someone help me I need a good grade my mom gonna yell at my if i don't get it ):

Someone Help Me I Need A Good Grade My Mom Gonna Yell At My If I Don't Get It ):

Answers

Answer 1

The correct justification for the given steps are;

Step 1; Addition property of equality.

Step 2; Subtraction property of equality.

Step 3; Division property of equality.

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

Given that;

For the given condition,

⇒ 200 + 20w = - 100 + 25w

Where, 'w' is number of weeks.

Now,

Since, For the given condition,

⇒ 200 + 20w = - 100 + 25w

Where, 'w' is number of weeks.

Solve for w as;

⇒ 200 + 20w = - 100 + 25w

Apply Addition property of equality,

⇒ 200 + 20w + 100 = - 100 + 25w + 100

⇒ 300 + 20w = 25w

Apply Subtraction property of equality,

⇒ 300 + 20w - 20w = 25w - 20w

⇒ 300 = 5w

Apply Division property of equality,

⇒ 300/5 = 5w/5

⇒ 60 = w

⇒ w = 60

Thus, The correct justification for the given steps are;

Step 1; Addition property of equality.

Step 2; Subtraction property of equality.

Step 3; Division property of equality.

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ1


Related Questions

Sam purchased a 30$ bus pass. Each time they ride the bus, $2.25 is deducted. Write an equation to show the amount of money left on the bus pass after x rides.

Answers

Answer:

-2.25x = 30

Step-by-step explanation:

I hope this helps!

(10)
Write the equation
of the line in
Slope-Intercept
Form.

Answers

Answer: y= -3x -1

Step-by-step explanation: y=mx+b

The Y-intercept is at (0,-1), so b is -1

The slope is rise/run, and the graph is down 3, right 1, so the slope is -3/1

If you can, please give me a Brainliest, I only need 1 more to become an Ace, thank you!

A semicircle is divided into two circular sectors of which one is 4/5 of the other. The radius of the circle measures 18cm. Calculate the length of the two arcs and the area of ​​the two circular sectors

Answers

The length of the two arcs and the area of the two circular sectors can be calculated as follows:

Since the semicircle is divided into two circular sectors, each sector has an angle of 180/2 = 90 degrees. Therefore, the smaller circular sector has an angle of 90 * (4/5) = 72 degrees, and the larger circular sector has an angle of 90 - 72 = 18 degrees.

The length of the arc of a circle is equal to the circumference of the circle multiplied by the ratio of the central angle of the arc to 360 degrees. Therefore, the length of the smaller arc is 18 * pi * (72/360) = 8pi cm, and the length of the larger arc is 18 * pi * (18/360) = 2pi cm.

The area of a circular sector is equal to the area of the circle multiplied by the ratio of the central angle of the sector to 360 degrees. Therefore, the area of the smaller circular sector is 18^2 * pi * (72/360) = 288pi cm^2, and the area of the larger circular sector is 18^2 * pi * (18/360) = 72pi cm^2.

Therefore, the length of the two arcs is 8pi cm and 2pi cm, and the area of the two circular sectors is 288pi cm^2 and 72pi cm^2.

x-½y=0 ½x- 0 ½z=-1 3x-y -z =-2​

Answers

x =2, y=6, z=4 hope this helps

Solve for x
48° 73° X°

Answers

Answer:

[tex]x=59[/tex]

Step-by-step explanation:

Angles in a triangle add to [tex]180^{\circ}[/tex].

[tex]\implies x=180-48-73=59[/tex]

Write an equation in slope-intercept form of the line that is perpendicular to the one given and passes through the given point. (4,8); y=-2x - 4

Answers

answer:

step by step explanation:

(4,8); y = 2x — 4 = ?

TO FIND THE ANSWER TO YOUR QUESTION:

Joseph and Raquel are building a scale model of the Alamo Mission for their Texas history project using a scale in which 2 inches represents 30 feet. The enclosed area of the Alamo Mission was 480 feet long and 160 wide.


What should the length of the enclosed area of the scale model be in inches?

Answers

Th length of the enclosed area of the scale model in inches is 32 inches.

How to find the length of the enclosed area of the scale model in inches?

Joseph and Raquel are building a scale model of the Alamo Mission for their Texas history project using a scale in which 2 inches represents 30 feet.

The enclosed area of the Alamo Mission was 480 feet long and 160 feet wide.

