Two brothers, Leo and William, are racing their bikes around
a 9.5-mile loop. Since Leo is younger, he is given a 1.5-mile
head start. The graph to the right shows Leo's progress.
The expression 19x can be used to determine y, the distance
in miles that William has traveled after x hours have passed.
Which statement about this situation is not true?

A. William is traveling at a faster speed than Leo.

B. The difference between their speeds is exactly
1.5 miles per hour.

C. Leo traveled only 8 miles during the race.

D. Both brothers will finish the race in 1/2 hour.

Answers

Answer 1

The incorrect answer is b) The difference between their speeds is exactly 1.5 miles per hour.

What is distance?

The distance between two sites is the length of the route. The metre is the SI unit for distance.

What is speed?

The speed at which an object’s location changes in any direction. The distance travelled divided by the time it took to travel that distance is how fast something is moving.

What is time?

The amount of time that something happens, goes through a process, or remains the same.

Let distance be Y and time be X.

Distance (Y) travelled by William after X hours;

Y= 19X

Speed of Leo = [tex]\frac{distance}{time}[/tex]

= [tex]\frac{8}{0.5}[/tex]= 16 m/hr

Difference in speed= 19-16= 3m/hr

To know more about distance time formula:

https://brainly.com/question/28504831

#SPJ1


Related Questions

Remember, jed's height is within 3 inches of pablo's height. Describe the solutions in words. Jed can be 67 inches or shorter. At least 67 inches, but at most 73 inches. 73 inches or taller. 67 inches or shorter, or 73 inches or taller.

Answers

at least 67 inches, but at most 73 inches if  Jed can be 67 inches or

shorter

The  inequality in which involves one or more rational expressions is Rational inequality.

What is inequality?

Using the terms greater than, larger than or equal to, less than, or less than or equal to as a declaration of the order connection between two integers or algebraic expressions is known as inequality. Economic inequality comes in many forms, most notably wealth inequality measured by the distribution of wealth and income inequality measured by the distribution of income (the amount of money people are paid) (the amount of wealth people own). There are significant forms of economic inequality amongst various groups of people in addition to economic disparity between nations or states.

An inequality with a rational expression is said to be rational. Inequalities with rational expressions, such as 32x>1, 2xx34, 2x3x6x, and 142x23x, are referred to as rational inequalities.

67 ≤ x ≤ 73 are the solutions to the absolute value inequality |x − 70| ≤ 3

the complete question is

What are the solutions to the absolute value inequality |x − 70| ≤ 3? Remember, the inequality can be written as −3 ≤ x − 70 ≤ 3 or as x − 70 ≤ 3 and x − 70 ≥ −3.

Answer: 67 ≤ x ≤ 73

Remember, Jed's height is within 3 inches of Pablo's height.

Describe the solutions in words.

Jed can be

67 inches or shorter.

at least 67 inches, but at most 73 inches.

73 inches or taller.

67 inches or shorter, or 73 inches or taller.

Just found out it's the 2nd choice.

learn more about of inches here

https://brainly.com/question/16033250

#SPJ4

Answer:

B: at least 67 inches, but at most 73 inches.

Step-by-step explanation:

please help me with the ratio

Answers

Answer:

total number of votes = 5696

Step-by-step explanation:

the 5 part of the ratio relates to 3560 no votes , then

3560 ÷ 5 = 712 ← value of 1 part of the ratio , then

3 × 712 = 2136 ← number of yes votes

total number of votes = yes + no = 2136 + 3560 = 5696

How do you solve a mean table?

Answers

Mean from a frequency table is when we find the mean average from a data set which has been organised into a frequency table.

To calculate the mean we find the total of the values and divide the total by the number of values. The number of values is the total frequency.  This can be abbreviated to nn.

[tex]Mean = \frac{total}{number of values} =\frac{total}{n}[/tex]

We can use an extra column to help.

Mean is a measure of central tendency, it is a value that can be used to represent a set of data.  

E.g. The frequency table shows the number of people living in 1616 flats.

