experience.

Who is Sandra Cisneros?

Sandra Cisneros is a poet, short story writer, novelist, essayist, performer, and artist. Her numerous awards include NEA fellowships in both poetry and fiction.

In addition to her writing, Cisneros has fostered the careers of many aspiring and emerging writers through two nonprofits she founded: the Macondo Foundation and the Alfredo Cisneros del Moral Foundation.

Learn more about Sandra Cisneros here,

https://brainly.com/question/17220076

#SPJ1

Answer:

"Then I realized I'm going to stay here and write that book I haven't seen."

Explanation:

Just took the test and got it right

Happy to help !!

One theme from "The Yellow Wallpaper" is that women played a lesser role in
marriage during the 19th century. Which line from the story best supports this
theme?

A. And I know John would think it absurd. But I MUST say what I feel
and think in some way it is such a relief!
-

B. We shall sleep downstairs to-night, and take the boat home tomorrow. I quite enjoy the room, now it is bare again.

C. I'm feeling ever so much better! I don't sleep much at night, for it is
interesting to watch developments...

D. He said I was his darling and his comfort and all he had, and that I
must take care of myself for his sake, and keep well.

Answers

Answer:

A. And I know John would think it absurd. But I MUST say what I feel

and think in some way it is such a relief!

Explanation:

How does the symbol of the birdcage reinforce a feminist theme? it shows that women were not allowed out of the house. it illustrates the ultimate control that women had over things that mattered to them. it suggests that women could break out of the roles that they were supposed to fill. it demonstrates the confinement that women face in the roles clearly defined for them.

Answers

The symbol of the birdcage reinforce a feminist theme as D. It demonstrates the confinement that women face in the roles clearly defined for them.

What is a theme?

It should be noted that a theme simply means the underlying message that can be conveyed in a literary work.

Here, the symbol of the birdcage reinforce a feminist theme as it demonstrates the confinement that women face in the roles clearly defined for them

Learn more about theme on:

brainly.com/question/11600913

#SPJ1

Answer:

The lack of dialogue emphasizes women’s lack of voice and power. The specific stage directions highlight that the women are underestimated by the men. The lack of dialogue shows the lack of communication between men and women at the time. The stage directions suggest that the silenced women speak through subtle but important actions.

Explanation:

i just did it on edg

Since this will be a double marriage, what does Titus propose (488-490)?

Answers

Answer: Since this will be a double marriage, what does Titus propose (488-490)? Titus proposes his love and loyalty to Saturninus.

Explanation:

Answer: Titus proposes his love and loyalty to Saturninus.

Explanation: brainlest?

Which of these will help you the most in achieving coherence in your interpretive essay?

A.
developing an introduction that is clear and engaging to the reader

B.
using quotes as evidence within a paragraph

C.
writing a conclusion that reinforces the central thesis

D.
building the ideas in a paragraph around one central thought

Answers

The sentence help you the most in achieving coherence in your interpretive essay is building the ideas in a paragraph around one central thought.

What is coherence?

Coherence refer to a way or situation of gathering words to make it fit well and add coordination and meaning.

Therefore, The sentence help you the most in achieving coherence in your interpretive essay is building the ideas in a paragraph around one central thought.

Learn more about coherence below.

https://brainly.com/question/9105952

#SPJ1

Which of the following was a reason why a cowboy may not have carried a gun

Answers

Guns were even more expensive in the late 1800s than they are now, and not all cowboys could afford to buy one.

Answer:

He wouldn't want to scare the cattle with an accidental discharge

Explanation:

Read the excerpt from Roosevelt’s "Four Freedoms" speech. A part of the sacrifice means the payment of more money in taxes. In my Budget Message I shall recommend that a greater portion of this great defense program be paid for from taxation than we are paying today. No person should try, or be allowed, to get rich out of this program; and the principle of tax payments in accordance with ability to pay should be constantly before our eyes to guide our legislation. The underlined portion of this excerpt serves as the for this section of Roosevelt’s argument.

Answers

The underlined portion of Roosevelt's speech serves as the claim for this section of Roosevelt's argument, as is further explained below.

What is claim?

We can define claim as a statement containing a speaker's opinion about a certain topic. The claim:

Appears at the beginning of the speech.Is supported by arguments and pieces of evidence.

In Roosevelt's "Four Freedoms" speech, the claim supports the argument that the defense program should not be used to make people rich. Roosevelt also says that the program shall be paid for using taxes that people already pay, that is, new taxes should not be created for the program.

Learn more about claim here:

https://brainly.com/question/4193488

#SPJ1

Answer:

b

Explanation:

Awnser asap!!!! if correct you get brainliest (50 points)

explain the history of science fiction and how it emerged as a genre.

Answers

Answer:

science fiction, abbreviation SF or sci-fi, a form of fiction that deals principally with the impact of actual or imagined science upon society or individuals. The term science fiction was popularized, if not invented, in the 1920s by one of the genre’s principal advocates, the American publisher Hugo Gernsback.

Explanation:

Hope this helps but if I am wrong my bad but hope some of this helps you with what you are looking for :)

Use the topic “mammals” to create a statement that should NOT be included in your notes. Explain why this statement is inappropriate to include in your notes.

Answers

The statement using the topic Mammals is indicated below:
"Even the best of us are Mammals". This statement is inappropriate.

