What did many people in the south believe after the supreme court's ruling in the scott v. sandford case?
o the argument over slavery would lead to its demise.
o the argument over slavery had been settled.
o the argument over slavery had just begun.
o the argument over slavery would never end.
mark this and return
save and exit
next
submit

Answers

Answer 1

The correct statement is that the argument over the slavery would never end.

What was the reaction of the people in the South in Scott v. Sandford case?

The people of the South were opposed to the decision made by the supreme court.

They had the the belief that the slavery would never end, despite it would spread rapidly.

Even people agreed that slavery had already spread.

Learn more about the Scott v. Sandford case here:-

https://brainly.com/question/12359809

#SPJ1


Related Questions

“Who was not an explorer during the Renaissance period?”

Answers

Answer:

Is there supposed to be a multiple-choice or something?

Explanation:

What was the Red Scare?

a widespread fear in the 1930s of the bubonic plague spreading in the U.S.

a period of widespread social activism and political reform across the U.S. that spanned the 1890s to the 1920s

a government-led initiative that aimed to stop illegal drug use by dramatically increasing prison sentences for both drug dealers and users

a frenzy over the perceived threat posed by Communists in the U.S. during the Cold War​

Answers

Answer:

A frenzy over a threat by communists in the cold war

Explanation:

Answer:

A frenzy over the perceived threat posed by Communists in the U.S. during the Cold War​

Explanation:

The Red Scare occurred primarily between 1917-1920, and then during the Cold War, and essentially was termed to describe the US's general populations fear of the spread of communism across the world and into the United States, and the active lookout to stop it. The Red Scare was taken a step extreme with McCarthyism, which saw to the accusation of many political and ordinary people being accused of being a communist and being blacklisted.

The Red Scare proceeded to die down during the 1920s with the advent of the rise of Nazism, and during the 1950s it ended with McCarthy's loss of credibility where his accusations were mostly proven false.

Learn more about McCarthy, McCarthyism, and Red Scare, here:

https://brainly.com/question/27709522?referrer=searchResults - Result of McCarthyism.

https://brainly.com/question/19343828?referrer=searchResults - Goal of McCarthyism.

https://brainly.com/question/14176721?referrer=searchResults - Definition of McCarthyism (refer to Aewright8383 's answer).

Other european powers responded to great britain's seizure of the suez canal
by:
a. forming an alliance to prevent the british from capturing more
land.
b. rushing to secure colonial territories of their own throughout
africa.
c. attacking undefended british colonies in asia and the americas.
d. providing african states with beapons to resist british
imperialism.
k

Answers

The response of other European nations to Britain seizing the Suez Canal was b. rushing to secure colonial territories of their own throughout Africa.

What happened when Britain took the Suez Canal?

Towards the end of the 1800s, the British took over the Suez Canal thanks to some "smart" financial dealings.

When other European nations saw this, they did not want to be left behind and so went to colonize territories of their own in Africa.

Find out more on European colonization of Africa at https://brainly.com/question/12360924.

#SPJ1

8. Japan's acquisition of Korea in 1910 demonstrates
1. China's policy of generosity toward its neighbors
2. Korea's willingness to become part of the Japanese Empire
3. Russia's determination to strengthen its position in East Asia
4. Japan's emergence as an imperial power in East Asia

Answers

Answer:


2. Korea's willingness to become part of the Japanese Empire

Japan's acquisition of Korea in 1910 demonstrates Japan's emergence as an imperial power in East Asia.

What is Japan's acquisition of Korea?

Japan was able to annex Korea in 1910 due to its military strength. Contrary to the later claims of Makoto Saito, the union of Korea and Japan was not “peacefully accomplished by the mutual consent of the people.”

What is an imperial power?

Imperialism is the state policy, practice, or advocacy of extending power and dominion, especially by direct territorial acquisition.

What is East Asia countries?

The modern states of East Asia include China, Japan, Mongolia, North Korea, South Korea, and Taiwan.

To learn more about Japan, Korea and East Asia countries refer

https://brainly.com/question/12397197

#SPJ2

Answer this, Ill give you brainliest and I would be very appreciative.