There are 55 flats with 11 person living there, so we work out 1\times5=51×5=5

There are 66 flats with 22 people living there, so we work out 2\times6=122×6=12

There are 33 flats with 33 people living there, so we work out 3\times3=93×3=9

There are 22 flats with 44 people living there, so we work out 2\times4=82×4=8

The number of values (n)(n) is the total frequency, here n=16n=16

mean = total/n

         =34/16

         = 2.125

To know more about mean class visit brainly.com/question/28786394

#SPJ4

What is a slope grade 11?

Answers

In grade 11 math, the slope is a concept that is typically introduced in the study of linear equations and graphing.

The slope of a line serves as a gauge for its steepness. It is defined as the change in y (the vertical distance) divided by the change in x (the horizontal distance) between two points on the line.

A line's slope might be zero, positive, negative, or undefinable. A line with a positive slope rises as it goes from left to right, while a line with a negative slope falls as it goes from left to right. A line with a slope of zero is horizontal, while a line with an undefined slope is vertical.

The slope is often represented by the letter m in the equation of a line, which is written in the form y = mx + b. The slope of the line is the coefficient of the x term (the m in the equation).

For example, the slope of the line represented by the equation y = 3x + 4 is 3, while the slope of the line represented by the equation y = -2x + 1 is -2.

To learn more about slope, refer:-

https://brainly.com/question/16941905

#SPJ4

determine whether an observational or experimental study is appropriate to address the following statement. a car wash operator wants to find out if providing a discount for local residents will generate additional revenue.

Answers

The statement is "a car wash operator wants to see if offering a discount to local residents would create a greater income." This is an observational study.

What is observational or experimental study?

A method of study in which participants are observed or certain outcomes are measured. There is no attempt made to change the outcome (for example, no treatment is given).

Experimental investigations include introducing an intervention and observing its results. Experimental investigations are frequently randomized, which means that the individuals are assigned to groups at random. People who qualify are randomly allocated to one of two or more groups in a randomized controlled experiment (RCT).

Cohort studies, case-control studies, and cross-sectional studies are the three different kinds of observational research.

In an observational study, the researchers just observe the participants without interfering with them or attempting to sway the results. In other words, neither the researchers nor the individuals are placed in experimental groups or in charge of the therapies.

Thus, the above mentioned statement is an observational study.

To know more about observational study refer to:

https://brainly.com/question/14393640

#SPJ4

What are the 2 types of roots and their functions?

Answers

Real roots and distinct roots are the two types of roots of quadratic function.

Given,

Real roots;-

We are aware that anytime we resolve a linear or quadratic equation, we obtain the equation's value variable, or in other words, we identify the equation's solution. We refer to this "solution" as the real roots. For instance, when we solve the equation x27x+12=0, the real roots come out to be 3 and 4.

Distinct roots;-

Whenever the answers to a quadratic equation have two distinct values that may be represented by real numbers on a number line. It is known as distinct roots.

Here,

How do you tell which roots are distinct and real?

The discriminant is the expression b² - 4ac for the quadratic equation ax² + bx + c = 0. The discriminant's value reveals how many roots f(x) has: - The quadratic function has two unique real roots if b² - 4ac > 0, otherwise it does not. The quadratic function has one repeating real root if b² - 4ac = 0.

That is,

The quadratic function has real roots and distinct roots.

Learn more about types of roots here;

https://brainly.com/question/11697358

#SPJ4

which rule must be used to find the number of strings of four decimal digits that have exactly three digits that are 9s?

Answers

The product rule must be used to find the number of strings of four decimal digits, that have exactly three digits that are 9s.

What is product rule ?

The Product Rule says that the derivative of a product of two functions is the first function times the derivative of the second function plus the second function times the derivative of the first function.

To obtain the number of strings of 4 decimal digits that have exactly 3 digits that are 9s ; we use the product rule,

In first digit 1 possible way between 0 to 9

In second digit 1 possible way between 0 to 9

In third digit 1 possible way between 0 to 9

In fourth digit 9 possible ways between 0 to 9

That's mean 1 * 1* 1* 9* 4 = 36

Thus 36 possible ways.

The product rule must be used to find the number of strings of four decimal digits.

To learn more about product rule visit:

brainly.com/question/29198114

#SPJ4

5+2 x 3². for this question I have put 16 but apparently it’s incorrect

Answers

Answer:

23

Step-by-step explanation:

Given in the picture below (BODMAS rule is applied)

I hope my answer helps you

Answer:

23

Step-by-step explanation:

5 + 2 x 3² =                         (remember PEMDAS)

5 + 2 x 9 =

5 + 18 =

23

• Question 2
In the graph of an inequality, the region below the dashed horizor
What inequality does the graph represent?

