What features of proteins does two-dimensional gel electrophoresis exploit in order to separate proteins? size and charge pH and polarity charge and shape shape and size charge and pH

Answers

Answer 1

The features of proteins that two-dimensional gel electrophoresis exploits in order to separate proteins are charge and size.

Two-dimensional gel electrophoresis (2DGE) is a powerful technique used to separate complex mixtures of proteins. In the first dimension, proteins are separated based on their isoelectric point (pI), which is their pH at which they have no net charge. The proteins are then separated in the second dimension based on their size by electrophoresis through a gel matrix. By exploiting the differences in protein charge and size, 2DGE can separate a large number of proteins in a single gel, allowing for the identification of individual proteins in a complex mixture. This technique is widely used in proteomics research to study changes in protein expression levels under different conditions, and to identify biomarkers for diseases.

Learn more about gel electrophoresis here:

https://brainly.com/question/2960312

#SPJ11

Answer 2

The features of proteins that two-dimensional gel electrophoresis exploits in order to separate proteins are charge and size.

Two-dimensional gel electrophoresis (2DGE) is a powerful technique used to separate complex mixtures of proteins. In the first dimension, proteins are separated based on their isoelectric point (pI), which is their pH at which they have no net charge. The proteins are then separated in the second dimension based on their size by electrophoresis through a gel matrix. By exploiting the differences in protein charge and size, 2DGE can separate a large number of proteins in a single gel, allowing for the identification of individual proteins in a complex mixture. This technique is widely used in proteomics research to study changes in protein expression levels under different conditions, and to identify biomarkers for diseases.

Learn more about gel electrophoresis here:

https://brainly.com/question/2960312

#SPJ11


Related Questions

16. We reasonably expect there to be no white fish because of the selection, but the frequency ofrmay not be zero, even if there are no white fish. Why not? 17. It is likely that there were sometimes no white fish for a period, but then a few returned a few generations later. What might cause this? 18. In population genetics, fixation is the change in a gene pool from a situation where there exists at least two variants of a particular gene (allele) in a given population to a situation where only one of the alleles remains. The gene has become "fixed." Describe how this might happen in the koi population. 19. Summarize the effect of natural selection on the evolution of populations. Use the term "fitness" in your explanation.

Answers

16. Even if there are no white fish, the frequency of white fish may not be zero due to chance events such as mutation or migration.

What might cause the return of fish after a few generations? What is fitness?

17. The return of white fish could be due to a new mutation or the arrival of white fish from a neighboring population.

18. Fixation could occur in the koi population if the selection against white fish is strong enough that all white fish are eliminated over time, leaving only the orange fish.

19. Natural selection acts on the variation within a population, favoring individuals with higher fitness (i.e., better adapted to the environment) and reducing the frequency of less fit individuals. Over time, this can result in changes in the population's genetic makeup and the evolution of new traits that increase fitness.

Learn more about species fitting in here:

https://brainly.com/question/4101369

#SPJ1

decribe teh mechansims resonpitble for con-a induced hemagglucnation reaction

Answers

The mechanism responsible for Con-A induced hemagglutination reaction involves the binding of Concanavalin A (Con-A), a lectin protein, to the specific sugar residues present on the surface of red blood cells (RBCs).

This binding leads to the formation of cross-links between the RBCs, resulting in the clumping or agglutination of RBCs. The mechanism of Con-A induced hemagglutination reaction can be explained by the fact that Con-A has a specific binding site for alpha-D-mannose and alpha-D-glucose residues on the surface of RBCs. When Con-A comes in contact with RBCs, it binds to these specific sugar residues and forms a lattice-like structure, resulting in the agglutination of RBCs. Additionally, Con-A is known to induce the secretion of cytokines and chemokines, which can activate immune cells and further enhance the hemagglutination reaction. This activation of immune cells by Con-A may also contribute to the development of an immune response against the RBCs. In summary, the mechanism of Con-A induced hemagglutination reaction involves the specific binding of Con-A to sugar residues on the surface of RBCs, leading to the formation of cross-links between the cells and the subsequent clumping or agglutination of RBCs. The activation of immune cells by Con-A may also contribute to the development of an immune response against the RBCs.

Learn more about cells here-

https://brainly.com/question/30046049

#SPJ11

Observe the coleus leaves, what colors do you see? Based on this observation, what pigments do you expect to identify? The solvent used in this experiment is a non-polar chemical. Given the information about plant pigments in the table below, predict how these pigments will separate on the chromatography strip. Pigment Name Number of polar groups Ranked position on paper from bottom (.e., 1st, 2nd, etc.) Anthocyanin 6 and a positive charge Carotene 0Chlorophyll a 5Chlorophyll b 6Xanthophyll 2The chromatography solvent is extremely flammable and used only in the hood. Do not inhale fumes and do not use sparks or open flames.