The length of the enclosed area of the scale model in inches can be calculated as follows:

30 feet = 2 inches

480 feet = ?

cross multiply

length of the enclosed area = 480 × 2 / 30

length of  the enclosed area = 960 / 30

length of the enclosed area = 32 inches

learn more on scale model here:https://brainly.com/question/22377661

#SPJ1

Find the slope: m=

Find the y-intercept: b=

Equation: y=

Answers

Answer:

y = - [tex]\frac{5}{4}[/tex] x + 5

Step-by-step explanation:

the equation of a line in slope- intercept form is

y = mx + b ( m is the slope and b the y- intercept )

calculate m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (0, 5) and (x₂, y₂ ) = (4, 0) ← 2 points on the line

m = [tex]\frac{0-5}{4-0}[/tex] = [tex]\frac{-5}{4}[/tex] = - [tex]\frac{5}{4}[/tex]

the line crosses the y- axis at (0, 5 ) ⇒ b = 5

y = - [tex]\frac{5}{4}[/tex] x + 5 ← equation of line

In the following diagram, AD || BC and AB || DC.
Prove angle A is congruent to angle C

Answers

They are vertical angles but in a different form.

If AD = BC then AC must be congruent. Transitive Property
Let’s use a two-column proof:

Statement: Reason:

AD || BC Given

∠1 ≅ ∠4. Alternate Interior Angles

Theorem

AB || DC Given

∠2 ≅ ∠3 Alternate Interior Angles

Theorem

━ ━
DB ≅ BD Reflexive Property of

Equality

ΔDAB ≅ ΔDCB ASA Postulate

You currently have $40 saved up. You get $5 every
time you shovel the driveway. Your friend has no
money saved up and gets $10 every time she
shovels her driveway (hers is twice as big as
yours!) After how many driveways will you have
the same amount of money as your friend?

Answers

8 days because you start at 40, and get 5$ everyday so 5x8 is another 40 for a total of $80. And if your friend earns $10 each day, in 8 days she will also have $80.

2) Solve: 115 − 10 = −12 − 5(2 − 6)

Answers

Answer:

False

Step-by-step explanation:

Simplify 115 − 10 : 105

Subtract the numbers  115 − 10 = 105    

     2.Simplify 12 − 5(2 − 6) : 8

105=8

this shows that the sides are not equal so it is false  

Find the area of the triangle below. Be sure to include the correct unit in your answer. 8 cm 9 cm 18 cm

Answers

Answer:

648

Step-by-step explanation:

An easy way to do this is to multiply all sides, then divide by 2.

8 × 9 × 18 = 1296

Now divide that by 2:

1296 ÷ 2 = 648

The area of the triangle is 648.

You have rented a moving truck to move into your first apartment. ABC truck has interior dimensions of 168 inches times 96 inches times 77 inches. The dimensions of your storage boxes are 24 inches times 13 inches times 28 inches. Determine how many boxes can fit into the truck.

Answers

Dimension of ABC Truck = 168 * 96 * 77 = 1241856 inches cubed
Dimension of storage boxes = 24 * 13 * 28 = 8736 inches cubed

How many boxes can fit approx = 1241856 / 8736 = 142 boxes

For the high school basketball game, it costs $12 for every 3 tickets.
Complete the table below showing the cost and the number of tickets.

Answers

Based on the unit rate of the table, the missing values that shows the cost and the number of tickets are:

$32 and 9 tickets.

How to Complete the Table Showing Cost and Number of Tickets?

To calculate the missing values in the table shown in the attachment below, we have to find the unit rate, which is the cost of 1 ticket.

Given that 3 tickets will cost $12, therefore:

Unit rate = 12 / 3 = $4 per ticket.

Using this rate, find the missing values as explained below.

For 8 tickets, we will have the following cost:

8 × $4 = $32

For $36, we will have the following tickets:

$36/$4 = 9 tickets

Thus, the missing values that will complete the table will be:

$32 and 9 tickets.

Learn more about unit rate of a table on:

https://brainly.com/question/17612867

#SPJ1

solve for b in the trapezoid.

Answers

180 - 57 = 123 ( ALLIED ANGLE )

For the conditional write the converse , inverse , and contrapositive: Walking in front of a moving car is dangerous to your health .

Answers

The converse of the conditional statement is “If dangerous to your health then walking in front of a moving car”.

The inverse of the conditional statement is “If not dangerous to your health then not walking in front of a moving car”.

The contrapositive of the conditional statement is “if not walking in front of a moving car then not dangerous to your health."

What is the conditional statement?

The conditional statement is defined as the two fundamental components that make up a conditional statement Hypothesis (if) and Conclusion (then).

The given conditional statement is "walking in front of a moving car is dangerous to your health."

The converse of the conditional statement is “If dangerous to your health then walking in front of a moving car”.

The inverse of the conditional statement is “If not dangerous to your health then not walking in front of a moving car”.

The contrapositive of the conditional statement is “if not walking in front of a moving car then not dangerous to your health."

Learn more about the conditional statement here:

brainly.com/question/7066208

#SPJ1

-2x2 + 8x = 10 using the Quadratic Formula. Simplify if possible.

Answers

The required solutions are x = 2-i and x = 2+i to the given quadratic function.

What is a quadratic function?

The quadratic function is defined as a function containing the highest power of a variable is two.

We have been given that quadratic function as

-2x² + 8x - 10 = 0

Compare the given function to the standard quadratic function f(x) = ax² + b x + c.

We get a = -2, b = 8 and c = -10

Using the quadratic formula to solve the above quadratic function

[tex]x = \dfrac{-b\pm\sqrt{b^2-4ac}}{2a}[/tex]

[tex]x=\dfrac{-8\pm \sqrt{8^2-4\left(-2\right)\left(-10\right)}}{2\left(-2\right)}[/tex]

[tex]x=\dfrac{-8\pm \:4i}{2\left(-2\right)}[/tex]

[tex]x=\dfrac{-8+4i}{2\left(-2\right)},\:x=\dfrac{-8-4i}{2\left(-2\right)}[/tex]

x = 2-i, x = 2+i

Thus, the required solutions are x = 2-i and x = 2+i to the given quadratic function.

Learn more about quadratic function here:

brainly.com/question/14083225

#SPJ1

50 POINTS PLEASE HELP QUICK
Which expression is equivalent to 2 and three tenths raised to the fourth power divided by nine tenths raised to the fifth power, all raised to the fourth power?


A: 2 and three tenths raised to the eighth power divided by nine tenths raised to the ninth power

B: 2 and three tenths raised to the sixteenth power divided by nine tenths raised to the twentieth power

C: 1.4 raised to the forth power

D: 1.4 raised to the ninth power

Answers

B is the answer they are both equal to 5.04423x10^6

Answer:

The answer is B

Step-by-step explanation:

I took the test and got it right,(also i have a pic) brainiest pls!!

Solve the system by substitution. { − 4 . 5 x − 2 y = − 12 . 5 3 . 25 x − y = − 0 . 75

Answers

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

The value of x is 1.

The value of y is 4.

What is an equation?

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

Example:

2x + 4 - 9 = 5 is an equation.

We have,

-4.5x - 2y = -12.5 ____(1)

3.25x - y = -0.75 _____(2)

From (1) we get,

-4.5x + 12.5 = 2y

y = (-4.5x + 12.5) / 2 _____(3)

Now,

3.25x - y = -0.75

Putting (3) in (2) we get,

3.25x - (-4.5x + 12.5) / 2 = -0.75

6.5x + 4.5x - 12.5 = 2 x -0.75

11x - 12.5 = -1.5

11x = -1.5 + 12.5

11x = 11

x = 1

Now,

From (3) we get,

y = (-4.5x + 12.5) / 2

y = (-4.5 x 1 + 12.5) / 2

y = (-4.5 + 12.5) / 2

y = 8/2

y = 4

Thus,

The value of x is 1.

The value of y is 4.

Learn more about equations here:

https://brainly.com/question/17194269

#SPJ1

help meeeeeeeeeeeeeeeeeeeeeeeeeee pleaseeeeeeeeeeeeeeeeeeeeee!!!!!

Answers

Answer:

  a) 23.1 million

  b) year 2013

Step-by-step explanation:

Given a population in millions is modeled by A = 23.1e^(0.0152t) for t years after 2000, you want to know the population in year 2000, and the year in which the population is 28.3 million.

a) Initial population

When t=0, the exponential factor is 1. The population is given by the coefficient of that factor: 23.1

The population in 2000 was 23.1 millions.

b) Year of 28.3M

We can solve for t to find the year the population is 28.3 million:

  28.3 = 23.1e^(0.0152t)

  28.3/23.1 = e^(0.0152t) . . . . .divide by 23.1

  ln(28.3/23.1) = 0.0152t . . . . . take natural logs

  t ≈ 13.36

The population will reach 28.3 million in the year 2013.

<95141404393>

A marching band director needs to divide 44 members into two groups. He wants the ratio of band members in group 1 to band members in group 2 to be 1 to 3. How many band members will be in group 2?.

Answers

If the ratio of band members in group 1 to band members in group 2 is 1 to 3, then for every 3 band members in group 2, there will be 1 band member in group 1.Therefore, group 2 will have 11 band members.

What is ratio and proportion?

Comparing two numbers or quantities results in a ratio. Usually, it is expressed in the form "a:b" or "a/b," with a and b standing for the two quantities under comparison. Contrarily, a percentage is an equation that states that two ratios are equal. Alternatively said, a proportion is a claim that one ratio is equal to another.

For example, if the ratio of apples to oranges in a basket is 2:3, this implies that there are three oranges per each two apples. We may alternatively state that the ratio of apples to total number of fruits in the basket is 2:5, because 2 + 3 = 5. The two ratios (2:3 and 2:5) are proportionate in this instance. Also, ratio of band members in group 1 to band members in group 2 to be 1 to 3

How to solve?

If the director wants to divide 44 band members into two groups, with this ratio, then the number of band members in group 2 will be 44 / (1 + 3) = 44 / 4 = 11 band members.

To learn more about ratio and proportion, visit:

https://brainly.com/question/26974513

#SPJ4

Find the three consecutive integers such that the smallest and three times the largest is 330. What is the smallest integer?

Answers

The smallest integer out of the three integers is 109

What is a number system?

A numeral system is a writing system for expressing numbers; that is, a mathematical notation for representing numbers of a given set in a consistent manner using digits or other symbols. In different numeral systems, the same sequence of symbols can represent different numbers.

A zero, a positive natural number, or a negative integer with a minus sign is an integer. The negative numbers are the additive inverses of their positive counterparts.

Three consecutive integers:

x, x+1, x+2

The sum of the integers,

x+(x+1)+(x+2) = 330

3x + 3 = 330

3x= 327

x= 327/3

x= 109

To know more about the number system follow

https://brainly.com/question/13162939

#SPJ1

What is the slope of the line that passes through the points (10, 3)(10,3) and (7, 0)(7,0)? write your answer in simplest form.

Answers

The slope of the line that passes through the points (10, 3)(10,3) and (7, 0)(7,0)= 1.

What is slope?

A line's steepness and direction are measured by the line's slope.

Without actually using a compass, determining the slope of lines in a coordinate plane can assist in forecasting whether the lines are parallel, perpendicular, or none at all.

Any two different points on a line can be used to calculate the slope of any line.

A line's slope is determined by how its y coordinate changes in relation to how its x coordinate changes. y and x are the net changes in the y and x coordinates, respectively.

Two locations located on a straight line can be used to determine a line's slope. We can use the slope of line formula if we know the two spots' coordinates. These two points' coordinates should be-

P1 = (x1, y1) and P2 = (x2, y2)

According to our question-

The slope m using the slope formula

m = y2-y1/x2-x1

with (x₁, y₁ ) = (10, 3 ) and (x₂, y₂ ) = (7, 0 )

-3/-3 = 1

Hence, the slope is = 1.

learn more about slope click here:

https://brainly.com/question/3493733

#SPJ4

a paddle wheel on a boat is 4 feet in diameter. the fins along the outer edge travel at a speed of 1.3 feet per second. how long does it take the paddle wheel to complete 100 full revolutions ? round to the nearest second.

_ minutes and _ seconds. ​

Answers

Answer: To find out how long it takes the paddle wheel to complete 100 full revolutions, we need to calculate the circumference of the paddle wheel and divide that by the speed at which the fins along the outer edge are traveling.

The formula for the circumference of a circle is:

C = 2πr

where C is the circumference and r is the radius of the circle.

The radius of the paddle wheel is 2 feet (the diameter of 4 feet divided by 2), so the circumference is:

C = 2π * 2 = 8π feet

To find out how long it takes the paddle wheel to complete 100 full revolutions, we divide the number of feet traveled in one revolution (the circumference of 8π feet) by the speed at which the fins are traveling (1.3 feet per second):

100 * 8π feet / 1.3 feet per second = 615.38 seconds

Rounded to the nearest second, it takes approximately 615 seconds for the paddle wheel to complete 100 full revolutions.

Find the coordinates of the circumcenter of the triangle with the given vertices.
A(2, 2). B(2, 4), C(8, 4)
The circumcenter is

Answers

Answer:D

beacuse it is correct  just trust me i have done this class and its correct

The answer is D!!!!!!

Paige can sort her toys in 6 fewer hours that Madison can. When they work together, it
takes them only 4 hours to sort the toys. How long would it take for each of them to sort
the toys alone?

Answers

Let X be the number of hours it takes Paige to sort the toys alone.

It takes Madison X + 6 hours to sort the toys alone.

Together, it takes them X + (X + 6) = 4 hours to sort the toys.

Combining like terms, we get 2X = 4

Dividing both sides by 2, we get X = 2

Therefore, it takes Paige 2 hours to sort the toys alone.

It takes Madison 2 + 6 = 8 hours to sort the toys alone.

1/2 divided by 2 In fraction

Answers

Answer:

1/4

Step-by-step explanation:

1/2 divided by 2 would be 0.25, and since that's a quarter it would be 1/4.

What is the location of point G, which partitions the directed line segment from D to F into a 5:4 ratio? –1 0 2 3

Answers

The location of G is (3, 0).

Given question in that we have a number line.

A number line goes from negative 5 to positive 10.

Point D is at negative 2 and point F is at positive 7.

A line is drawn from point D to point F.

So we can write coordinate of point D as (-2,0) and point F as (7,0).

line segment from D to  F divides as point G as in ratio of 5:4

Consider two points P(x1, y1) and Q(x2, y2). We have to find the coordinates of the point R which divides PQ in the ratio m : n

x = [tex]m*x2+n*x1/(m + n)[/tex]

[tex]y = m*y2+n*y1/(m + n)[/tex]

so here in our question m =5 n=4

x1=-2 x2=7 y1=0 y2=0

x = 5*7+4*(-2)/9

x = 3

y = 5*0+4*0/9 = 0

So the location of G is (3, 0)

Given Question is incomplete complete question here.

What is the location of point G, which partitions the directed line segment from D to F into a 5:4 ratio? A number line goes from negative 5 to positive 10. Point D is at negative 2 and point F is at positive 7. A line is drawn from point D to point F.

To know more about line segment here

https://brainly.com/question/25727583

#SPJ4

Question

A square based pyramid has a height of 6 feet and the edge length of the base is 2 feet. A second square based pyramid is 2 feet taller and the edge length of the base is 0.5 feet greater than the first pyramid. How much greater is the volume of the second pyramid than the volume of the first pyramid? Round your answer to the nearest hundredth.


please help

Answers

A pyramid is a solid shape with a specified shaped base. The required answer is 8.67 cubic feet.

A pyramid is a solid shape with a specified shaped base. While a square based pyramid is a type of pyramid which has its base to be a square.

Volume of a square based pyramid = [tex]\frac{1}{3}[/tex] x base area x height

Also, are of a square = length x length

So that,

i. For the first pyramid;

volume =  [tex]\frac{1}{3}[/tex] x (2 x 2) x 6

            = 8 cubic feet

The volume of the first pyramid is 8 cubic feet.

ii. For the second pyramid, we have;

height = 8 feet

base side = 2.5 feet

So that.

Volume =  [tex]\frac{1}{3}[/tex] x (2.5 x 2.5) x 8

             = 16.6667

Volume = 16.67 cubic meters

The volume of the second pyramid is 16.67 cubic meters.

Therefore, the volume of the second pyramid is greater than the volume of the first pyramid by;

volume of the second pyramid - volume of the first pyramid = 16.67 - 8.0

                                              = 8.67 cubic feet

Learn more about volume of pyramids at https://brainly.com/question/2786083

#SPJ1

Lamont works for a company that pays him $20 per hour, but $50 each week is deducted from his pay for insurance. let p(h) represent Lamont's pay in one week after deductions for working h hours. The function
p
(
h
)
=
20
h

50
p(h)=20h−50 is used to calculate Lamon's weekly pay after the insurance deduction. What is the independent variable?

Answers

The independent variable in the given function is h.

What are Independent and dependent variables?

The Independent variables are those variable whose value does not depend on any other variable. And it causes the change in other variables.

The dependent variable is those variables whose value is not independent and change in this variable is dependent on the change of the independent variable.

Given the function p(h)=20h−50, which represents Lamont works for a company that pays him $20 per hour(h), but $50 each week is deducted from his pay for insurance.

Now, in the given function since the amount that Lamont will get depends upon the number of hours for which he is working.
Therefore, the h is the independent variable and p is the dependent variable.

Learn more about Independent and Dependent Variable are:

https://brainly.com/question/1479694

#SPJ1

Other Questions
The width of a claroom i 4meter le than the length. It area i 45cm*45cm. Find the dimenion of the claroom sonata form consists of three main sections, exposition, development, andquestion 10 options:introductionrecapitulationmotivestransition a nurse teaches an adolescent client with asthma to independently administer breathing treatments. which principle should the nurse keep in mind when planning the teaching session? 1. compute total variable cost per unit. 2. compute total fixed costs. 3. prepare a flexible budget at activity levels of 12,000 units and 16,000 units. Can anyone help me out. Really need this turned in Solve x for this diagram why did the framers of the constitution put the principles of checks and balances and separation of powers in the constitution? can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope.