The strings in a compound bow behave approximately like a
spring. A bowstring is pulled back 0.60 m with a maximum force of
267 N (AKA a 60-pound draw weight) to shoot an 18 g arrow.
Assume energy is conserved.
a) At what speed would the arrow be launched? (Note: W = FΔd uses the average
force while F = -kx uses the instantaneous force.)

Answers

Answer 1

The speed at which the arrow would be launched is 133.42 m/s

The work-energy theorem asserts that the net work done applied by the forces on a particular object is equivalent to the change in its kinetic energy.

The equation for the work-energy theorem can be computed as:

[tex]\mathbf{W =\Delta K.E}[/tex]

[tex]\mathbf{F\Delta x =\dfrac{1}{2} mv^2}[/tex]

where;

Force (F) = 267 Ndistance Δx = 0.60 mmass (m) = 18 gspeed (v) = ???

From the above equation, let make speed(v) the subject of the formula:

[tex]\mathbf{v = \sqrt{\dfrac{2(F \Delta x)}{m}} }[/tex]

[tex]\mathbf{v = \sqrt{\dfrac{2(267 \times 0.60)}{0.018}} }[/tex]

v = 133.42 m/s

Learn more about the work-energy theorem here:

https://brainly.com/question/17081653


Related Questions

which is the correct relationship among pressure, flow, and resistance?

Answers

Answer:

Flow is proportional to change in pressure and inversely proportional to resistance.

Please help is any one know Its correct answer ​

Answers

Answer:

a=Head

b=Tip

c=South pole of the magnet

d=North pole of the magnet

the smallest division value of electronic balance​

Answers

Answer:

0.1g to 0.0000001g hope it helps uu

what are the electrical signals generated by neurons called?

Answers

Answer:

electrons

Explanation:

because it electrons

What type of bond is found in pure gold?
A) Metallic
B) Ionic
C)Covalent
D)Diatomic

Answers

Pure gold is a metallic bond as well as silver, iron and platinum

The type of bond found in pure gold is metallic bonding, indicated by metallic bonds. Therefore option A is correct.

Metallic bonding occurs between metal atoms, such as gold, and is characterized by the sharing of electrons among a sea of delocalized electrons.

In metallic bonds, the valence electrons of metal atoms are not strongly bound to any particular atom but are free to move throughout the metal lattice.

This sharing of electrons gives rise to properties such as high electrical and thermal conductivity, malleability, and ductility, which are characteristic of metals like gold.

Unlike ionic or covalent bonds, metallic bonds do not involve the transfer or sharing of electrons between different elements.

Know more about metallic bonding:

https://brainly.com/question/29762857

#SPJ6

An object is projected into the air with a vertical velocity of 20 feet per second. At what times will the object be on the ground

Answers

Answer:

20 ft/sec / 32 ft/sec^2 = .625     to reach top

2 * .625 = 1.25

It will be on the ground at t = 0 and t = 1.25

You can also solve the equation:

H = 0 = V0 t - 1/2 g t^2

Obviously, at t=0 h = 0

V0 = 1/2 g t    is a solution

t = 20 * 2 / 32 = 1.25 sec

why does rhododendron not grow well in the terai region of nepal give reason

Answers

Answer:

Tge Rhododendrob is the national flower of Nepal. The hills and mountain sides ranges of Nepal are decorated with diff colours and shapes

The weak nuclear force causes:
(A). Lightning
(B). Combustion
(C). Radiation
D). Protons and neutrons to form the nuclear of atoms

Answers

Answer:

(C) Radiation

Explanation:

The weak nuclear forces causes radiation to form.

How does the force of gravity affect the rate of acceleration?

Answers

Gravity causes all objects to accelerate toward Earth at a rate of 9.8 m/s/s. Air resistance slows the acceleration of falling objects. An object falls at its terminal velocity when the upward force of air resistance equals the downward force of gravity.
Well technically because gravity is when an item falls on the ground the velocity actually increases. By which gravity causes all the objects to accelerate towards earth at a rate of 9.8m/s/s

what are the three elements that can be used to make a magnet?

Answers

Answer:

Iron, cobalt, and nickel are the only three naturally occurring elements that are magnetic. 

Explanation:

hope it helps

correct me if I'm wrong thank you

brainliest please

Answer:

The three elements that can be used to make a magnet are :

Aluminum, nickel and cobalt

What does the risk of biological harm from radiation depend on?

Answers

Answer:

The effects of radiation depend on the type, energy, and location of the radiation source, and the length of exposure.

Which design of the walls would be most desirable help avoid echoes?
A
They should use bumpy walls for all four sides.
B
They should use bumpy walls for only one side.
С
They should use smooth walls for all four sides.
D
They should use smooth walls for only one side.

Answers

Answer:

a

Explanation:

because the sound wont bounce off

the gravitational force acts on all objects in proportion to their mass. neglecting air resistance, why don’t heavy objects fall faster than light ones?

Answers

Answer:

Because in correspondence to the same distance from a mass, the gravitational acceleration is the same for all the bodies. It doesn't depend on the mass of the objects.

calculate the resultant force acting on the object and state its direction

Answers

[tex]\\ \sf\Rrightarrow F_{net}=F_1+F_2+F_3+F_4[/tex]

[tex]\\ \sf\Rrightarrow F_{net}=20N+20N+10N-10N[/tex]

[tex]\\ \sf\Rrightarrow F_{net}=40N[/tex]

Direction is east.

Assume ideal behavior. How many moles of are needed to fill a 2000L weather balloon at 210K and 1atm pressure? Round your answer to the nearest mole (use R = 0.082057 L atm mol-1K-1)

Answers

Considering the ideal gas law, 116.06 moles of are needed to fill a 2000 L weather balloon at 210 K and 1 atm pressure.

An ideal gas is a theoretical gas that is considered to be composed of randomly moving point particles that do not interact with each other. Gases in general are ideal when they are at high temperatures and low pressures.

The pressure, P, the temperature, T, and the volume, V, of an ideal gas, are related by a simple formula called the ideal gas law:  

P×V = n×R×T

where P is the gas pressure, V is the volume that occupies, T is its temperature, R is the ideal gas constant, and n is the number of moles of the gas. The universal constant of ideal gases R has the same value for all gaseous substances.

In this case, you know:

P= 1 atmV=2000 Ln= ?R= 0.082057 [tex]\frac{atmL}{molK}[/tex]T= 210 K

Replacing in the ideal gas law:

1 atm× 2000 L = n× 0.082057 [tex]\frac{atmL}{molK}[/tex]× 210 K

Solving:

[tex]n=\frac{1 atmx 2000 L}{0.082057 \frac{atmL}{molK}x 210 K}[/tex]

n=116.06 moles

Finally, 116.06 moles of are needed to fill a 2000 L weather balloon at 210 K and 1 atm pressure.

Learn more about the ideal gas law:

https://brainly.com/question/4147359?referrer=searchResults

why does polishing the surface of a metal extend fatigue life

Answers

Answer:

they are machined with shape characteristics which maximize the fatigue life of a metal.

Explanation:

they are highly polished to provide the surface characteristics which enable the best fatigue life.

1. An 80 kg skydiver uses a parachute to produce an applied force of 700 N while falling with an initial
velocity of 40 m/s

Answers

Time taken by the skydiver to land on the ground is 4.57 seconds

The applied force, F = 700 N

The mass of the skydiver, m = 80 kg

The velocity, v = 40 m/s

To calculate the time taken by the skydiver to fall to the ground will be calculated using the formula

[tex]F=\frac{mv}{t}[/tex]

Substitute F = 700, m = 80, and v = 40 to solve for t

[tex]700=\frac{80(40)}{t}\\\\700t=3200\\\\t=\frac{3200}{700}\\\\t=4.57 s[/tex]

Time taken by the skydiver to land on the ground is 4.57 seconds

Learn more here: https://brainly.com/question/25898421

A cannonball explodes in mid-air, fragmenting into several pieces. How does the total
momentum of the pieces after the explosion compare to the total momentum of the
cannonball just before the explosion?
I. They are the same
II. The momentum of the fragments is less than the momentum of the cannonball
III. The momentum of the fragments is more than the momentum of the cannonball

Answers

Hi there!

I. They are the same.

Due to the Conservation of Momentum, an explosion as such means that the TOTAL momentum of the system (all of the pieces) is conserved.

Can someone help with 25 to 28 it’s multiple-choice!

Answers

Answer:

25:speed

26:acceleration

27:scalar

28:kinetic

when do magnets have the most potential energy

Answers

Answer:

Explanation:

Permanent magnets do have potential energy, stored in their magnetic field. That energy can be compared to the potential energy of some compressed spring. See the picture below, representing the magnetic field lines of a magnetized sphere : These lines are compressed inside the magnet.

Honestly I think it’s the pill

When Magnesium and Fluorine react what type of bond is formed
A) Metallic
B) Ionic
C) Covalent
D) Diatomic

Answers

Answer:

hi your answer should be B

Explanation:

Hope this helps!

Answer:

ionic

Explanation:

two metals that bond are considered ionic bonds

A 78 N block is supported by a spring whose constant is 12 N/m. Calculate the elongation of the spring under this load.

a. 6.5 m

b. 1.5 m

c. 8.2 m

d. 7.2 m

Answers

Answer:

a 6.5 m

Explanation:

[tex]f = kx = > x = \frac{f}{k} = \frac{78}{12} = 6.5 m[/tex]

How much work is done when mass of 3kg(weighing 30N)is lifted vertically through 6m?

Answers

Answer:

180 [J].

Explanation:

1) the required work [W] can be calculated as difference of the energy: W=E₂-E₁, where E₁=mgh₁ - the energy before lifting, E₂=mgh₂ - the energy after lifting;

2) W=mgh₂-mgh₁, where m - mass; g=10 [N/kg], h - height;

3) then the required work [W]:

W=mg*(h₂-h₁)=30*6=180 [J].

Anyone please help thank you

Answers

Answer:

A) earth

B) live

C) live

D) earth

Explanation:

hope i help

A concrete block (B-36 x10 °C-') of volume 100 mat 40°C is cooled to
-10°C. What is the change in volume? *
A. It will increase by 0.18 m
B. It will decrease by 0.18 m'
C.It will increase by 0.05 m
D. It will decrease by 0.05 mº

Answers

T1=40°C=313KT_2=-10°C=263K

Applying Charles law

[tex]\\ \sf\Rrightarrow \dfrac{V_1}{T_1}=\dfrac{V_2}{T_2}[/tex]

[tex]\\ \sf\Rrightarrow \dfrac{100}{313}=\dfrac{V_2}{263}[/tex]

[tex]\\ \sf\Rrightarrow V_2=\dfrac{26300}{313}[/tex]

[tex]\\ \sf\Rrightarrow V_2=84.02ml[/tex]

what is the prmary source of energy inside of the earth

Answers

The correct answer is the energy of the sun
The primary source would be the sun

How much energy has 4x 1010 m³ of water collected in a reservoir at a 2. 3. height of 100 m from the power house? What kind of energy is that? (Given, mass of 1 m³ of water = 1000 kg)​

Answers

Explanation:

[tex] \rule{999pt}{66646pt}[/tex]

Please HELP
6. A 3.4-kg bucket of water is attached to a 1.0-m rope. The bucket is swung in a circle at a speed
of 10.0-m/s.


a.
If the rope can only tolerate 400-N of force, what is the maximum speed the bucket can
experience before the rope snaps? {Hint: Let the centripetal force be 400-N and solve for the speed)

Answers

Answer:

Explanation:

hope this helps

The maximum speed of the bucket can experience before the rope snaps if A 3.4-kg bucket of water is attached to a 1.0-m rope. The bucket is swung in a circle at a speed of 10.0-m/s is 10.85 m / s.

What is force?

Force is the influence of either pull or pushes in the body. Basically, gravitation forces, nuclear forces, and friction forces are the types of forces. For e.g. when the wall is hit by a hand then a force is exerted by the hand on the wall as well as the wall also exerts a force on the hand. There are different laws given to Newton to understand force.

Newton is a unit of force used by physicists that is part of the International System (SI). The force required to move a body weighing one kilogram one meter per second is known as a newton.

Given:

The mass of the bucket, m = 3.4 kg,

The length of the rope, r = 1 m,

The speed of the bucket, v = 10 m / s,

The force of the rope, F = 400 N,

Calculate the maximum speed by the formula given below,

[tex]F_c = mv^2 / r[/tex]

400 = 3.4 v² / 1

v² = 400 / 3.4

v² = 117.6

v = 10.85 m / s

Therefore, the maximum speed of the bucket can experience before the rope snaps if A 3.4-kg bucket of water is attached to a 1.0-m rope. The bucket is swung in a circle at a speed of 10.0-m/s is 10.85 m / s.

To know more about Force:

https://brainly.com/question/13191643

#SPJ2

Resolve the weight of the box to find the component of the weight acting parallel to the slope.
W = 50N
30

Answers

Answer:

here's your answer below

Explanation:

sorry something went wrong

.

Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides?

Answers

Answer:

Below!

Explanation:

Referring to the picture, we can conclude that the picture J will have the most effect on ocean tides.

Whichever model is similar to model J in the picture will be your answer.

Hoped this helped.

Other Questions
Malik jogged 2 miles in 20 minutes.What was his rate in miles per hour?10 miles per hour6 miles per hour23 mile per hour110 mile per hour the smallest division value of electronic balance Astatine-218 has a half-life of 1.6 seconds. If you begin with a 1.7 g sample of astatine-218, how much of the sample remains after 3.2 seconds? explain different users of computer in briefly? Find the area of the cuboid. The valence electrons of a krypton (Kr) atom in the ground state are located in theA. first energy level (shell).B. second energy level (shell).C. third energy level (shell).D. fourth energy level (shell). Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology. (PHOTOGRAPHY) Rebecca is planning to take photographs on her trip to see the California redwoods. The California redwoods are very, very large trees. She wants to make sure that everyone who sees her photographs understand how giant the trees are. What might she do to help her audience see the scale of the redwoods?Group of answer choicesAsk her parents to park their car near the base of the tree so that it will be in the photograph, too.Take a closeup of the trees bark so viewers get a sense of the level of detail the tree has.Take a photo with more than one redwood tree in the frame.Position herself so that she captures the sky and clouds behind the redwood tree.PLEASE HELP ASAP