Answers

Upon observing the coleus leaves, We see various colors such as green, red, purple, and yellow. Based on this observation, I expect to identify the pigments chlorophyll a and b, anthocyanin, and xanthophyll.

Since the solvent used in the experiment is non-polar, I predict that the polar pigments will move slower up the chromatography strip and be ranked closer to the bottom. Therefore, I would expect to see chlorophyll a and b ranked higher on the paper, followed by xanthophyll, and then anthocyanin. Carotene, being non-polar, would not separate on the chromatography strip and would likely remain at the bottom of the paper. It is important to note that the chromatography solvent is extremely flammable and should only be used in a hood while avoiding inhaling fumes and using sparks or open flames.

To know more about coleus leaves, click here:

brainly.com/question/29584713

#SPJ11

Which of the following is FALSE?
a. Species that are closely related have similar DNA sequences.
b. Advantageous mutations are often preserved in the DNA code.
c. Harmful mutations are selected against and tend to be eliminated.
d. If a species needs a certain trait to survive, it is more likely to have a mutation in its DNA.

Answers

The false statement among the given options is d. If a species needs a certain trait to survive, it is more likely to have a mutation in its DNA. While it may seem logical that a species would evolve to have traits that help it survive, it is not necessarily true that a mutation will occur in its DNA to provide that trait.

Mutations occur randomly and may or may not be advantageous or harmful to the species. It is only when a beneficial mutation arises that natural selection can act upon it and favor its spread within the population. In other words, the process of natural selection does not work by "needing" a certain trait and then developing it, but rather by random mutations occurring and advantageous ones being selected for over time. Therefore, it is important to understand that evolution is not a conscious process, but a result of natural selection acting upon random mutations in the DNA code.

To know more about mutation click here:

brainly.com/question/30337180

#SPJ11

Select the statement(s) that accurately describe the function of the tonsils in the immune system.

Pathogens are filtered from the bloodstream.
Stimulates the immune system to respond accordingly.
Red blood cells are created that help fight infections
Traps and destroys foreign substances and filters them from the blood.
Keeps pathogens (invaders) out by providing a barrier.

Answers

Tonsils traps and destroys the foreign substances and filters from the blood option c is the correct answers

The tonsils' primary job is to snare the germs that enter the body through breathing. They serve as the body's initial line of defense when contagious microbes invade it. For instance, the lymph, a clear and colorless fluid, is used to wash out bacteria and viruses that enter the body through the mouth and nose and are found by the tonsils.

The tonsils also function as a defense system by preventing foreign objects from entering the lungs.

These also remove viruses and germs. These also result in the production of white blood cells and antibodies.

White blood cells are abundant in your tonsils and aid in the killing of pathogens.

therefore your tonsils can "catch" germs that enter your body through your nose or mouth since they are located at the back of your throat.

To learn more about Tonsils here

https://brainly.com/question/2162267

Discussion What part of the life cycle is represented by the mature pollen grain

Answers

The mature pollen grain represents the male gametophyte stage in the life cycle of seed plants, specifically during the process of sexual reproduction. This stage is part of the alternation of generations, which includes two distinct multicellular phases: the sporophyte (diploid) and the gametophyte (haploid).

In seed plants, the mature pollen grain contains the male reproductive cells and is produced by the anther within the flower. Upon reaching maturity, the pollen grains are released for pollination, which is the transfer of pollen from the anther to the stigma of a flower. This can occur through various mechanisms, such as wind, insects, or other animals.
Once the pollen grain lands on the receptive stigma, germination occurs, leading to the formation of a pollen tube that grows through the style and into the ovary. The male gametes then travel down the pollen tube to reach the female gametophyte, where fertilization takes place. This results in the formation of a zygote (diploid), which eventually develops into a new sporophyte generation.
In summary, the mature pollen grain represents the male gametophyte stage in the life cycle of seed plants, playing a crucial role in sexual reproduction and the continuation of the species.

To know more about pollen grain click here:

brainly.com/question/2996120

#SPJ11

are the spots on the following chromatogram the same molecule? why or why not?

Answers

A chromatogram is a visual representation of the separation of chemical compounds based on their physical and chemical properties, typically through a process called chromatography.

Without seeing the specific chromatogram in question or knowing the details of the experiment or analysis being conducted, I cannot determine whether the spots on the chromatogram represent the same molecule or not.

Generally, the identity of a molecule can be determined by comparing its physical and chemical properties to those of known compounds, such as through spectroscopy, mass spectrometry, or other analytical techniques. However, without more specific information about the chromatogram and the compounds being analyzed, it is impossible for me to say whether the spots on the chromatogram represent the same molecule or not.

