Starting from the sun, create a food chain including three organisms.

Answers

Answer 1

Answer:

sun ----> plant -----> bunny

Explanation:

the sun helps the plant grow, then the bunny eats the plant.

Answer 2

Answer:

Sun, Plankton, Herring

Explanation:

The sun Provides energy for the plankton to conduct photosynthises, which in turn allows for herring to eat the plankton


Related Questions

What type of mutation changes a single DNA nucleotide base, and causes a change in a specific codon?

Answers

Answer:

A base substitution mutation is the answer.

Explanation:

A base substitution mutation changes only a single nucleotide within a gene sequence, so only one codon is affected.

Which of the following characteristics are necessary for a fossil to be a good index fossil? (Choose all that apply)
had a broad geographic distribution
easy to identify at the species level
an invertebrate
short-lived

Answers

Answer:

A good index fossil is one with four characteristics: it is distinctive, widespread, abundant, and limited in geologic time. Because most fossil-bearing rocks formed in the ocean, the major index fossils are marine organisms.

Explanation:

Fossil to be a good index fossil are:-

Had a broad geographic distributionEasy to identify at the species levelAn invertebrateShort-lived

What is a fossil?Fossils are the preserved remains, or traces of remains, of ancient organisms. Fossils are not the remains of the organism.They are rocks. A fossil can preserve an entire organism or just part of one. Bones, shells, feathers, and leaves can all become fossils.

Hence, All the given option are correct.

To know more about fossils here

https://brainly.com/question/6867325

#SPJ2

1. Why is cell an open dynamic system?​

Answers

The exchange of matter or substances between the cell and its environment is dynamic as it varies in direction and rate as per the requirements of the cell. Thus,a cell attains a stead -state wherein the internal conditions of the cell remain constant. Hence, cell is considered to be a open dynamic system

An insulator the loss of heat energy.

slows down or speeds up

I WILL MARK YOU BRAINLYSS PLUS 40 POINTSSS

Answers

The heat slows down.

Answer: Slows down

Explanation: Insulation slows does the transfer of heat energy. think of it like this. a puffer jacket (more insulation) keeps you warmer longer than a t-shirt (less insulation).

:)

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Explain the the verse below in your own words.




Hebrews 11:7

Answers

Answer:

Faith, according to the Bible, is not blind. More than half of the verses in the book of Hebrews are dedicated to explaining reasons and evidence to accept the new covenant in Jesus Christ. Nor is faith gullible, or senseless. Instead, godly faith is exemplified by trust. That trust is based on what we know of God, relying on Him for the things we do not know. In particular, godly faith looks forward, from an eternal perspective, and produces obedience, even in the face of hardship. God takes what we cannot see, or cannot understand, and uses it to make good on His word. Since faith relies on what we've seen of God, and trusts Him for the future, it becomes the "assurance of things hoped for, the conviction of things not seen" (Hebrews 11:1–3).

Explanation:

I LOVE JESUS

CAN I HAVE A BRANLIEST PLZ

Faith, according to the Bible, is not blind. More than half of the verses in the book of Hebrews are dedicated to explaining reasons and evidence to accept the new covenant in Jesus Christ. Nor is faith gullible, or senseless. Instead, godly faith is exemplified by trust. That trust is based on what we know of God, relying on Him for the things we do not know. In particular, godly faith looks forward, from an eternal perspective, and produces obedience, even in the face of hardship. God takes what we cannot see, or cannot understand, and uses it to make good on His word. Since faith relies on what we've seen of God, and trusts Him for the future, it becomes the "assurance of things hoped for, the conviction of things not seen" (Hebrews 11:1–3).

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

Answers

a. the distribution of sand on an ocean floor
C. The speed at which a hummingbird flies

PLEASE HELP
How are the waste products of respiration removed?
(SELECT ALL THAT APPLY)

A) Food waste moves from the digestive system to the cardiovascular system.

B) Carbon dioxide is removed by respiratory organs.

C) The cardiovascular system transports waste products from cells to other systems.

D) Oxygen molecules are removed by the cardiovascular system.

Answers

[tex]{{\tt{==========================================}}}[/tex]

Question:

How are the waste products of respiration removed?

[tex]{{\tt{==========================================}}}[/tex]

Choices:

A) Food waste moves from the digestive system to the cardiovascular system.

B) Carbon dioxide is removed by respiratory organs.

C) The cardiovascular system transports waste products from cells to other systems.

D) Oxygen molecules are removed by the cardiovascular system.

[tex]{{\tt{==========================================}}}[/tex]

Answer:B) Carbon dioxide is removed by respiratory organs.

[tex]{{\tt{==========================================}}}[/tex]

Explanation:

The primary function of the respiratory system is to deliver oxygen to the cells of the body's tissues and remove carbon dioxide.

[tex]{{\tt{==========================================}}}[/tex]

[tex]\rm\small{CARRYONLEARNING}[/tex]

Waste products of respiration are removed when carbon dioxide is removed by respiratory organs.

What is respiration?

Respiration refers to the process by which living things undergo gaseous exchange with the environment. Respiration produces some wastes such as;

water vapor and carbon dioxide in animalsOxygen in plants

Hence, waste products of respiration are removed when carbon dioxide is removed by respiratory organs.

Learn more about respiration: https://brainly.com/question/1439976

Is fermentation as efficient as aerobic cellular respiration? Multiple choice question, yes or no?

Answers

Answer:

NO

EXPLANATION :

Aerobic cell respiration is roughly 18 times more efficient than anaerobic cell respiration. Your cells require a lot of energy and are dependent on the high efficiency of aerobic respiration. They quickly die if deprived of oxygen.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

Answers

Answer:

it is 736

Explanation:

me big brain

Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.

The effects of road salting on the environment

Road salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.

The types of salt used for road salting include:

rock salt,

salt brine,

winter sand,

a mix of sand and salt.

The impact of road salting on the environment include the following:

Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.

Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.

Learn more about aquatic ecosystems here:

https://brainly.com/question/1023703

muscle cell labelled diagram ​

Answers

Explanation:

Here is a diagram, let me know if this is what you needed.

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

Which describes a dominant allele?

A. It can be masked by the presence of a recessive allele
B. Its trait will always show up if it is present
C. It is the type of allele that makes a hybrid
D. It is the form of the gene that comes from the mother​

Answers

Answer:

B.

Explanation:

A dominant allele is an allele whose trait will always show up in an organism when the allele is present

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

Giving Away 50 points + brainy to first



Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____

Answers

Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a system.

The group of components of the Earth work together to make an environment we live in.

What are the different components of the Earth?

The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.

The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.

Learn more about Earth's component, here:

https://brainly.com/question/11250595

#SPJ5

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

Answers

False
Should be the right answer because we can see mutations in humans can kill some and do nothing to others

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3


In order for mutations to be passed to offspring in sexually reproducing organisms, the
mutation(s) must occur in sex cells. Why is this NOT true for bacteria like Staphylococcus?
Choose one or more:

Answers

Answer:

Bacteria can evolve quickly because they reproduce at a fast rate. Mutations in the DNA of bacteria can produce new characteristics and that the bacterium will grow better than its neighbors and can increase in numbers..

Explanation:

N/A

compare a frogs internal organs to a humans internal organs

Answers

Answer:

Answer is below

Explanation:

Frogs and humans share the same basic organs. Both have lungs, kidneys, a stomach, a heart, a brain, a liver, a spleen, a small intestine and a large intestine, a pancreas, a gall bladder, a urinary bladder and a ureter. ... On the whole, their organ structure is similar, but frogs have considerably less complex anatomies

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest

Answers

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

Why animals reproduce? A. To become many B. To become food C. To enjoy D. To grow​

Answers

Question:

Why animals reproduce?