Answers

The linear inequality represented by the graph is given as follows:

y < 1/4x + 2.

How to define the inequality?

The dashed line is a linear function, hence the slope-intercept format of the inequality is given as follows:

y < mx + b.

(the sign is < because the line is dashed and not solid).

In which the coefficients are given as follows:

m is the slope, representing the rate of change of the linear function.b is the y-intercept, representing the value of y when the graph of the linear function crosses the y-axis.

The line crosses the y-axis at y = 2, hence the intercept b is given as follows:

b = 2.

When x = -8, y = 0, thus when x increases by 8, y increases by 2, meaning that the slope is given as follows:

m = 2/8

m = 1/4.

Thus the inequality is given as follows:

y < 1/4x + 2.

Missing Information

The graph of the linear inequality is given by the image shown at the end of the answer.

More can be learned about linear inequalities at https://brainly.com/question/24170593

#SPJ1

How many solutions has the linear equation 3x 2y 5?

Answers

In this given equation, any value of x and y will work, which will cause it to have infinite number solutions

What is an equation?

An equation is a mathematical statement showing that two or more values or mathematical expressions are equal or equivalent.

We represent an equation with the equation symbol (=).

Given the equation:

3x + 2y = 5

The lineear equation has infinitely many solutions

We know the standard form of a linear equation is:

ax + by = C

In this given equation, any value of x and y will work, which will cause it to have infinite number solutions

learn more about of equation here

https://brainly.com/question/29130263

#SPJ4

For what value of A is x 5 a factor of x³ 3x² ax 10?

Answers

The value of a is ( x - 5 ) factor of f (x) = x ³ - 3x²  + ax -10 is found to be 8 .

What is a factor of an equation ?

A factor is a number that divides another number, leaving no remainder. In other words, if multiplying two whole numbers gives us a product, then the numbers we are multiplying are factors of the product because they are divisible by the product.

There are two methods of finding factors: multiplication and division. In addition, rules of divisibility may also be used.

Let f (x) = x ³ - 3x²  + ax -10 be the given polynomial.

By factor theorem,  ( x - 5 ) is the factor of f (x) , if f ( 5 ) = 0

Therefore,

f ( 5 ) = 3 ( 5 )²  + a ( 5 ) - 10 = 0

           125 - 75 + 5a - 10 = 0

            5a = -40

            a = -8

Hence, a = -8

Learn more about factors of an equation here ;

https://brainly.com/question/3423184

#SPJ4

How many terms are in the binomial expression 2x 3 5?

Answers

A binomial expression is of the form (x + y)ⁿ. The given binomial expression (2x + 3)⁵ has 6 terms in it.

Binomial is said to be the algebraic expression containing exactly two terms.

Examples of binomials are 4x² + 5y², xy² + xy, x + y, x² + 3, etc.

The number of terms in the binomial expression (x + y)ⁿ is given as,

Number of terms = n + 1

where, n is the power of ( x + y )

In the above given binomial expression, (2x + 3)⁵, n = 5.

N = n + 1 = 5 + 1 = 6

Thus, there are a total of 6 terms in the above expansion.

To know more about binomials:

https://brainly.com/question/29104243

#SPJ4

shawna reads a study about exercise that includes the following scatterplot. which answer choice correctly indicates the explanatory variable and the response variable? a.) explanatory variable: exercise response variable: calories burned per minute b.) explanatory variable: weight response variable: exercise c.) explanatory variable: weight response variable: calories burned per minute d.) explanatory variable: calories burned per minute response variable: weight

Answers

Shawna finds The correct answer as "explanatory variable: weight response variable: calories burned per minute."

In this scatterplot, the explanatory variable is the weight of the individuals and the response variable is the number of calories burned per minute. The explanatory variable is the variable that is being manipulated or tested in the study, while the response variable is the variable that is being measured or observed.

In this case, the study is examining the relationship between weight and calories burned per minute, with weight being the explanatory variable and calories burned per minute being the response variable. The other answer choices do not correctly identify the explanatory and response variables in the scatterplot.

Learn more about Scatterplots here:

https://brainly.com/question/6592115

#SPJ4

Find the height of a standard yield sign when the area is 558 square inches and each side is 36 inches.

Answers

The height of the yield sign is 15.5 inches.

The total amount of space allotted to a triangle's three sides in a two-dimensional plane is known as the area of a triangle. The fundamental formula for a triangle's area is A = [tex]\frac{1}{2}*b*h[/tex], which states that the area of a triangle is equal to half the product of its base and height.

To find the height of the yield sign, we need to use the following formula, which is:

area= length*height

The result of substituting in the data we are aware of is:

558=36*h

h= [tex]\frac{558}{36}[/tex]

h= 15.5

Therefore the height of a standard yield sign when the area is 558 square inches and each side is 36 inches is 15.5 inches.

To learn more about height, refer;-

https://brainly.com/question/10726356

#SPJ4

Identify the number fo zeros for each function. Show your work.

1. P(x)=x³+2x²-12x+1
2.P(x)=2x⁵-5x+10
3.P(x)=3x⁴+2x

Answers

The number of zeros for each function is given as follows:

1. Three zeros.

2. One zero.

3. Two zeros.

How to obtain the number of zeros for each function?

The number of zeros for each function is obtained looking at the graph of the function, counting the number of times that the function either touches or crosses the x-axis, which is the horizontal axis.

Thus the graph for each function is plotted, using a graphing calculator, as shown by the image at the end of the answer, and the number of zeros for each of the functions is given by the number of times that the function touches or crosses the x-axis.

The colors of each function are given as follows:

1. Red.2. Blue.3. Green.

More can be learned about the number of zeros of a function at https://brainly.com/question/20901045

#SPJ1

The graph of y = is translated. The translation is defined by (x + 1, y – 2).

Which is the graph of the translated image?
A B C D

Answers

Answer:

we know that

The rule of the translation is

That means

The translation is  units to the right and   units down

therefore

the answer in the attached figure

Step-by-step explanation:

What are the 4 steps of the 4 step method?

Answers

The steps of the  step method are:

1. Analyze the situation: Identify the problem and its causes.2. Plan: Develop a plan of action to address the problem.3. Execute: Implement the plan.4. Evaluate: Monitor and measure the results of the plan.

The Benefits of Using the 4-Step Method to Solve Problems

Problem solving is an essential skill in life. It helps us to find solutions to difficult situations and can be applied to almost any area of life. One effective way to approach problem solving is to use the 4-step method. This method is designed to help you analyze a situation, plan an action, execute the plan, and evaluate the results. In this essay, we will discuss the benefits of using the 4-step method to solve problems.

The first step of the 4-step method is to analyze the situation. This involves identifying the problem and its causes. Taking the time to understand the problem before attempting to solve it can help ensure that the solution is effective. By analyzing the situation, you can determine the most effective solution and avoid wasting time and resources on ineffective solutions.

The second step of the 4-step method is to plan an action. This involves developing a plan of action to address the problem. Taking the time to plan ahead can help ensure that the solution is tailored to the specific situation. It can also help to minimize the risk of unexpected problems or delays during the execution of the plan.

Learn more about the 4 step method:

https://brainly.com/question/17969966

#SPJ4

What are the 3 types of solutions when graphing a system of equations?

Answers

Answer:

infinite, no solutions, and uniquely solution

Step-by-step explanation:

What is the 4 type of polynomial?

Answers

Answer:

Binomial,Trinomial,Monomal,Linear equation

Step-by-step explanation:

At 11:45 AM. Jason glanced at the clock. His doctor's appointment was in 2 1/2hours. At what time was his appointment? please help me​

Answers

Answer:

14: 15 or 2: 15 pm

Step-by-step explanation:

1/2 times 60 = 30 minutes

2 1/2 hours = 2 hours and 30 minutes

Take

11:45

+ 2:30

13:75

1 hour only has 60 minutes, so 13:75 = 14:15 or 2:15 pm

So, his appointment was at 2:15 pm

How do you find the value of X step by step?

Answers

Bring the variable to the left side and bring all the remaining values to the right side. Simplify the values to find the result.

Now, According to the question:

The algebraic expression should be any one of the forms such as addition, subtraction, multiplication and division. To find the value of x, bring the variable to the left side and bring all the remaining values to the right side. Simplify the values to find the result.

Standard Equation

The standard form to find the value of X in multiplication operation is

Multiplicand × Multiplier = Product

Let us take Multiplier as x,

Multiplicand × x = Product

Then the formula to find the value of x is

X = product / Multiplicand

Example of how to find the value of x.

Find the value of x for the given expression: 10x = 50

Given: 10x = 50

X = 50/10

X = 5

Therefore, the value of x is 5.

Learn more about Value of x at:

https://brainly.com/question/9916945

#SPJ4

Is AAA a similarity theorem?

Answers

It is a AAA similarity theorem If and only if the corresponding sides of two triangles are in proportion, they will have identical corresponding angles.

What is the AAA similarity theorem?

According to the fundamental theorem of similarity, a line segment can divide two triangle sides into proportionate segments if and only if it is parallel to the third side of the triangle.

Theorem: Two triangles have identical corresponding angles if and only if their corresponding sides are proportionate.

It can also be rephrased as the AAA (angle-angle-angle) similarity theorem.

A triangle is said to be comparable to another triangle if any two of its three angles are equal to any two of its three angles.

Therefore, it is a AAA similarity theorem If and only if the corresponding sides of two triangles are in proportion, they will have identical corresponding angles.

Know more about the AAA similarity theorem here:

https://brainly.com/question/29788013

#SPJ4

How do you find the square root of a number without a calculator?

Answers

Without using a calculator, the square root of an integer is

1. Use multiplication to calculate the ideal square root.

2. Use division to calculate the ideal square root.

3. Use nearest perfect square number to find the square root of non-perfect squared numbers.

Given that,

We need to figure out how to calculate a number's square root without a calculator.

We know that,

There are some ways to find

First

Use multiplication to calculate the ideal square root.

A number that, when multiplied by itself, equals the first number is the number's square root.

3 is therefore the square root of 9.

Because 3 multiply by 3 is 9

That is 3×3=9

√9=3

Second

To calculate the square root, we use division.

A whole number can also be divided by a number until you get an answer that is the same as the number you used to divide the whole number in order to determine its square root.

For instance: Four is the square root of sixteen.

Because 16 divided by 4 is 4

That is 16÷4=4

√16=4

Third

We must compare the number with a nearly perfect squared number in order to determine the square root of non-perfect squared numbers.

For example: the square root of 63 is not a perfect square.

So,

The closest perfect square integer right now is 64, and its square root value is 8.

So, we can say the square root of 63 as 7.98.

To learn more about square visit: https://brainly.com/question/29286039

#SPJ4

Hana i planning a park day for the next month to give her friend ome exercie! The local park open it path for biker every 12 day and open it’ lake for paddling every 8 day. Today, both the biking and paddling option are open. Which two number entence will help Hana pick the next date where both the bike lane and lake padding will be open?

Answers

If a local park is open for biking every 12 day open for paddling every 8 day and if today the park is open for both options, then the next date when the park will be open will be on the 24th day. So Hana should pick 24th day from today next.

Every 12 day the local park is open its path for biking and every 8 day they open their lake or paddling. That is in every multiple of 12 days the biking option is available and every multiple of 8 days the paddling option is available.

If today both the biking and paddling option are open, then the next day where both options will be open can be determined by calculating the least common multiple of 12 and 8.

12 = 2×2×3

8 = 2×2×2

LCM (12, 8) = 2×2×2×3

LCM(12, 8) = 24

LCM of 12 and 8 is 24. So 24 days from today, the park will be open for both options.

To know more on LCM

https://brainly.com/question/20739723

#SPJ4

How do I solve this?