Answers

Answer:

Option 3

Explanation:

Before bringing charges against the suspect in an arraignment, the government must first receive an indictment from a grand jury.

Answer:I believe it's A. They need to assign a judge to hear the case.

Then the judge decides what needs to be done, and if they need to go to trial or whatever.

Explanation:

Which international organization helped latin american nations become more democratic by sending observers to member states to see that elections were conducted fairly?


international monetary fund


pan american health organization


world health organization


organization of american states

Answers

Organization of American States

The international organization that helped Latin American nations become more democratic by sending observers to member states to see that elections were conducted fairly is organization of American States(OAS).

Thus, the correct answer is option D.

What is the organization of American States?

The Organization of American States is an international organisation founded on April 30, 1948, to promote solidarity and cooperation among its member countries in the Americas. The OAS, which is headquartered in the United States capital of Washington, D.C., has 35 members who are independent states in the Americas.

The organization has focused on election monitoring since the 1990s. The Organization of American States is the premier regional forum for Western Hemisphere political debate, policy analysis, and decision-making. The Organization of American States (OAS) brings together leaders from the Americas to address hemispheric issues and opportunities.

Therefore, the OAS  helped Latin American nations become more democratic by sending observers to member states to see that elections were conducted fairly.

To learn more about organization of American states, click here:

https://brainly.com/question/10514406

#SPJ2

What political problem did many latin american countries have upon gaining independence?
o many places were still taxed by the colonial powers.
o few people had experience in government leadership.
o many peninsulares stayed and ruled local governments.
o a few leaders controlled many of the new governments.

Answers

The political problem that many Latin American countries have upon gaining independence was few people had experience in government leadership. Hence, the correct statement is Option B.

What problems Latin Americans face after independence?

After the Latin American countries won their independence:

There has been confusion as to who might advantage of power.Leaders from independence moves had thoughts for a consultant government.The concept of the presidency became very unorganized due to the fact leaders might now no longer constantly agree on positive things.The Latin population became involved in the brand new political elite might include the antique colonial aristocracy.

Hence, The political problem that many Latin American countries have upon gaining independence was few people had experience in government leadership. The correct statement is Option B.

learn more about Latin Americans here:

https://brainly.com/question/24996151

#SPJ1

people agree about how the goverment should spend its money true or false​

Answers

Answer:

Depends on who you are asking

Explanation:

Some people believe that the government is spending its money correctly, such as on public roads, welfare, etc. These are usually Democrats. However, others believe that the Government is spending it incorrectly. These are republicans.

Answer:

People don't and here are some reasons.

Explanation:

The government spends its money on railroads and people think they should have built a school.

The government builds police academies and people think they should build fast-food restaurants or a park or something.

What people don't realize is that the reason why the government builds these things is that they have a standard to uphold and people to feed and they can't afford to go by what people want unless it is something that requires a vote.

What we need is for some people to just relax and not be so paranoid and finicky.

I hope you agree.

In the early 1600's in Europe, there was an explosion of information in books and people had to learn new rules about recognizing ethos. Before, all books had ethos. Why

Answers

Answer:

There was no table of contents

Explanation:

Europeans had to learn new guidelines for identifying ethos throughout the early 1600s because of the expansion of information in literature. There was no table of contents back then, thus all books had an ethos.

What is literature?

Literature is any collection of written works, but it is sometimes used more explicitly to refer to writings that are specifically thought to be works of art, particularly prose fiction, drama, and poetry. In more recent decades, the concept has been broadened to incorporate oral literature, much of which has been recorded.

Even when it is employed to discuss literature, the idea of meaning is frequently seen as a single, cohesive concept. Although literary meaning varies widely, one cannot generalise about its features as a whole. The term "meaning" in literature generally refers to a variety of distinct phenomena.

The oldest known works of recorded literature appear to have been created in ancient Mesopotamia, just as the wheel, cities, and legal systems.

Learn more about literature from here:

https://brainly.com/question/28188697

#SPJ2

The first mlb baseball stadium was in what u. S. City?.

