Answer:
the product of photosynthesis is starch(sugar) and oxygen.
Describe the steps a plant would take to move sugars from a source to a sink.
Explain the differences between Bacteria and Decomposers?
Answer: Decomposers like bacteria and fungi don't eat their food, they decompose it externally. Also, decomposers consume nutrients on a molecular level while detritivores eat large amount of decaying material and excrete nutrients. ... In addition to fungi, bacteria are also decomposer organisms. brainliest
Explanation:
If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False
I need help ASAP!!
A.D
B.B
C.C
D.A
Answer:
a ibecause tifmsndtbeekodfhekekn
The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland
Answer:
The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.
The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.
What do you mean by Endocrine Gland?An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.
The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.
For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.
Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.
To learn more about Endocrine glands, refer to the link:
https://brainly.com/question/4455660
#SPJ2
Select the statement(s) that is accurate about the immune system.
What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%
Answer:
90%
Explanation:
How do invasive species usually affect the availability of natural resources in an ecosystem?
PLEASE HELP ME
Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.
Explanation:
Please help, A, B,C, or D?
Answer:
I cant see the pic??
Explanation:
Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle
Answer:
inner core
Explanation:
I looked it up
what does the tilde symbol mean in biology
Answer:
means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".
50 POINTS !!!!A credit union is a business that is owned by people who have something in common, offers you a place to keep your money, and uses your funds to make more money. A. True B. False
Answer:
true
Explanation:
Hope this helps
Answer:
The anser is FALSE
Explanation:
I just took the test and it was FALSE
Question 2 (1 point)
Which two vocabulary words are synonyms (meaning similar things)?
a
revolution
b
orbit
c
latitude
rotation
Answer:orbit and rotation
Explanation:
The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it
Answer:
A) make new cells(somatic cells)and only germ-line cells do it(meiosis)
Explanation:
Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.
While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.
Meiosis produces germ cells while mitosis produces somatic cells.
Laying eggs belong to which category of energy use? Maintenance, waste production, movement, growth and reproduction
Answer: it is reproduction
Explanation:
Select the correct answer.
Which type of galaxy is the Milky Way?
A.
elliptical
✓ B.
spiral
C.
irregular
D.
lenticular
Next
Help ASAP, please
Thank you, Friends:)
Which factor listed below is abiotic? Bacteria, water, fungi, protists
Answer:water
Explanation:
Answer:
Water
Explanation:
Water does not contain cells, therefore it is non-living.
If the base sequence of a strand of DNA is ATGGGCCTA, what would be the base sequence of the complimentary DNA strand?
Answer:
TACCCGGAT
Explanation:
Adenine(A) always base pairs with Thymine(T) (except in the case of RNA, in which case A would base pair Uracil(U).
Cytosine(C) always base pairs with Guanine(G).
What is the major distinction scientists use to divide the animal kingdom?
Answer:
Whether the animal has a vertebral column or not.
Help stepbro im stuck in the washer
Answer:
I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT
how does a liver cell respond to insulin
Answer:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
Explanation:
Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.
The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species
Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA
Answer:
The correct answer is -
a single strand with a distinctive cloverleaf structure, and
tRNA
Explanation:
The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.
Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.
Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks
Answer:
Bacteria
Explanation:
Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.
Sunlight, rocks, and soil are all non-living.
The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.
They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.
Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.
Learn more about soil at:
https://brainly.com/question/31227835
#SPJ6
Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids
Answer:
The correct answer is - proteins.
Explanation:
All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.
Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.
how is zero, oxidation numbers, and noble gases related
Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.
hope this helps
What can be concluded from the graph?
The layers of Earth have different densities.
O P and S waves are absorbed in the core.
The layers of Earth do not have distinct boundaries.
O Pand S waves always originate in the mantle and travel through the core.
Answer:
Explanation: second option
explain why the concentration of FSH in the blood increases after day 1
Answer:
As the levels of FSH and LH in the blood increase with puberty, the eggs begin to mature and a collection of fluid — the follicle — begins to develop around each one. The first day of menses is identified as cycle day one. Estrogen is at a low point. ... This increase in estrogen begins to inhibit the secretion of FSH.
Explanation:
"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"
Answer:
b is the answer my friend. hope this will solve your problem. mark me as brainliest