Why is the statement inappropriate?

The statement is not right to be included in ones notes because it is derogatory or insolent although it is factually correct.

It is important to sieve ones notes, especially one that will be presented to a live audience because the sensitivities of the people in attendance must be respected.

Learn more about inappropriate statements at:

https://brainly.com/question/1018974

#SPJ1

what is group of sheeps called

Answers

Answer:

Flock

Explanation:

Answer:

mira ya te encontré

Explanation:

ʘ‿ʘ。◕‿◕。

29)

Select the correct answer.
Which details should the writer add before sentence 6 to best help readers imagine how the author physically feels when she opens the attic door?

A) As I stepped into the room, a cold breeze brought me chills and a cloud of dust burst into the air as I coughed and gasped for fresh air; I was
convinced no one had been in this room for ages and I was the first explorer.

B) As I walked into the room, I realized most people would be scared of going up to the attic alone, but I proved to myself how brave I was to
venture up here all by myself-I felt a sense of accomplishment I never felt before!

C) When I peered into the dark room, I noticed that there were shelves upon shelves full of old boxes sealed with tape that has not been tampered
with; it was evident that no one had opened any of the boxes for a very long time.

D) When I tiptoed into the room, I imagined all the interesting things I would find when I uncovered what was in the old boxes that filled every
corner and wall of the attic room-there was so much to look through and so little time!

Answers

The details that the writer add before sentence 6 to best help readers imagine how the author physically feels when she opens the attic door is As I walked into the room, I realized most people would be scared of going up to the attic alone, but I proved to myself how brave I was to

venture up here all by myself-I felt a sense of accomplishment I never felt before!.

What is sentence?

What is sentence refer to group of words that have subject and predicate which has meaning and comprises of noun and verb.

Therefore, The details that the writer add before sentence 6 to best help readers imagine how the author physically feels when she opens the attic door is As I walked into the room, I realized most people would be scared of going up to the attic alone, but I proved to myself how brave I was to

venture up here all by myself-I felt a sense of accomplishment I never felt before!.

Learn more about sentence below.

https://brainly.com/question/25841954

#SPJ1

The details that the writer should add before sentence 6 is to best help readers imagine how the author physically feels when she opens the attic door option A. This is because it is kinetic..

As I stepped into the room, a cold breeze brought me chills and a cloud of dust burst into the air as I coughed and gasped for fresh air; I was convinced no one had been in this room for ages and I was the first explorer.

What is a kinetic feelings?

Kinetic feelings is derived from two words: emotion – mental energy, set in motion through feeling; and kinetics – dynamic processes involving movement. It is an energetic process or system used to move blockages in the physical body caused by unreleased emotion.

Therefore, the correct answer is option A. As I stepped into the room, a cold breeze brought me chills and a cloud of dust burst into the air as I coughed and gasped for fresh air; I was convinced no one had been in this room for ages and I was the first explorer.

learn more about kinetic feelings: https://brainly.com/question/14179911

#SPJ1

two reasons why parents get frustrated or worried when their teenagers are constantly on their cell phones​

Answers

Answer:

They could be afraid of what they may be doing. They also could be worried on how they are so addicted to the phones. (Which is not so healthy)

Explanation:

Let's say a teenage girl is texting and starts to laugh. The mother is obviously going to wonder on what she is laughing about.

A mother could be worried on how long she has been on the phone and the daily times she checks it.

I really hope this is helpful :]

Select the correct answer.
Which sentence contains a restrictive clause?
A.
They decided to meet where the band was performing.
B.
The children, sweaty and miserable, piled into the bus.
C.
They put the baby, who was fast asleep, in his crib.
D.
The girls, overwhelmed by the sale, bought many shoes.
E.
The child, who was now wailing, ran toward his mother.

Answers

The sentence that contains a restrictive clause is A. They decided to meet where the band was performing.

What is a restrictive clause?

It should be noted that a restrictive clause simply means a noun that gives necessary information about the noun in the sentence.

In this case, the sentence that contains a restrictive clause is that they decided to meet where the band was performing.

Learn more about restrictive clause on:

brainly.com/question/1602063

#SPJ1

Answer:

A

Explanation:

just took the test

State And define the types of essay writing and give two examples each

Answers

Answer:

Explanation:

Argumentative

Forming an opinion via research Building an evidence-based argument

An argumentative essay expresses an extended argument for a particular thesis statement. The author takes a clearly defined stance on their subject and builds up an evidence-based case for it. Argumentative essays are by far the most common type of essay to write at university.

Expository

Knowledge of a topic Communicating information clearly

You are likely familiar with expository writing already, even if the name sounds unfamiliar. Common examples include newspaper articles, how-to manuals, and assembly instructions. Expository writing is also the most frequent type of academic writing.

Narrative

Creative language use Presenting a compelling narrative

The introduction of a narrative essay is the paragraph that begins your story. In the introduction, you describe the setting, introduce the characters, and prepare your audience for the action to come. Of course, the introduction should have a hook and a thesis.

How did president kennedy appeal to the american people's emotions
to get them behind the plan to go to the moon?

Answers

Answer:

Kennedy appeals to the audience's curiosity with his claim that the exploration of space is an adventure. Kennedy appeals to the audience's competitive spirit with his claim that the exploration of space will go on with or without the United States.

Other Questions
Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map