Answers

the first mlb baseball stadium was fenway park in boston, massachusetts.
it is home of the boston red sox
Fenway park opened in 1912.
the surface is grass

Task 1: Researching Today’s Trade Agreements The International Trade Administration (ITA) is a division of the US Department of 1 © 2015 EDMENTUM, INC. 1 Commerce that focuses on the nation’s trade issues and helps companies do business in and with other countries. The ITA website contains a wide variety of information on issues related to international trade. Read about the free trade agreements the United States has with other countries and answer the questions that follow. Choose a trade agreement that the US currently has with another country that you would like to learn more about. Which country and trade agreement did you choose? Type your response here: If you haven’t already, click the link for the webpage of the potential agreement you selected, and navigate through it to answer the remaining questions. You may have to go to other websites to find some information. If so, be sure to cite your source in your response. List five main points of this agreement. Type your response here: What are the major regions and industries that the agreement addresses? Type your response here: What are some of the current tariffs or barriers to trade? Type your response here: How will consumers benefit from this trade agreement? Type your response here: Conduct some research on the origins of this agreement. Were any Congress members particularly for this agreement? If so, who and why? Type your response here: Were any Congress members against this agreement? If so, who and why? Type your response here: 2 © 2015 EDMENTUM, INC. 2 How might this agreement benefit the US economy overall? Type your response here: How might this agreement benefit people in your state specifically? Type your response here: Task 2: Presenting Your View Imagine that this agreement is still being negotiated. In this task, you will create a presentation to your Congress member to encourage him or her to support passage of this tra

Answers

The main purpose of trade agreements between countries is to reduce trade barriers such as tariffs and quotas and facilitate free trading.

What is a trade agreements?

This refers to the treaties signed by nations to encourage the free flow of goods and services between the members.

These agreements can be a bilateral or multilateral which generally reduce trade barriers such as tariffs and quotas.

An example of trade agreements is one that exist in the Northern Sphere of America called the North American Free Trade Agreement (NAFTA).

Read more about trade agreements

brainly.com/question/2201430

#SPJ1

Which was a response to the terrorist attack against the United States on September 11, 2001?

Question 48 options:

invasion of Afghanistan


OPEC oil boycott


Yom Kippur War


The Gulf War

Answers

Answer:

:)

Explanation:

invasion de afganistan es la repuesta!!

King Richard was best known for,
A. Defeating the French
B. Going Crusading
C. His numerous Reforms
D. The Signing of the Magna Carta

Answers

I’m pretty sure the answer is going crusading

Answer:

His knightly manner and his prowess in the Third Crusade (1189–92) made him a popular king in his own time as well as the hero of countless legends.

Explanation:

Which countries sought control of north america during the seven years war?.

Answers

the french & british wanted control over north america

In what year was juneteenth declared a state holiday in texas?.

Answers

It was declared a state holiday in 1980.

Select the correct answer. who invented the movable type printing press? a. johannes gutenberg b. erasmus c. thomas more d. niccolo machiavelli e. hans holbein

Answers

the answer is a johannes gutenberg

Johannes Gutenberg invented the movable type printing press. Hence option a is correct.

What is printing press?

Printing press is defined as a mechanical tool that presses down on an inked surface that is resting on a print medium to transfer the ink.  We can swiftly and widely disseminate vast volumes of knowledge thanks to the printing press. The printing press is one of the most significant inventions of all time because of how crucial it is. It fundamentally altered how society developed.

As a political exile from Mainz, Germany, Johannes Gutenberg, a goldsmith and inventor, began experimenting with printing in Strasbourg, France, in 1440. He went back to Mainz a few years later, and by 1450, the Gutenberg press was a fully functional and ready-to-use printing device.

Thus, Johannes Gutenberg invented the movable type printing press. Hence option a is correct.

To learn more about printing press, refer to the link below:

https://brainly.com/question/2295180

#SPJ5

what was the main reason towns and cities began to develop out west

Answers

Answer:

Industrialization/ Industrial Revolution, Manifest Destiny

Explanation:

Answer:

The growth of the railroad

Explanation:

Find the probability of rolling a 4 on a number cube and then choosing a red ball at random from a bag of 8 blue and 6 red balls.