To know more about chromatography

brainly.com/question/30907934

#SPJ11

Choose the DNA sequence of the strand that is complementary to 5' GTATCTGCCA 3'. a. 5' GUAUCUGCCA 3'b. 5' ACCGTCTATG 3'c. 5' UGGCAGAUAC 3'd. 5' CATAGACGGT 3'e. 5' TGGCAGATAC 3'

Answers

The DNA sequence of the strand that is complementary to 5' GTATCTGCCA 3' is (d) 5' CATAGACGGT 3'.

To find the complementary DNA sequence to 5' GTATCTGCCA 3', you need to remember the base-pairing rules in DNA. Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).

Given the sequence 5' GTATCTGCCA 3', the complementary strand would have the following base pairs:

G -> C
T -> A
A -> T
T -> A
C -> G
T -> A
G -> C
C -> G
C -> G
A -> T

So, the complementary DNA sequence is 5' CATAGACGGT 3'. Therefore, the correct answer is option d. 5' CATAGACGGT 3'.

It's important to note that the other options include uracil (U), which is found in RNA, not DNA. So, they can be ruled out as complementary DNA sequences.

Learn more about DNA sequence here: https://brainly.com/question/26225212

#SPJ11

1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose?

Answers

When cloning by restriction digest and ligation, restriction enzymes are used to cut open a plasmid (backbone) and insert a linear piece of DNA (insert) cut by suitable restriction enzymes.

How do restriction enzymes of type 2 cleave DNA?

Type II restriction enzymes are the ones that are most commonly utilised in molecular biology applications including gene cloning and DNA fragmentation and analysis. These enzymes break DNA at certain places in relation to their recognition sequence, resulting in repeatable fragments and discrete gel electrophoresis patterns.

Traditional classifications of restriction enzymes are based on subunit composition, cleavage location, sequence specificity, and cofactor requirements.

learn more about electrophoresis patterns

https://brainly.com/question/13813089

#SPJ1

E. coli has an arg operon that produces structural genes CBH. These structural genes encode proteins used in arginine biosynthesis. When arginine is absent, transcription of the operon occurs. When arginine is present, arginine binds to a repressor protein. The repressor binds the arg operator and blocks transcription. What type of operon is this?
a. Inducible operon b. Repressible operon c. Unregulated operon d. argh, who knows!?!

Answers

The type of operon described is a Repressible operon.

In this type of operon, transcription of the structural genes is normally active, but it can be inhibited or repressed by a specific small molecule, which in this case is arginine. When the repressor protein binds to the operator in the presence of arginine, it prevents transcription of the structural genes, leading to a decrease in the production of the enzymes necessary for arginine biosynthesis.

b. Repressible operon

Learn more about operon here:

https://brainly.com/question/14331566

#SPJ11

4. what do the different colors of the indicator tell you about the bacteria growing on the plate?

Answers

The different colors of the indicator on the plate can provide information about the population of bacteria growing on it. For example, if the indicator turns yellow, it may indicate the presence of acid-producing bacteria. If it turns blue, it may indicate the presence of alkaline-producing bacteria. This information can be useful in identifying the types of bacteria present and monitoring changes in the population over time.

To know more about bacteria, click here:-

https://brainly.com/question/8008968

#SPJ11

Are dichotomous keys purely a human invention? Explain.

Answers

No, dichotomous keys are not purely a human invention because we can observe this pattern in nature and therefore there would exist natural selection.

What are dichotomous keys and which is this importance in classification?

A dichotomous key is any trait that exhibits only two different phenotypes and is important in classification based on the possibility to categorize taxonomic groups.

Therefore, with this data, we can see that dichotomous keys can be used to classify different taxa and also are observed in nature which has been selected by natural selection.

Learn more about dichotomous keys here:

https://brainly.com/question/1726339

#SPJ1

cells that are able to perform transformation are called confiscated.truefalse

Answers

False. The terms "cells" and "transformation" are used correctly in the sentence, but "confiscated" is not relevant to the question or answer. The statement is incorrect as cells that are able to perform transformation are usually referred to as "transformed cells" or "transgenic cells."

The basic building elements of all living things, cells are also crucial to a number of physiological functions. The capacity of cells to change, adapt, and differentiate into distinct cell types is one of their most fascinating features. When a cell undergoes transformation, it changes from one kind to another, such as when a stem cell becomes a muscle cell or when a malignant cell arises from a healthy cell. Genetic mutations, environmental influences, or cell signalling pathways can all result in transformation. It is essential to comprehend how cells transform in order to create treatments for a variety of ailments, including cancer and degenerative conditions.

Learn more about "cells" here:

https://brainly.com/question/1255054

#SPJ11

False. The terms "cells" and "transformation" are used correctly in the sentence, but "confiscated" is not relevant to the question or answer. The statement is incorrect as cells that are able to perform transformation are usually referred to as "transformed cells" or "transgenic cells."

The basic building elements of all living things, cells are also crucial to a number of physiological functions. The capacity of cells to change, adapt, and differentiate into distinct cell types is one of their most fascinating features. When a cell undergoes transformation, it changes from one kind to another, such as when a stem cell becomes a muscle cell or when a malignant cell arises from a healthy cell. Genetic mutations, environmental influences, or cell signalling pathways can all result in transformation. It is essential to comprehend how cells transform in order to create treatments for a variety of ailments, including cancer and degenerative conditions.

Learn more about "cells" here:

https://brainly.com/question/1255054

#SPJ11

Susan has two boxes. Each is 12 cm high, 12 cm long,
and 12 cm wide. Which statement describes Susan's
boxes?
A) The boxes are congruent, but not similar.
B) The boxes are similar, but not congruent.
C) The boxes are similar and congruent.
D) The boxes are only similar.

Answers

Answer:

C

Explanation:

The dimensions of both boxes are the same which makes them congruent and similar. Congruent figures are always similar.

The answer is C) the boxes are similar and congruent.
Congruent figures are similar always

The considering the limitations of diffusion and osmosis, why does it make sense that life started with small cells in an aquatic environment?

Answers

The limitations of diffusion and osmosis refer to the fact that these processes become less efficient as the distance between cells and their environment increases.

This means that larger cells would have more difficulty exchanging nutrients and waste products with their surroundings, which could limit their ability to survive and thrive. Additionally, larger cells may be more prone to damage from osmotic imbalances, which can occur when the concentration of solutes inside and outside of the cell are not balanced.

Given these limitations, it makes sense that life started with small cells in an aquatic environment. In this environment, cells are surrounded by a fluid that can easily facilitate diffusion and osmosis, allowing for efficient exchange of materials with the surrounding environment. The presence of water also helps to buffer against osmotic imbalances, which could help protect cells from damage.

Small cells would have an advantage in this environment because they would be better able to exchange materials and maintain proper osmotic balance, allowing them to survive and reproduce more effectively. Therefore, it is likely that the earliest forms of life were small cells that lived in aquatic environments.

Learn more about osmosis here:

https://brainly.com/question/1799974

#SPJ11

all of the following are categories of adjustments EXCEPT
Group of answer choices
behavioral.
acclimatory.
genetic.
developmental.

Answers

Behavioral, acclimatory, and developmental are all categories of adjustments except "genetic" changes.

When we talk about "adjustments" in biology or ecology, we usually refer to changes that organisms make in response to environmental pressures or changes. Adjustments can be categorized as behavioral, acclimatory, and developmental, but genetic changes are not considered adjustments as they are inherited traits passed down through genes. "Genetic" refers to an organism's genetic makeup, determined by its genes and inherited from its parents.

While an organism's genes can influence how it responds to environmental pressures, they are not typically considered the same way as behavioral, acclimatory, or developmental changes. For example, if a population of birds is exposed to a new predator that hunts during the day, the birds may adjust their behavior by becoming more active at night to avoid the same predator. This would be considered a behavioral adjustment.

Alternatively, if the birds gradually become more tolerant of higher temperatures over time, this would be an acclimatory adjustment. If the birds develop longer wings to better escape the predator, this would be considered a type of developmental adjustment. However, if the birds inherit genes that make them better able to tolerate higher temperatures or evade predators, this is not considered a type of adjustment, but an adaptation that has evolved through natural selection.

Therefore, the correct option is "genetic."

Learn more about genetic: https://brainly.com/question/2780091

#SPJ11

Which of the following variables of an asteroid collision affects the impact crater they leave behind?
O Size
O Speed
O Mass
O All of the above

Answers

Answer:

All of the above

Explanation:

Answer:

O all of the above

Explanation:

All of the variables mentioned - size, speed, and mass - can affect the impact crater that an asteroid leaves behind.

The size of the asteroid determines the size of the impact crater. A larger asteroid would create a larger impact crater compared to a smaller asteroid.

The speed of the asteroid affects the amount of kinetic energy that it carries. The higher the speed, the greater the kinetic energy, which results in a larger impact crater.

The mass of the asteroid also influences the impact crater, as a more massive asteroid would have more kinetic energy and greater momentum, resulting in a larger impact crater.

What types of rotational symmetry are possible for a protein with (a) four or (b) six identical subunits?

Answers

(a) A protein with four identical subunits can have either 4-fold or 2-fold rotational symmetry.

(b) A protein with six identical subunits can have either 6-fold, 3-fold, or 2-fold rotational symmetry.

Proteins with identical subunits can exhibit various types of rotational symmetry. For a protein with four identical subunits, there can be either 4-fold or 2-fold rotational symmetry. In 4-fold symmetry, the protein can be rotated 90 degrees four times to achieve the same orientation. In 2-fold symmetry, the protein can be rotated 180 degrees two times to achieve the same orientation.

For a protein with six identical subunits, there can be either 6-fold, 3-fold, or 2-fold rotational symmetry. In 6-fold symmetry, the protein can be rotated 60 degrees six times to achieve the same orientation. In 3-fold symmetry, the protein can be rotated 120 degrees three times to achieve the same orientation. In 2-fold symmetry, the protein can be rotated 180 degrees two times to achieve the same orientation. These types of symmetry can provide important insights into the structure and function of proteins.

Learn more about proteins here:

https://brainly.com/question/29776206

#SPJ11

Once an oocyte is ‘chosen’, know the steps leading to ovulation

Answers

Once an oocyte is selected, the following steps lead to ovulation:

The follicle that contains the oocyte starts to grow and mature under the influence of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) produced by the pituitary gland.The oocyte undergoes meiosis I and produces a secondary oocyte and a polar body.As the follicle continues to grow, it fills with fluid, and the pressure inside increases.At a certain point, usually around day 14 of a 28-day menstrual cycle, the follicle ruptures and releases the mature oocyte from the ovary. This process is known as ovulation.The released oocyte is swept up by the fimbriae of the fallopian tube and begins its journey towards the uterus.If the oocyte is fertilized by a sperm during its journey, it may implant in the uterine lining and develop into a fetus. If the oocyte is not fertilized, it will degenerate and be expelled from the body during menstruation.

In the first stage of photosynthesis, light energy is converted into chemical energy and reducing equivalents (NADPH + H+). This phenomenon is called A) energy transduction B) decay c) radiation D) kinetic energy E) potential energy

Answers

The correct answer is A) energy transduction. During the first stage of photosynthesis, also known as the light-dependent reactions.

THE light energy is absorbed by pigments in the chloroplasts and converted into chemical energy in the form of ATP and reducing equivalents in the form of NADPH + H+.

This process is known as energy transduction, as it involves the conversion of one form of energy (light) into another form (chemical energy) and reducing equivalents.
Hi! In the first stage of photosynthesis, light energy is converted into chemical energy and reducing equivalents (NADPH + H+). This phenomenon is called A) energy transduction.

To know more about photosynthesis,  click here:

brainly.com/question/29764662

#SPJ11

why does the human body need energy in forms other than heat?

Answers

In summary, while heat is a byproduct of energy consumption in the human body, the body requires energy in other forms to support vital life processes and maintain overall health.

The human body needs energy in forms other than heat for various essential functions. These functions include:
1. Cellular processes: Energy is required for cellular activities like cellular respiration, protein synthesis, and cell division. This energy is usually in the form of adenosine triphosphate (ATP).
2. Muscle movement: Physical activities such as walking, running, and lifting objects require energy to contract and relax muscles, enabling movement and strength.
3. Brain function: The human brain needs energy to perform cognitive tasks, including thinking, learning, memory, and decision-making. This energy helps maintain the proper function of neurons and neurotransmitter production.
4. Growth and repair: The body uses energy to build new tissues, repair damaged cells, and maintain organ function.
5. Metabolism: Energy is needed to fuel the chemical reactions that break down food, absorb nutrients, and eliminate waste

Learn more about energy here:

https://brainly.com/question/30512162

#SPJ11

name one virus that you can visibly see the effects of other than dwv

Answers

One of the virus that you can visibly see the effects of, other than Deformed Wing Virus (DWV), is the Chickenpox virus (Varicella-zoster virus).

This virus causes a highly contagious disease characterized by itchy, red blisters on the skin.

One virus that you can visibly see the effects of, other than DWV (Deformed Wing Virus) is the TSV (Tobacco Streak Virus). TSV causes a yellowish streaking pattern on the leaves of infected plants, which is easily visible to the eye.

Additionally, the virus can cause a reduction in plant growth, deformation of the leaves, and a decrease in crop yield.

To learn more about Varicella-zoster virus click here

brainly.com/question/9831413

#SPJ11

The first regions of the brain to be damaged by Alzheimer's disease are the __________ which contain the __________, which is heavily involved in memory.
temporal lobes; hippocampus
occipital lobes; hippocampus
hypothalamus; parietal lobes
frontal lobes; hypothalamus

Answers

The first regions of the brain to be damaged by Alzheimer's disease are the temporal lobes, which contain the hippocampus, which is heavily involved in memory.