Given h(x)=3x-5,find h(3)

Answers

Multiple 3•3
9-5

Answer 4

Answer:

4 is correct

Step-by-step explanation:

The ratio in the table for ditance covered in meter to time taken in hour i contant. Let d = ditance covered in 15 hr. Let t = time taken to cover 8 m. Which table how the correct value for t and d? A. B. C. D

Answers

The table that shows the correct t and d values is

Distance Covered (m)           Time Taken (hr)

8                                               6

32                                              15

How to determine the correct values for t and d

The table of values is given as:

Distance Covered (m)           Time Taken (hr)

8                                               6

16                                              12

32                                              15

48                                              18

The distance covered in 15 hours is 32 m and the time taken to cover 8 m is 6 hours

When these values are extracted, we have:

Distance Covered (m)           Time Taken (hr)

8                                               6

32                                              15

The above represents the table that shows the correct t and d values

Read more about distance and time at:

brainly.com/question/13877898

#SPJ4

How to find the height of a pyramid using Pythagorean Theorem?

Answers

The Pythagorean Theorem states that because a pyramid's height, slant height, and apothem form a right triangle with slant height as its longest side:  (apothem)² + (height)² = (slant height)².

Define the term pyramid?

A pyramid is a three shape having a base that is a polygon and triangular sides that come together at the apex, which is located directly just above center of the base.

The distance here between center of the base as well as the apex of a pyramid is its height. The distance between the apex and one of the base's sides is its slant height. The distance between both the center of the base and one of the base's sides is its apothem.

Let's start by taking a look at a pyramid with both the height, slant height, the apothem shown in order to demonstrate how to use the Pythagorean Theorem to get a pyramid's height.

a² + b² = c².

To know more about the pyramid, here

https://brainly.com/question/218706

#SPJ4

Can you use SSA to prove a triangle is congruent?

Answers

Yes, you can use the Side-Side-Angle (SSA) Congruence Theorem to prove that two triangles are congruent.

The SSA Congruence Theorem states that if two sides of one triangle have the same length as two sides of another triangle, and the included angle in the first triangle is congruent to the included angle in the second triangle, then the two triangles are congruent.

Here is an example of how you can use the SSA Congruence Theorem to prove that two triangles are congruent:

Let's say you have two triangles, triangle ABC and triangle DEF. You are given that the length of side AB is equal to the length of side DE, the length of side AC is equal to the length of side DF, and angle A is congruent to angle D.

To prove that triangle ABC is congruent to triangle DEF, you would need to show that all of the corresponding parts of the triangles are congruent. Since the lengths of two sides (AB and DE) and the included angle (angle A and angle D) are congruent, you can use the SSA Congruence Theorem to conclude that triangle ABC is congruent to triangle DEF.

It's worth noting that the SSA Congruence Theorem is not always sufficient to prove that two triangles are congruent. If the conditions of the theorem are not met, you may need to use other methods, such as the ASA Congruence Theorem or the HL Congruence Theorem, to prove congruence.

To know more about SSA Congruence visit :

https://brainly.com/question/4100108?referrer=searchResults

#SPJ4

pls help me im begging you i need a B in this class

Answers

g(x)=-x^2 is the reflection of your function f(x) over the x-axis.

What is function?

The function f(x)=x2 is a parabola facing upward with its vertex at (0,0), and including the points (1,1), (2,4), (-1,1), and (-2,4).

A function that is a reflection across the x-axis compared to f(x) would be the mirror image of f(x). It would have the opposite y-values for each x-value. It would also have its vertex at the same place as f(x).

Therefore, it would be a parabola pointing downward, with the points (1, -1), (2,-4), (-1,-1), and (-2,-4).

To get the opposite values for y, you simply need to place a negative in front of the x2. So the function would be g(x) = - x2.

To learn more about function visit:https://brainly.com/question/5975436

#SPJ1

how many permutations of abcde are there in which the first character is abc and the last character is cde

Answers

Total number of permutations of abcde in which the first character is a, b, or c and the last character is c, d, or e is 48 permutations.

Case 1 : First letter is "a", last letter is any of {c, d, e}. Hence there are 3!  ways of arranging the remaining three letters

3! * 3 = 18 combinations.

Case 2 : First letter is "b", last letter is any of {c, d, e}. Hence there are 3!  ways of arranging the remaining three letters

3! * 3 = 18 combinations.

Case 3 : First letter is "c", last letter is any of {d, e}. Hence there are 3! ways of arranging the remaining two letters

3! * 2 = 12 combinations.

Hence, total number of combinations = 18 +18 + 12 = 48 permutations.

To know more about permutation questions:

brainly.com/question/11989732

#SPJ4

Other Questions
Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by?