1/14
1/6
2/21
19/42

Answers

The probability of rolling a 4 on a number cube and then choosing a red ball at random from a bag of 8 blue and 6 red balls is 1/14.

How to calculate probability?

The probability of rolling a 4 is 1/6. The probability of choosing a red ball will be:

= 6/14.

Therefore, the probability of rolling a 4 on a number cube and then choosing a red ball at random from a bag of 8 blue and 6 red balls will be:

= 1/6 × 6/14

= 1/14

Learn more about probability on:

brainly.com/question/24756209

#SPJ1

Given that the Soviet Union fought in Afghanistan, why was it considered a proxy war?

Answers

Answer:

The Soviet Union answered the Afghans' request for help

Explanation:

Given that the Soviet Union fought in Afghanistan, why was it considered a proxy war? The Soviet Union answered the Afghans' request for help. The mujahedeen fought on behalf of the United States. The combatants in the war represented myriad interests.

According to the author what evidence is there that Mansa Miss was a powerful and wealthy monarch

The text ⬇️

The flow of sub-Saharan gold to the northeast probably occurred in a steady but small stream. Mansa Musa's arrival in Cairo carrying a ton of the metal (1324-25) caused the market in gold to
crash, suggesting that the average supply was not as great. Undoubtedly, some of this African gold was also used in Western gold coins. African gold was indeed so famous worldwide that a Spani
map of 1375 represents the king of Mali holding a gold nugget. When Mossi raids destroyed the Mali empire, the rising Songhai empire relied on the same resources. Gold remained the principal
product in the trans-Saharan trade, followed by kola nuts and slaves. The Moroccan scholar Leo Africans, who visited Songhai in 1510 and 1513, observed that the governor of Timbuktu oned
many articles of gold, and that the coin of Timbuktu was made of gold without any stamp or superscription.

Answers

Answer:

Mansa Musa inherited a kingdom that was already wealthy, but his work in expanding trade made Mali the wealthiest kingdom in Africa. His riches came from mining significant salt and gold deposits in the Mali kingdom. Elephant ivory was another major source of wealth.

How did the Mycenean civilization decline

Answers

Answer:

Ancient Mycenaean civilization might have collapsed due to an uprising or invasion. For many years, the prevailing theory on how the Mycenaean civilization collapsed was that devastating earthquakes led to the destruction of its palaces in the Peloponnese, southern Greece around 1,200 BC.

Memorial day was originally celebrated on what date.

Answers

Answer:

May 30, 1868 was the first day Memorial Day was celebrated.

The declaration was not embraced by all americans when it was written. what arguments do you think people might have made against the seneca falls declaration at the time it was published? write at least one paragraph in your response.

Answers

The arguments made against the Seneca Falls declaration at the time it was published was that Women were not knowledgeable or educated enough to vote.

What is the Seneca Falls declaration?

The declaration was written in form of a manifesto that described the American's women's grievances and demands.

The main purpose of the declaration is to encourage the women to fight for their Constitutionally guaranteed right to equality as U.S. citizen.

In conclusion, the arguments made against the Seneca Falls declaration at the time it was published was that Women were not knowledgeable or educated enough to vote.

Read more about Seneca Falls declaration

brainly.com/question/4419303

#SPJ1

Answer:

Women were not knowledgeable or educated enough to vote.

Women were unfit to participate in the male world of commerce and politics.

Women were naturally less intelligent than men.

A woman’s duty was to raise her children and maintain a home.

Explanation:

Hitler's primary motivation for the invasion of the Soviet Union was?:

Answers

Answer:

Living Space

Explanation:

Answer:

There were multiple reasons but here are some of them

Hitler for one wanted to destroy his most powerful enemy or so he thought at that time which was Stalin and he knew that by destroying Russia not only would he get that biggest empire on earth" I didn't say strongest said Biggest" but by destroying them he would end the Russian France treaty and they would not be allies but he would also have many more resources for tanks and ammunition but also he would know that when he invaded Poland they would not be able to stop him.