Alzheimer's disease is a brain disorder that slowly destroys memory and thinking skills, and eventually, the ability to carry out the simplest tasks. In most people with Alzheimer's, symptoms first appear later in life.Alzheimer's disease is thought to be caused by the abnormal build-up of proteins in and around brain cells. One of the proteins involved is called amyloid, deposits of which form plaques around brain cells. The other protein is called tau, deposits of which form tangles within brain cells.

Hippocampus is a complex brain structure embedded deep into temporal lobe. It has a major role in learning and memory. It is a plastic and vulnerable structure that gets damaged by a variety of stimuli. Studies have shown that it also gets affected in a variety of neurological and psychiatric disorders.

TO KNOW MORE ABOUT Alzheimer's disease CLICK THIS LINK -

brainly.com/question/26431892

#SPJ11

During the post-natal period, human growth is not isometric – an adult is not a proportionally scaled up baby (left panel). Allometric growth of various body structures results in changes in their proportion relative to total height (or mass).
After measurements of two structures over the course of growth, an allometric (double logarithmic) plots relative to total height we made (right panel). The dashed line is an isometric line.
(a) What body parts might plot A and plots B represent?
(b) Why might the two lines have different slopes?
(c) How does the difference in the slope account for the differences in the growth trajectory
of the two structures?

Answers

(a) The plot A and plot B might represent different body parts such as head circumference and height (plot A) and body mass and height (plot B).

(b) The two lines might have different slopes because different body parts may have different growth rates during the post-natal period.

For example, the head may grow faster in the early stages of life, while the body may grow more slowly and then accelerate in growth during puberty. This can result in different allometric relationships between body structures and total height or mass.

(c) The difference in the slope of the two lines can account for the differences in the growth trajectory of the two structures.

A steeper slope indicates a higher growth rate relative to the growth of the whole body, while a shallower slope indicates a lower growth rate relative to the growth of the whole body.

For example, if the slope of the head circumference vs. height plot (plot A) is steeper than the slope of the body mass vs. height plot (plot B), it means that the head is growing faster relative to the body, which may result in changes in the overall proportion of the body over time. This can also explain why an adult is not a proportionally scaled up baby, as different body structures grow at different rates during the post-natal period.

learn more about body mass here:

https://brainly.com/question/14806759

#SPJ11

(a) The plot A and plot B might represent different body parts such as head circumference and height (plot A) and body mass and height (plot B).

(b) The two lines might have different slopes because different body parts may have different growth rates during the post-natal period.

For example, the head may grow faster in the early stages of life, while the body may grow more slowly and then accelerate in growth during puberty. This can result in different allometric relationships between body structures and total height or mass.

(c) The difference in the slope of the two lines can account for the differences in the growth trajectory of the two structures.

A steeper slope indicates a higher growth rate relative to the growth of the whole body, while a shallower slope indicates a lower growth rate relative to the growth of the whole body.

For example, if the slope of the head circumference vs. height plot (plot A) is steeper than the slope of the body mass vs. height plot (plot B), it means that the head is growing faster relative to the body, which may result in changes in the overall proportion of the body over time. This can also explain why an adult is not a proportionally scaled up baby, as different body structures grow at different rates during the post-natal period.

learn more about body mass here:

https://brainly.com/question/14806759

#SPJ11

1. Anteriorly, the iliofemoral, or Z, ligament prevents hip hyperextension.
True
False
2. All three gluteal muscles are common in that portions of each are antagonistic to other portions of the same muscle.
True
False
3. The teres ligament is taut in excessive hip adduction, flexion, and external rotation.
True
False

Answers

(1) The statement "Anteriorly, the iliofemoral, or Z, ligament prevents hip hyperextension" is true. (2) The statement "All three gluteal muscles are common in that portions of each are antagonistic to other portions of the same muscle" is false. (3) The statement "The teres ligament is taut in excessive hip adduction, flexion, and external rotation" is true.

(1) The iliofemoral ligament is a strong ligament that spans from the anterior inferior iliac spine (a bony projection on the front of the pelvis) to the intertrochanteric line (a ridge on the upper part of the femur). It is shaped like a "Z", which is why it is sometimes called the Z-ligament.

The iliofemoral ligament has several important functions in the hip joint, one of which is to prevent hyperextension (excessive backward movement) of the hip joint. This is because the ligament runs across the front of the hip joint, and as the hip joint extends, the tension in the ligament increases, ultimately limiting further extension.

(2) The three gluteal muscles are the gluteus maximus, gluteus medius, and gluteus minimus. While each of these muscles has multiple segments or regions, there is no significant antagonism between the segments of the same muscle. Rather, the different gluteal muscles work together synergistically to produce and control hip movement and stability.

(3) The teres ligament is a strong, fibrous band that connects the head of the femur to the acetabulum (the cup-shaped socket of the hip joint). It plays an important role in stabilizing the hip joint and preventing dislocation.

The teres ligament is taut in excessive hip adduction, flexion, and external rotation because these movements put tension on the ligament and stretch it tight. The tautness of the teres ligament helps to limit the range of motion of the hip joint in these directions, thereby helping to prevent dislocation or other injuries. Therefore, statements (1) and (3) are true while statement (2) is false.

Learn more about gluteal: https://brainly.com/question/10372475

#SPJ11

What 3 locations may trichomonas vaginalis reside?

Answers

Trichomonas vaginalis is a parasitic protozoan that causes a common sexually transmitted infection (STI) called trichomoniasis.

Trichomonas vaginalis can reside in three different locations in the human body. The first location is the vagina, which is the primary site of infection. The protozoan can live in the vaginal walls and mucus membranes, causing inflammation and discharge. The second location is the male urethra. Although trichomoniasis is more commonly diagnosed in women, men can also contract the infection, and the protozoan can reside in the urethra, causing urethritis and discomfort during urination. The third location is the cervix. Trichomonas vaginalis can also reside in the cervix, the narrow passage at the lower end of the uterus that connects to the vagina. In this location, the protozoan can cause inflammation and discharge, as well as increase the risk of complications during pregnancy. It is important to note that trichomoniasis can be easily treated with antibiotics, and both sexual partners should receive treatment to prevent reinfection.

Learn more about protozoan here: https://brainly.com/question/29990311

#SPJ11

Describe how water is lost from the leaves of a plant​

Answers

Most of the water a plant loses is lost due to a natural process called transpiration. Plants have little pores (holes or openings) on the underside of their leaves, called stomata. Plants will absorb water through their roots and release water as vapor into the air through these stomata.

Bergey’s Manual of Systems Bacteriology provides information on classifying bacteria according to rRNA.
True
False

Answers

Bergey’s Manual of Systems Bacteriology provides information on classifying bacteria according to rRNA. This statement is true.


What is Bergey's manual of systematic bacteriology?
Bergey's Manual of Systematic Bacteriology is a reference work containing information on bacterial taxonomy, including classification based on rRNA sequencing. This manual is widely used in the field of bacteriology for identifying and classifying pathogenic and non-pathogenic bacteria. Gram staining, which is used to differentiate between gram-positive and gram-negative bacteria, is also an important tool in bacteriology.

Bergey's Manual is an important resource in bacteriology, which is the study of bacteria. It helps researchers and scientists classify and identify bacteria, including pathogens, which are disease-causing microorganisms. The manual also contains information on methods such as gram staining, a technique used to differentiate bacterial species into two groups (Gram-positive and Gram-negative) based on the characteristics of their cell walls.

To know more about classification of bacteria, visit:

https://brainly.com/question/30870028

#SPJ11

what is the mechanistic basis for the observation that inhibitors of atp synthase lead to thee inhubition of etc

Answers

The mechanistic basis for the observation that inhibitors of ATP synthase lead to the inhibition of the electron transport chain (ETC).

ATP synthase is an enzyme that plays a crucial role in generating ATP (adenosine triphosphate) through a process called oxidative phosphorylation. This process occurs in the ETC, where electrons are transferred through a series of protein complexes to ultimately generate a proton gradient across the inner mitochondrial membrane. When inhibitors of ATP synthase are introduced, they block the enzyme's activity, preventing the conversion of ADP (adenosine diphosphate) to ATP. As a result, the proton gradient cannot be utilized to produce ATP, causing a buildup of protons in the intermembrane space. This buildup of protons leads to the inhibition of the ETC, as the proton gradient is essential for driving the electron flow through the chain. Consequently, the overall process of oxidative phosphorylation and cellular energy production is disrupted.

Learn more about electron here-

https://brainly.com/question/1255220

#SPJ11

In this activity, you will compare the properties of DNA polymerase I, II, and III. Identify the properties of DNA polymerase I. Select all that apply.

Answers

The properties of DNA polymerase I are:

5' to 3' polymerase activity

3' to 5' exonuclease activity

5' to 3' exonuclease activity

Low processivity

Involved in removing RNA primers and replacing them with DNA during DNA replication

Has a molecular weight of about 109 kDa.

DNA polymerase I, II, and III are enzymes involved in DNA replication in prokaryotes. The properties of DNA polymerase I are:

5' to 3' polymerase activity

3' to 5' exonuclease activity

5' to 3' exonuclease activity

Low processivity

Involved in removing RNA primers and replacing them with DNA during DNA replication

Has a molecular weight of about 109 kDa.

Therefore, the correct options are:

5' to 3' polymerase activity

3' to 5' exonuclease activity

5' to 3' exonuclease activity

Involved in removing RNA primers and replacing them with DNA during DNA replication

Has a molecular weight of about 109 kDa.

Click the below link, to learn more about DNA polymerase:

https://brainly.com/question/30826988

#SPJ11

Other Questions
If a ball is thrown into the air with a velocity of 36 ft/s, its height (in feet) after t seconds is given by y = 36t 16t2. Find the velocity when t = 1. if two cards are drawn one at at time from a standard deck of cards. what is the probability of drawing a 4 and then a non face card without replacement find the median for -4, 5, 12, 11, -6, 7, 20, 4, 16, 10, 13 Which nuclear process would yield the most energy, the fission of uranium or the fusion of hydrogen? A. the fission of uranium B. the fusion of hydrogen C. both processes yield equal amounts of energy Sketch the region enclosed by the given curves. Y = 2/x, y = 8x, y = > 0 Find its area. _________ Common moral agreement about right and wrong actions and behaviors across multiple cultures and countries, also known as ethical universalism, gives rise toA) standards of what constitutes ethical and unethical behavior in business situations that are partly universal, but in the main are governed by local business norms.B) principles that set forth the traits and behaviors considered virtuous, that is, which a good person is supposed to believe in and display.C) standards of what's ethical and what's unethical, applicable to all businesses in all countries, irrespective of local business traditions and local business norms.D) principles of right and wrong in judging the ethical correctness of business behavior. E) principles embodied in international law that all societies and countries are obliged to practice. If mEFG=(3x+11), and mGCE=(5x23), what are the measures of the central and circumscribed angles? Responses: mEFG=86, mGCE=94 mEFG=83, mGCE=97 mEFG=79, mGCE=101mEFG=150.5, mGCE=209.5 Solve and show each step Each student in Mrs. Wimberlys six science classes planted a bean in a Styrofoam cup. All beans came from the same source, were planted using the same bag of soil, and were watered the same amount. Mrs. Wimberly has 24 students in each of her six classes. In first period, 21 of the 24 bean seeds sprouted. Which statement about the seeds in the remaining five classes is NOT supported by this information? ResponsesA 87.5% of the bean seeds should sprout.87.5% of the bean seeds should sprout.B More than 100 bean seeds should sprout.More than 100 bean seeds should sprout.C 1 out of 8 bean seeds will not sprout.1 out of 8 bean seeds will not sprout.D At least 20 bean seeds will not sprout.At least 20 bean seeds will not sprout. Which statement best describes the effects of Fascist Party changing the value of currency in Italy? a. Goods became less expensive, and it led to more people finding jobs. b. Goods became less expensive, but it led to high unemployment rates. c. Goods became more expensive, but it led to more people finding jobs. d. Goods became more expensive, and it led to high unemployment rates. suppose a is 3x3 and det(a) = 1. what is det(2a)? The median is ...A) the middle number in a numerical data set when the values have been arranged innumerical order.B) the number or numbers occurring most frequently in a data set.C) a measure of dispersion.D) The difference of the highest value and lowest value in the data set. Nicole writes the expression (2.5x -7)( 3). She rewrites the expression using the distributive property. Which expression could Nicole have written using the distributive property? A. 7.5x - 4 C. 7.5x - 21 B. 5.5x - 4 D. 5.5x + 10 in order for a copyright holder to collect money damages from a person who used copyrighted material, it must be proven that Does the rock cycle always follow a certain path? In other words,is it a one way process? Please explain why or why not. If Ax = ax for nxn matrix A, nx1 matrix x, and a E R, determine a scalar with the property that Ax = Bx. why did eisenhower not use the cia or send troops to suez canal to support Britain France and Isreal How did the Isrealites view their leaders? In the dehydration reaction of 2-methylcyclohexanol, what is the primary role of the acid catalyst? a. to neutralize base that is formed during the reaction b. to generate a better leaving group c. to enhance the solubility of the polar intermediates d. to deprotonate the carbocation intermediate that leads to alkene formation Johnson Cogs wants to set up a line to serve 60 customers per hour. The work elements and their precedence relationships are shown in the following table. a. What is the theoretical minimum number of stations? b. How many stations are required using the longest work element decision rule? c. Suppose that a solution requiring five stations is obtained. What is its efficiency?