Solve number 6 please

Solve Number 6 Please

Answers

Answer 1

Answer:

d

Step-by-step explanation:

if 2 chords of a circle intersect , then the product of the parts of one chord is equal to the product of the parts of the other chord, that is

KN × JN = LN × MN

(x - 4)(x + 23) = (x + 14)(x - 1) ← expand factors on both sides using FOIL

x² + 19x - 92 = x² + 13x - 14 ( subtract x² from both sides )

19x - 92 = 13x - 14 ( subtract 13x from both sides )

6x - 92 = - 14 ( add 92 to both sides )

6x = 78 ( divide both sides by 6 )

x = 13


Related Questions

How many children are working around the world today, according to the ilo? a. 215,000 b. 2.15 million c. 21.5 million d. 215 million

Answers

Answer:

160 million

Step-by-step explanation:

According to the ILO as of 2021, there's an estimated 160 million children working right now, so i don't know what answer you should put :/

Answer:

D 215 million

Step-by-step explanation:

Expand and simplify 5(3x+2)-2(4x-1)

Answers

5(3x+2)-2(4x-1)

= 15x+10-8x+2

= 7x+12

( 12y + 2x) + 4y simplify the expression

Answers

Answer:

[tex]2x+16y[/tex]

Add  [tex]12y[/tex] and [tex]4y[/tex].

[tex]2x+16y[/tex]

Answer:

2x + 16y

Step-by-step explanation:

The y terms can be added together. 12y + 4y is 16y. The 2x has to just stay the way it is because it could only be added to another x term and there aren't any. So you are left with 2x + 16y

The figure is made up of two shapes a semi circle on a rectangle what is the exact perimeter of the

Answers

The perimeter of the composite shape is: (3π + 12)mm

What is a semicircle?

A semicircle is a part of a circle cut through its diameter.

Analysis:

perimeter of a semicircle = πr

where r = 6/2 = 3mm

perimeter of a semicircle = π(3)  = 3π

perimeter of incomplete rectangle = L+2B, L = 6mm, B = 3mm

perimeter of rectangle = 6mm +2 x 3= 12mm

perimeter of shape = (3π+12)mm

In conclusion, the perimeter of the rectangle is (3π+12)mm

Learn more about semicircles :brainly.com/question/285710

#SPJ1

What is the value of x in the figure below?

Answers

Answer:

The value of x in the figure is 3.5

Step-by-step explanation:

When we look at the figure, we see that AB and BC, are connected, to make a longer side of a triangle. We can also see that BC is dilated from AB. When dilating, we multiply or divide by a number, to get the extended or shortened length. (Just keep multiplication and division in mind)                    To get x, we can do the same that we did to get 2, from 4. From AB to BC it goes from 4 to 2.

To get 2 from 4, you must divide 4 by 2. So when we do the same thing to 7, we should get x.

7 / 2 = 3.5

The value of x in the figure is 3.5

[tex]\\ \rm\dashrightarrow \dfrac{4}{2}=\dfrac{7}{x}[/tex]

[tex]\\ \rm\dashrightarrow 2=\dfrac{7}{x}[/tex]

[tex]\\ \rm\dashrightarrow x=\dfrac{7}{2}[/tex]

[tex]\\ \rm\dashrightarrow x=3.5[/tex]

In circle P, diameter QS measures 20 centimeters.

Circle P is shown. Line segment Q S is a diameter. Line segment R P is a radius. Angle R P S is 123 degrees.

What is the approximate length of arc QR? Round to the nearest tenth of a centimeter.

9.9 centimeters
19.9 centimeters
21.5 centimeters
43.0 centimeter

Answers

The approximate length of arc QR to nearest tenth is 9.9cm

Length of an arc

The formula for calculating the length of an arc is expressed as:

L = r theta

where

r is the radius of an arc = 20cm/2 = 10cm

theta = 180 - 123 = 57 degrees

Determine the length of an arc

L = 10(57π/180)
L = 57π/18
L = 9.94cm

Hence the approximate length of arc QR to nearest tenth is 9.9cm

Learn more on length of an arc here: https://brainly.com/question/2005046

#SPJ1

Answer:

9.9

Step-by-step explanation:

Your credit limit is $1,000. What is the max you should ever owe on this card?

= $

Answers

Answer:

see the attachment photo!

Ayuda por fa es para hoy

Answers

Translation: please help it's due today

Would love to help but there is no question to answer

The sum of multiples of five from 10 to 75, inclusive.

Answers

The asked sum of multiples of five from 10 to 75, inclusive, is 595.

To find the sum of multiples of five from 10 to 75, inclusive, we can use the formula for the sum of an arithmetic series:

Sum = (n/2) * ([first term] + [last term])

Following the given case, the first term (a) is 10, the last term (l) is 75, and the common difference (d) between consecutive terms is 5 (since we are considering multiples of five).

The number of terms (n) can be calculated as:

n = (last term - first term) / common difference + 1

Let's calculate the number of terms first:

n = (75 - 10) / 5 + 1

n = 65 / 5 + 1

n = 13 + 1

n = 14

Now, we can determine the sum of the multiples of five:

Sum = (14/2) * (first term + last term)

Sum = 7 * (10 + 75)

Sum = 7 * 85

Sum = 595

Therefore, the asked sum of multiples of five from 10 to 75, inclusive, is 595.

Learn more about the arithmetic series here:

https://brainly.com/question/34016107

#SPJ12


hich represents the inverse of the function f(x) = 4x?
Oh(x)=x+4
Oh(x)=x-4
h(x) = ²x
h(x) = x

Answers

Answer:

[tex]h(x) = \frac{1}{4} x[/tex]

Step-by-step explanation:

To find the inverse of a function, the steps are:

Let y= f(x)Make x the subject of formulaReplace x with f⁻¹(x) and y with x

In this case, since h(x) is the inverse function of f(x), we can replace x with h(x) in step 3.

_____

f(x)= 4x

Let y= f(x) [tex]\textcolor{steelblue}{\text{ - step 1}}[/tex]

y= 4x

Divide both sides by 4:

[tex] \frac{1}{4} y = x[/tex]

[tex]x = \frac{1}{4} y \: \: \: \textcolor{steelblue}{\: \text{ - step 2}}[/tex]

Replace x with h(x) and y with x:

[tex]\bf{h(x) = \frac{1}{4} x} \: \: \: \textcolor{steelblue}{\: \text{ - step 3}}[/tex]

Additional:

For a similar question on inverse functions, do check out the following!

https://brainly.com/question/21287415

Which best describes a random sample?
A.) a sample in which the elements are chosen by chance
B.) a sample in which the chosen elements are predetermined
C.) a sample in which each element of the populations chose
D.) a sample in which the chosen elements are removed from the population once they are chisen

Answers

A random sample  is a sample in which the chosen elements are removed from the population once they are chosen.

What is a random sample?

A sample is a smaller group of the population that has the desired elements of the population. A sample is sometimes necessary because it might not be feasible or cost effective to access the whole population.

To learn more about sample, please check: https://brainly.com/question/18521835

#SPJ1

Express your answer in simplest a+ bi form. (8+5i)(3+2i)-(4+i)(4-i)

Answers

[tex]\qquad\qquad\huge\underline{{\sf Answer}}[/tex]

Let's solve ~

[tex]\qquad \sf  \dashrightarrow \:(8 + 5i)(3 + 2i) - (4 + i)(4 - i)[/tex]

[tex]\qquad \sf  \dashrightarrow \:[( 8 \sdot3) + (8 \sdot2i) + (5i \sdot3) + (5i \sdot2i)] -[( 4 \sdot4) + (4 \sdot - i) + (i \sdot4) + (i \sdot - i)][/tex]

[tex]\qquad \sf  \dashrightarrow \:[24+ 16i + 15i+ 10i {}^{2} ] -[16 - 4 i+ 4i - i {}^{2} ][/tex]

[tex]\qquad \sf  \dashrightarrow \:[24+ 31i+ 10 {}{( - 1)} ] -[16 - ( - 1){}^{} ][/tex]

[tex]\qquad \sf  \dashrightarrow \:[24+ 31i - 10 {}{} ] -[16 + 1{}^{} ][/tex]

[tex]\qquad \sf  \dashrightarrow \:[14+ 31i {}{} ] -[17{}^{} ][/tex]

[tex]\qquad \sf  \dashrightarrow \: - 3+ 31i {}{} [/tex]

I hope you understood the procedure ~

Whatis the tigonemtric form of -3+4i

Answers

We calculate the module:

[tex]|z|\: = \: \sqrt{( - 3) ^{2} \: + \: {4}^{2} } [/tex]

[tex]|z| \: = \: \sqrt{9 \: + \: 16} [/tex]

[tex]|z| \: = \: \sqrt{25} [/tex]

[tex] \boxed{|z| \: = \: 5}[/tex]

We calculate the angle formed by "z":

[tex] \arctan( \frac{4}{ - 3} ) \: = \: \underline{0.92729521 \: \text{rad}}[/tex]

We pass it to degrees:

[tex]0.92729521 \: \times \: \frac{180}{\pi} [/tex]

[tex] \frac{166.91313924}{\pi} [/tex]

[tex] \frac{166.91313924}{3.14159265}[/tex]

[tex] \boxed{ 53.13°}[/tex]

Now we use this formula to transform it into a trigonometric form:

[tex] \boxed{z \: = \: |z| \times \: ( \cos( \alpha) \: + \: i \: \times \: \sin( \alpha))}[/tex]

We substitute the values already obtained:

[tex] \boxed{ \bold{z \: = \: 5 \times \: ( \cos( 53.13°) \: + \: i \: \times \: \sin( 53.13°))}}[/tex]

Answer:

[tex] \boxed{ \bold{z \: = \: 5 \times \: ( \cos( 53.13°) \: + \: i \: \times \: \sin( 53.13°))}}[/tex]

MissSpanish

In order to go on the field trip, you must accrue 75 positive
behavior points. you found out that you have 45% of the
points necessary to go. how many points do you have? use the
variable, p, for your equation.

what is the equation?

Answers

Answer:

Equation 75 X .45 = P

P = 33.75

Solve by the elimination method. [tex]4x+8y=40\\-4x+y=14[/tex]

Answers

Answer:

[tex]x=-2,y=6[/tex]

Step-by-step explanation:

We can add these 2 equations together to eliminate [tex]x[/tex] from the equation, leaving us to solve for [tex]y[/tex].

[tex](4x+8y) + (-4x+y) = (40) + (14)\\9y = 54\\\boxed{y = 6}[/tex]

Now we can solve for [tex]x[/tex] through substituting [tex]y[/tex].

[tex]4x+8y=40\\4x+8(6)=40\\4x+48=40\\4x=-8\\\boxed{x=-2}[/tex]

We can check our answers by substituting [tex]x[/tex] and [tex]y[/tex] into one of the equations and seeing if the equation is true.

[tex]-4x+y=14\\-4(-2)+6=14\\8+6=14\\14=14[/tex]

LHS = RHS so our answers are correct.

how many solutions does 10x - 10= -10x + 10

Answers

Im pretty sure the answer is 10? I looked up some solutions and found that x=10

If im wrong im so sorry!! ):

Question in the picture 1-5
how to understand next steps what will be anyone give me explains​

Answers

Step-by-step explanation:

remember a few things :

a × -1 = -a

-a × -1 = a

-1 × -1 = 1

1 × a = a

therefore,

-1 × -1 × a = 1 × a = a

and finally

c × (a + b) = c×a + c×b

so, we can say

(1 - 5) = -1 × -1 × (1 - 5) =

= -1 × (-1×1 + -1×-5) = -1 × (-1 + 5) =

= -1 × (5 - 1) = -(5 - 1)

Question 9
Expand and simplify (2x-7)(3x-8).

Answers

Answer:

=> Expand by applying the FOIL method

[tex]2x\cdot \:3x+2x\left(-8\right)-7\cdot \:3x-7\left(-8\right)[/tex]

=> combine like terms

[tex]6x^2-37x+56[/tex]

(b) A bag contains five red counters and 3 blue counters. One counter is taken at random from the bag. What is the probability of obtaining a red counter?




please can your help !!!!!​

Answers

Answer:

p(obtaining a red counter) = 0.625

Step-by-step explanation:

The total number of counters in the bag is 5 + 3 = 8.

and only 5 are red.

Then

the probability of obtaining a red counter is :

[tex]= \frac{5}{8} = 0.625[/tex]

Pythagorean Theorem
FIRST TO ASNWER WILL GET THANKS AND WILL BE MARKED BRAINLIEST

Answers

Answer:

b=17.75 ft

Step-by-step explanation:

We will answer this using Pythagorean Theorem.
Since the bottom of a ladder is 3 feet from the wall, and the ladder is 18 ft long, the ladder is the hypotenuse. Knowing pythagorean theorem (a^2+b^2=c^2), we can plug it in.
3^2 + b^2 = 18^2

9+b^2=324

b^2=315

b=17.75 ft

y=-8x+1 find the slope and y-intercept in this equation.

Answers

the slope is -8 and the y intercept is 1
the slope is always the number in front of the x and the y intercept is always the number by itself
hope this helps!

solve pls brainliest

Answers

Answer:

The ans of first one is 0/8 = 0

and 6÷0 = undefined....hope this helps:)

Answer:

1) 0/8 = 0
2) 6/0 = Undefined

Detailed Answer:

Zero divided by any number gives zero.
Diving any number by zero is undefined.

Which addition does the model below represent?

5 positive tiles and 3 negative tiles.

Answers

Any time we have a single positive tile pair up with a single negative tile, those two tiles cancel out.

Three positive tiles and three negative tiles will pair up and cancel out. We're left with two positive tiles only. This represents the number 2.

In other words, 5 + (-3) = 5 - 3 = 2

Bo is flying a kite, holding his hands a distance of 3.5 feet above the ground and
letting all the kite's string play out. He measures the angle of elevation from his hand
to the kite to be 29°. If the string from the kite to his hand is 110 feet long, how many
feet is the kite above the ground? Round your answer to the nearest tenth of a foot if
necessary.

Answers

The height of the kite will be 53.32 feet above the ground.

What is trigonometry?

The branch of mathematics sets up a relationship between the sides and the angles of the right-angle triangle is termed trigonometry.

Given that:-

The boy is flying a kite, holding his hands a distance of 3.5 feet above the ground andletting all the kite's strings play out. He measures the angle of elevation from his hand to the kite to be 29°. If the string from the kite to his hand is 110 feet long, what is the total vertical height?

The height of the kite above the ground will be calculated as:-

[tex]Sin\theta = \dfrac{perpendicular}{Hypotenuse}[/tex]

[tex]Sin(29)=\dfrac{H}{110}[/tex]

H = Sin(29)  x  110

H  = 53.32 feet

The hand of the boy is 3.5 above the ground so the total height H(t) of the kite above the ground will be:-

H(t)  = 53.232  +  3.5

H(t)  = 56.28 feet.

Therefore the height of the kite will be 53.32 feet above the ground.

To know more about Trigonometry follow

https://brainly.com/question/24349828

#SPJ1

Answer:

Step-by-step explanation:

\text{What function uses the \color{green}{\textbf{O}PPOSITE} and the \color{#EB0000}{HYPOTENUSE}?}

What function uses the OPPOSITE and the HYPOTENUSE?

\text{\Large \underline{S}\color{green}{O}\color{#EB0000}{H}-CAH-TOA}

S

OH-CAH-TOA

\text{sin }\color{purple}{29}=\frac{\color{green}{\text{opposite}}}{\color{#EB0000}{\text{hypotenuse}}}=\frac{\color{green}{x}}{\color{#EB0000}{110}}

sin 29=

hypotenuse

opposite

=

110

x

\text{sin }29=

sin 29=

\,\,\frac{x}{110}

110

x

\frac{\text{sin }29}{1}=

1

sin 29

=

\,\,\frac{x}{110}

110

x

110\text{ sin }29=

110 sin 29=

\,\,x

x

Cross multiply.

x=53.329058...

x=53.329058...

Type into calculator.

\text{Add 3.5, the distance from the ground to his hand:}

Add 3.5, the distance from the ground to his hand:

53.329058...+3.5=

53.329058...+3.5=

\,\,56.829058...

56.829058...

\approx

\,\,56.8

56.8

Round to the nearest tenth.

\text{The kite is 56.8 feet above the ground.}

The kite is 56.8 feet above the ground.

Is ab parallel to cd? explain.

yes, because both lines have a slope of 4/3.
yes, because both lines have a slope of 3/4
no, because the slopes of the lines are not equal.
no, because the slopes of the lines are not opposite reciprocals of each other.

don't copy answers off of sites, otherwise i'd report you

Answers

Both lines are parallel because: A. both lines have a slope of 4/3.

What is the Slope of a Line?

The slope of a line = change in y / change in x = [tex]\frac{y_2 - y_1}{x_2 - x_1}[/tex].

The slope of parallel lines are the same, while the slope of perpendicular lines are negative reciprocals.

Slope of AB = 4 units/3 units = 4/3

Slope of CD = 4 units/3 units = 4/3

Both lines have the same slope, therefore, they are parallel to each other.

Learn more about slope on:

https://brainly.com/question/1542999

#SPJ1

A study was conducted about the number of miles that a sample of automobiles in New York City drive within a year. The sample was taken in front of an apartment complex and included 20 taxicab drivers and 40 of the building’s residents. Which is a reasonable explanation for the large gap in the histogram?

Answers

The histogram includes data from a voluntary response sample which is not representative of the population.

How to interpret Histograms?

A histogram is a chart that represents numerical data using bars. The dataset is split into intervals, each interval is represented by a bar, and the number of variables in each interval makes up the frequency for that interval.

From the histogram attached, we can see that there is a huge gap from around 17000 miles to 32500 miles.

Now, when we have this kind of gap it means that the histogram includes data from a voluntary response sample which is not representative of the population.

Read more about Histograms at; https://brainly.com/question/2962546

#SPJ1

Land Area
City
Chicago
(in square miles)
227.635
468.670
Population
(in 2011)
2,707,120
Los Angeles
3,819,702
To the nearest tenth, by how many people per square mile is the population density of Chicago greater than the population density of
Los Angeles?

Answers

Population density=Total population/Total area

#Chicago

Population density

2707120/227.63511892.4

#Los angeles

Population density

3819702/468.6708150.1

Difference

11892.4-8150.13742.3

The population density of Chicago is 3741.9 greater than Los Angele's population density.

What are arithmetic Operations?

The four fundamental operations of arithmetic are addition, subtraction, multiplication, and division of two or even more items.

Included in them is the study of integers, especially the order of operations, which is important for all other areas of mathematics,  notably algebra, data management, and geometry.

As per the given information in the question,

The population density is the ratio of the total population to the total area.

Total population of Chicago = 2,707,120

The land area of Chicago = 227.635

Then, the population density of Chicago will be:

= 2,707,120/227.635

= 11892.37

Total population of Los Angeles =  3,819,702

The land area of Los Angeles = 468.670

Then, the population density of Los Angeles will be:

= 3,819,702/468.670

= 8150.08

Then, the difference between Chicago and Los Angeles will be:

= 11892.37 - 8150.08

= 3741.9

To know more about arithmetic operations:

https://brainly.com/question/25277954

#SPJ2

Combine like terms to create an equivalent expression.
Enter any coefficients as simplified proper or improper fractions or integers.
-\dfrac65-\dfrac23v+\dfrac{4}{15}+\dfrac13v−
5
6


3
2

v+
15
4

+
3
1

v

From khan academy

Answers

The equivalent expression of [tex]-\dfrac65-\dfrac23v+\dfrac{4}{15}+\dfrac13v[/tex] is [tex]-\dfrac{15}{15}-\dfrac{v}3[/tex]

How to determine the equivalent expression?

The expression is given as:

[tex]-\dfrac65-\dfrac23v+\dfrac{4}{15}+\dfrac13v[/tex]

Collect like terms

[tex]-\dfrac65+\dfrac{4}{15}+\dfrac13v-\dfrac23v[/tex]

Evaluate the like terms (take LCM)

[tex]\dfrac{-6 * 3 + 4}{15}+\dfrac{v - 2v}3[/tex]

Evaluate the like expressions

[tex]-\dfrac{15}{15}-\dfrac{v}3[/tex]

Hence, the equivalent expression of [tex]-\dfrac65-\dfrac23v+\dfrac{4}{15}+\dfrac13v[/tex] is [tex]-\dfrac{15}{15}-\dfrac{v}3[/tex]

Read more about equivalent expression at:

https://brainly.com/question/2972832

#SPJ1

Which statement about digital payments is true?
A. Digital payments are becoming less safe than ever.
B. Digital payments are more common than ever.
C. Digital payments are more convenient for buyers but less
convenient for sellers.
D. Digital payments are being replaced by cash and credit cards.

Answers

Answer:

it think it is B. Digital payments are more common than ever.

Step-by-step explanation:

"Significant gains have been recorded, however, in the share of consumers using two or more digital payments methods, which jumped from 45 percent last year to 58 percent in 2020 "

Hope This Helped

What is the length of the diagonal from B to D of this rectangle? Round your answ
to the nearest tenth of a metre.

Answers

Answer: 19.7

Step-by-step explanation:

By the Pythagorean theorem,

[tex](BD)^{2}=8^{2}+18^{2}\\\\(BD)^{2}=388\\\\BD=\sqrt{388} \approx \boxed{19.7}[/tex]

Other Questions
Evaluate the following for the given values. 7xy - y + x - 1 for x = -2 and y = -1 Which term matches the picture? What hint does the author of how to jump start a battery give for remembering that you should connect the positive clamp onto the battery before the negative clamp Who created the Universal Declaration of Human Rights?Select one:a.Pierre Elliot Trudeaub.UN General Assemblyc.Lester B. Pearsond.Amnesty International Which associations best describe the scatter plot?Select each correct answer.Positive associationNegative associationLinear associationNonlinear association Escribe canciones originales. PLEASE HELP!!!! Which of the following scenarios is related to ethical issues?O A. A client confides to a nurse aide that her parents physically abuse her.O B.A nurse aide notices cigarette burn marks on a client when helping her dress.O C.A nurse aide sees her colleague stealing drugs from the healthcare facility.OD. A nurse aide does not properly sterilize medical equipment so she can leave early.OE. A nurse aide avoids attending to clients from a particular socio-economic background.UndoNext The quarks that compose a baryon may have charges of:. If f(x) = x - 2x, find:f(5) = [?] Given f(x) = x^4. if the function is transformed so that the inflection point is (-2, 1). write the new function. Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!!