Answer;

(A) To become many

why?

because if no animals in the world you will not enjoy of your childhood

that is my answer I hope it helps to you

Which of these is not an effect of antibodies?
A. Activating complement proteins
B. Neutralizing toxins
C. Tagging pathogens for phagocytosis D.Perforating membranes of pathogens​

Answers

Answer:

C

Explanation:

Tagging pathogens for phagocytosis D.Perforating membranes of pathogens

brainly stop removing my question its weird i just need help

Answers

lol…..that’s only thing I wanted to say. And I wanted the 5 points, don’t get me wrong u need to up the points. ( ignore whatever I said I just needed more words) luv you

Pls help me with this question!! The question is asked on this image!!

Answers

Answer:

With oxygen.

Explanation:

Have a great day!

Other Questions
12 A train in France can travel at a speedof 217.4 miles per hour. A train inChina can travel 1.23 times this speed.How fast can the train in China travelin miles per hour?I WILL MARK YOU AS BRAINIEST IF YOU ANSWER THIS QUESTION WITH AN ANSWER AND EXPLANATION + 100 points At Cheesecake Factory, the cost of your meal before the tip is $77.23. You leave a 15% tip. How muchmoney did you leave for tip? What is the total cost of your meal? e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What is the theme of William Shakespeares Sonnet 116? fill in the blank yo______espanol What is a secondary source? Give an example. What is the following sum in simplest form? StartRoot 8 EndRoot 3 StartRoot 2 EndRoot StartRoot 32 EndRoot 3 StartRoot 8 EndRoot 3 StartRoot 2 EndRoot 5 StartRoot 42 EndRoot 9 StartRoot 2 EndRoot 5 StartRoot 2 EndRoot StartRoot 32 EndRoot. Solve please! :) The values of m n k respectively. A dripping tap or shower head wastes up to:a) 1000 litres a weekb) 5000 litres a weekc) 3000 litres a weekd) 10000 litres a week Are spirits real? Please explain. Consider the equation 5/3v +4 + 1/3v = 8. What is the resulting equation after the first step in the equation? 1. What two metaphorical "fires" does Scout have to choose between at the beginning of the chapter? A good example of a positive feedback mechanism would be(select allthat apply)A. breast feedingB. regulating glucose levels in the blood C.enhancement of labor contractions during parturitionD. blood clot formationE.body temperature regulationF. blood calcium level regulation Eleventh gradeX.1 Identify and correct errors with subject-verb agreement 08SYou have book covers to reveal! Co toFind the error with subject-verb agreement. Select the incorrect verb and type it correctiy.The metric system, first created by French scientists in the 1790s, isbased on a unit of length known as the meter. Approximately 3.28 feetare the equivalent of one meter,This is for English !!! Rocky point brewery (rpb) filed an initial public offering in january 20x3. Rpb engaged olsen & alain, cpas (o&a) in 20x0 to keep the books and prepare monthly and annual financial statements (while the company was privately held), and terminated those services in december 20x2. Under sec and pcaob rules, could rpb engage o&a to be its auditors now that it is a public company?. Read the excerpt from Martines personal narrative about receiving a birthday gift.I ripped carelessly through the wrapping paper to reveal a plain, brown box. My eyebrows raised in anticipation. What could be inside? My fingers worked more slowly now, pulling back the tape that held the box shut. As soon as the flaps sprung open, I peered inside. But I inwardly shuddered when I discovered three pairs of bright neon-green socks. Oh no, I thought. These look hideous. I would never wear something like these, but I also dont want to hurt my aunts feelings. What should I do? I furrowed my brow and bit my lip, uncertain what to do next.This excerpt would most likely appearin the beginning of the narrative.in the middle of the narrative.toward the end of the narrative.at the end of the narrative. How to find domain of (1/x-3)(x^2-x-12) Which is the best estimate of StartRoot 0. 96 EndRoot to the nearest hundredth? 0. 96 0. 97 0. 98 1. 0. Someone please help me with this What are the odds of not selecting a black 2 in cards