What Hitler wasn't counting on was Russia's cold harsh winters and their allies also had allies which were the Japanese the Japanese bombed pearl harbor which caused the US and its allies to join the war.

What was life like for the opposition to Anastasio Somoza in Nicaragua in the 1970s? What kind of government was this? (Site 1)

Answers

Under Anastasio Somoza's regime in Nicaragua, the opposition was subject to heavy repression and human rights abuses which made the government a dictatorship.

What kind of government did Anastasio Somoza lead?

Anastasio Somoza was a dictator who did not like dissent against him from the people of Nicaragua.

As a result, he heavy handedly repressed the opposition such that a rebel movement was formed that eventually removed him from power.

Find out more on Anastasio Somoza at https://brainly.com/question/12268156.

#SPJ1

Priya is comparing two functions: (x) = 10 . y? and g(x) = 3 - 2* to find out which
one has greater output values as x gets very large.
She notices that f(1) = 10 and f(2) = 40. However, g(1) = 6 and g(2) = 12. She
concludes that as x continues to grow, the values of f will be greater than the values
of g.

Explain why priyas conclusion is incorrect

Answers

The value of the function g(x) will be greater, for larger values of x, because g(x) is an exponential function. Function g(x) will have a greater value for all values from x =8


So Priya's conclusion is incorrect.

Powers of the king.-The King, Louis XVI, was absolute. He ruled by the divine right theory which held that he had

received his power to govern from God and was therefore responsible to God alone. He appointed all civil officials and military officers. He made and enforced the laws. He could declare war and make peace. He levied taxes and spent the people's money as he saw fit. He controlled the expression of thought by a strict censorship of speech and press. y means of lettres de cachet (sealed letters which were really blank warrants for arrest) he could arbitrarily imprison anyone without trial for an indefinite period. He lived in his magnificent palace at Versailles, completely oblivious to the rising tide of popular discontent....

Historical Context-refers to the historical circumstances that led to this event/idea/historical development

1. Explain the historical circumstances that led to louis XVI consolidation of power [1]

Answers

Louis XIV consolidate his power after the Aristocratic revolt of 1787 where he imposed religious affair and made a lot of the French Protestants convert to Catholic and he kills those who refused.

Who was Louis XIV?

He was known to be the Sun King, Louis XIV was known to have reigned in France for about 70 years.

He was a great leader who lead France into a lot of wars and he was seen as one of the key dominant power in the European continent.

Note that the historical circumstances that led to louis XVI consolidating his power came after the Aristocratic revolt of 1787 where he imposed religious affair and made a lot of the French Protestants convert to Catholic and he kills those who refused.

Learn more about Louis XIV  from

https://brainly.com/question/19197638

#SPJ1

Which two groups of people did Arabs share power with under the Abbasid Dynasty?
O Persians and Mongols
O Persians and Turks
O Berbers and Egyptians
O Turks and Indians

Answers

Answer:

Persians and Turks

Explanation:

In the Abbasid Dynasty, Persians and Turks were the two Arab group who shared powers with this dynasty.

The Abbasid showed dependence on Persian bureaucrats for governing the territories as well as an increasing addition of non-Arab Muslims.

Persian customs adopted by the ruling elite, and they began to become patrons of artists and scholars.

The Seljuq Turks were the beginning to rise and capture Baghdad. Turks helped Al-Mu'tasim to gained power in 833 by providing mercenaries.

What is the value of hatred?

Answers

Answer:

well...its a emotion we have when things get on our nevers or when  were jus done with wuts going on with our livess so hate is a way at getting back at people by being angry and jus hating them

i dont value hatred but its a way for some to get there emotions out :0

Explanation:

hope that helps

Answer:

It is a preservation of the self. It is also an emotion hatred is a relatively stable feeling of intense dislike for another person.

HOPE THIS HELPS. If you have any questions comment down below.

What was alexander hamilton’s position in george washington’s cabinet?.

Answers

Secretary of the treasury

Answer:

secretary of the treasury

Explanation:

brainliest please!

hope this helps

Other Questions
Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain.