Select the correct texts in the passage. Which line of dialogue best develops the character of Demetrio in the cultural setting? adapted from The Underdogs by Mariano Azuela "Tonight or tomorrow at the latest we'll meet the Federals. What do you say, boys, shall we let them find their way about these trails?" Demetrio asked. The ragged crew jumped to their feet, uttering shrill cries of joy; then their jubilation turned angry again and they gave vent to threats, oaths and imprecations. "Of course, we can't tell how strong they are," said Demetrio as his glance traveled over their faces in scrutiny. "Do you remember Medina? Out there at Hostotipaquillo, he only had a half a dozen men. Well, he held back the soldiers, didn't he? And he defeated them, too. " "We're every bit as good as Medina's crowd!" said a tall, broad-shouldered man with a black beard and bushy eyebrows. "Viva Demetrio Macias," they all shouted.

Answers

Answer 1

The line of dialogue that best develops the character of Demetrio in the cultural setting is: " "We're every bit as good as Medina's crowd!" said a tall, broad-shouldered man with a black beard and bushy eyebrows. "Viva Demetrio Macias," they all shouted.

The cultural setting is revealed in elements of the prose that show the food, language, dressing of the people being talked about.

In the above dialogue, we find elements of the Spanish language when the crowd hailed Demetrio as: "Viva Demetrio Macias."

This reveals the cultural setting of the people.

Learn more about the cultural setting here:

https://brainly.com/question/24843498

Answer 2

Answer:  What do you say, boys, shall we let them find their way about these trails?"

Explanation:


Related Questions

Waving hands, cheered the audience.

1. Gerunds

2. Present participle

3. Verb

4. None of these

fast helpppppppppppppppppppp

Answers

Answer:

i think option b

but it can be wrong or right you decide it

Asher wants to compare the subjects of the poems "The Great Wave: Hokusai" and "Landscape with the Fall of
Icarus" by analyzing their structures
Asher should pay the most attention to
O the length and complexity of the lines in each text.
O the way each text describes the subject.
O the kinds of words each author used in each text.
O the attitude each text has toward the subject.
Dr.
Å

Answers

Answer:

the way each text describes the subject.

Explanation:

this is the correct option because if we choose A , the length and complexity of the lines in each text would not explain the subjects he wants to compares. If we choose C it would be wrong again because kinds of words the author uses in each text depends on the situation. it can both be positive and negative.And if we choose D the attitude describes the scenario and the part of the subject not the subject itself. The best option is B because it explains the subjects which are to be compared.

The fact that the subject of the poems are compared by their structures, attention should be paid to B. the way each text describes the subject.

What is text structure?

It should be noted that text structure simply means that the way that the information in a text is organized.

In this case, fact that the subject of the poems are compared by their structures, attention should be paid to the way each text describes the subject.

Learn more about structures on:

https://brainly.com/question/12053427

#SPJ5

22) You have been assigned to write an essay about the most exciting day of your life. Which answer might be a "brainstorming prewriting exercise with regard to this subject? A) Was it the most exciting day of my life, or not? B) 'The Most Exciting Day of My Life by Chris Main I'll never forget the most exciting day of my life. most exciting day: --won the big game? -day my brother was born? - day I graduated from high-school? ​

Answers

The answer is b- ‘ the most exciting day of my life by Chris Main l’ll never forget the most exciting day of life.

The "brainstorming prewriting exercise with regard to this subject is 'The Most Exciting Day of My Life by Chris Main I'll never forget the most exciting day of my life.

What is a prewriting exercise?

A prewriting exercise is a traditional way of practicing before writing anything.

This is also called brainstorming techniques.

The prewriting techniques are listing, free writing, clustering looping, and asking questions to the six journalists.

Thus, the correct option is B.

Learn more about prewriting exercise

https://brainly.com/question/1090632

What is the purpose of adding transition words to a report?
to pique the reader’s attention about the report topic
to help sentences and paragraphs flow from one to the next
to remind the reader what he or she learned about in the report
to draw attention to important points and ideas

Answers

Answer:

B.

to help sentences and paragraphs flow from one to the next

Explanation:

I'm pretty sure this is it, if it's not, please tell me.

They started building the house last month.

Answers

Answer:

what house?

Explanation:

im really confused

Answer
Who and what house?

I think you...... eat vegetable. Ít is good for health

Answers

Answer:

Should

Explanation:

I think you should eat vegetable. It is good for health

Last year we _____ (go) to the fair every Sunday​

Answers

Last year we went to the fair every Sunday.

Answer:

Walk

Explanation:

Walk also make since

When enhancing your style for diction, why is it important to pay attention to
words you choose?

Answers

Because word choice can help when you want the reader to stay engaged to what you’re writing. To WANT to keep reading not NEEDING to keep reading. You as the writer want them to want to keep reading to dread your work.

did the scottsboro actually commit the crime

Answers

Answer: Despite claims of innocence, the Scottsboro boys were convicted by all-white juries. All but one of them served time on death row. The next two decades were full of appeals and one retrial where one victim said they abuse her but it never happened.

Explanation:

what does rifkins style and language tell you about him?

Answers

Answer:

(Rifkin, 7). His style in this is relatively simple, he makes a point, and backs it up with evidence immediately to solidify his claim without providing to much in the way of personal rhetoric. This allows the reader to accept his point of view without having to yet acknowledge any strong counter-claims.

Explanation:

Answer:

I can usually say that the author's style can tell the reader how personal or how connected the author is with the writing itself. If the writing uses more vivid imagery and detail, you can tell that the author recalls perfectly or has an expansive and creative mind.

Some times, when authors use vague words or general imagery, they may be leaving it up for interpretation, mysteriousness, or the author wants to focus on different detail.

There's methaphors, allusion, symbolism, and more to watch for.

Explanation:

What suggestions do you wish to give to your school administration to improve the education quality?
Help plzzz I'll mark as brainliest
I'll give u many points as well

Answers

well my school has like a last resort class where if you're failing or wanting to drop out or just have special circumstances where you no longer wish to go to normal classes, they'll put you in a program that you do all of your classes online and can graduate earlier even if you were behind in the normal classes.

Modified True or False

Direction: Write True if the statement is correct. If it is incorrect, underline the word that makes the statement untrue then write the correct word. Write your answer in your test notebook.
________1. Mango is an example of fruit with high acidity.
________2. Foods with low amounts of hydrogen ion have low ph.
________3. Oily products tend to spoil slowly when inadequately packaged.
________4. When foods undergo chemical processes, foods may already be considered spoiled.
________5. Secondary package allows for the unit packs to be carried in bulk.
________6. Use of the primary package is normally for bulk transport in large warehouses.
________7. Foil packaging is one of the oldest and most common methods of food packaging in homes.
________8. Manufacturers should appear on the label of the food package.
________9. Canned foods come in a limited variety.
________10. When labelling, instructions for use should appear on the food package.

Answers

Answer:

.false .false .true

Explanation:

1.false 2 false 3.true

Essay on why soccer players should wear headgear

Answers

um Concussions

Answer:

Un  why would yall do an essay on soccer get a life.

Explanation:

Explain: ‘’poised beyond her years’’ and give an instance to support your answer. ‘Maria Sharapova”

Answers

Answer:

Definition of poised ; having poise: ;To be wise beyond one's years is to display a vast level of wisdom, maturity or just commonsense for someone of a young age; to have knowledge that it takes others a lifetime to figure out. Sometimes refer to the person as an “old soul”, as if he/she has lived before (e.g. reincarnation).

Explanation:

"Poised beyond her years" means more calm, confident and in control than people of her age usually are.Maria Sharapova was just eighteen years of age when she was ranked the world number one in women's tennis.

Hope you could understand.

If you have any query, feel free to ask.

She wishes that she.....a good student.

Answers

Explanation:

she wishes that she was a good student Because she " wishes " indicates for the thing which really hasn't happened but is only wished so this type of questions past tense should be used bit there are two past tenses was, were. she is a singular pronoun so we used was Hope this was helpful to this plus Other similar questions to Mark me brainliest plz I think my answer is deserving of that (⌒▽⌒)

At Christmas you re......gifts from your friends and family. what is the missing word?

Answers

Answer:

receive

Explanation:

Rewrite these sentences using after.
1. Despite all my warnings he still went swimming in the river.
2.The cat is chasing a mouse.
3.He studied for many hours.​

Answers

After all my warnings, he still went swimming in the river.

The Cat is chasing after a mouse

mmmmm.rkmtklmltrml.trkgmmgt

Answers

Answer:

Explanation:

Ok don't know what you mean by that

I'm a father's child, a mother's child, yet no one's son. What am I?

Answers

Answer:

you are a girl

Explanation:

Answer: adopted

Explanation: nobody likes u and u got sent to the adoption center.

Pls help I have problems with ela or engilish.

Which detail from the text best supports the answer to Part A?


“For her entire career, Katherine insisted that no one person was responsible for any specific achievement.”

“‘If we were off by just a few feet or seconds, they were done for,’ she remembered. ‘The astronauts wouldn’t have been able to return home.’”

“The Soviet Union took the lead again when it came to sending a man into space.”

“The landing and successful return of Apollo 11’s flight to the moon made headlines all around the world. And it could not have been possible without Katherine’s help.”

Answers



“The landing and successful return of Apollo 11’s flight to the moon made headlines all around the world. And it could not have been possible without Katherine’s help.”

The dedication page is where contents can be found
is it true or false, if it's false explain

Answers

it’s true because your teacher says so

What was sheriff Tate's rationale for not revealing Arthur Radley's role ??? Please help !

Answers

Sheriff Tate’s rationale was that Boo (Arthur) was a recluse. He did not like being around people let alone being in the spot light, which is what would happen if Boo was revealed. Bob Ewell was a bad man, who would continue to do bad things. No body was going to be upset that he was gone.

(PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!)
Sometimes, people do not realize just
how amazing they really are; this is evident
in Alberto Moravia’s “Poor Fish.” Using
textual evidence, explain the narrator’s
struggle in “Poor Fish.” Then, discuss
whether one person’s support and belief of
another can positively affect that person.
*This must be written in third person, and
each body paragraph should include at least
one direct quote from the text.

Answers

Answer:69

Explanation:

Which sentence uses commas correctly?? Plz answer rn plzzzz I will make brainiest

Answers

Answer:

C

Explanation:

The answer to that question is C.

I NEED ANSWER PLEASE IT'S MISSING! I NEED ANSWER NOW!!!

Answers

Answer:

Best option seems to be three.

Explanation:

It cannot be one or two becuase those are facts, not anything about the person in the article. It doesn't seem to be four becuase being good at electronics doesn't nessarily make you creative.

Come up with four interesting interview questions for the leader of the mission sending humans to Mars. You are only providing your questions, not the answers that could be given to those questions.

Introduce yourself and explain the purpose of the interview.
Do not ask questions that can be answered with "yes" or "no." Ask questions that begin with how, what, or why. They will prompt your source to give more detailed answers.
Be courteous and friendly. Make the interviewee feel comfortable answering your questions.
Sentence Starter: Hi, my name is ___________________________. I was asked to be a member of the first human mission to Mars, but before I respond, I have a few questions for you.

Answers

Answer:

Hi my name is Jocalyne. I was asked to be a member of the first human mission to Mars, but before I respond, I have a few questions for you.

(1) How do you plan on sending humans up to Mars?

(2) What do you plan on doing when you send those people into space?

(3) Do you have a plan if something bad happens?, if so please explain.

(4) Why are you sending humans why not a vegetable or a bunny?

Explanation:

I hope this helps

(I used my actual name as well)

Answer:

I would suggest using questions like these-

1. What do you plan to do once arriving on Mars?

2. How safe do you believe this trip will be?

3. Why are you going to Mars?

4. Did you choose to be leader of this trip, or were you forced, and why did either or take place?

Hopefully this is useful! I apologize if it's not.

Can someone plz help me? :(

Answers

I would say B. Jin had a hard decision to make. Her friends birthday party was Saturday, but so was her brothers soccer tournament. Although she could go to one, but also she could go to the other

Fill in the Correct Alphabet in blank ~

Teen_

Options :

A. y

B. y

C. y

D. y


it's hard !!​

Answers

Answer:

b.y hi

Explanation:

4. Why should main points be limited in a speech?

Answers

Answer:

Because you will need to further elaborate.

Explanation:

If you have too many main points, you will need to have a long speech, and most speeches are supposed to be concise and to the point.

prompt: which is more important, a person's freedom or a person's safety?
pls help me write my essay :')

Answers

Answer:

Here’s something to consider: does safety outweight freedom? According to H.L.

Menchen, “The average man does not want to be free. He simply wants to be safe.” Safety does,

in fact, outweigh freedom because there is more of a sense of security in safety that in freedom.

Although some people might think that freedom is more important than safety, in reality, it is the

other way around with safety winning the battle of importance. Safety gives people a good sense

of security and makes them feel like they are doing the right thing in life.

One example that safety gives people a sense of security is being able to keep a job. Since

the economy dropped in 2008, many people have been worrying about the necessities in life.

They wonder if they will keep their jobs, if they’re going to be able to pay the bills, and if they

will be able to provide for their families and for themselves. A good number of people have been

laid off since the recession. For instance, Toyota has laid off numerous people who work the

assembly line. This leads to the employees worrying if their job is safe and most important, if

they themselves are safe.

Another example of security found in safety lies in the theory called Maslow’s Hierarchy

of Needs. This is a diagram of a triangle that describes what the basic needs are for people

according to Maslow. At the bottom of this triangle lies security and safety. It is at the bottom

because it is the most important need and is the first step to achieve total happiness in life. While

at the top there are selfless behaviors, it is the last need. However, to accomplish this you need to

start at the bottom and work up from there. It all starts with the most important needs of safety

and security.

While safety is a great thing, others feel like freedom is the ultimate goal to achieve. For

example, during the time period where African Americans were slaves, freedom was the most

important thing in life. Many slaves risked their lives to escape the hellhole where they worked.

It wasn’t until Abraham Lincoln passed the Emancipation Proclamation that African Americans

were free. Nevertheless, while African Americans might have been freed, they still had to worry

about their safety as they were heavily discriminated against and still weren’t treated equally.

In conclusion, safety provides people with a sense of security when freedom cannot. It is

the biggest and most important need people need to strive for in life. Without safety, there can be

no peace of mind and ultimately no complete happiness.

Explanation:

Other Questions
16. All of the following are elements of culture EXCEPT______a. Economic Systemsb. Governmentc. Languaged. Food What do the following two equations represent?. 4x + 2y = 10 4x 2y = 10Choose 1 answer:The same lineDistinct parallel linesPerpendicular linesIntersecting, but not perpendicular lines If you are the driver or owner of a vehicle which is in a crash that is your fault and you are not. Malik jogged 2 miles in 20 minutes.What was his rate in miles per hour?10 miles per hour6 miles per hour23 mile per hour110 mile per hour the smallest division value of electronic balance Astatine-218 has a half-life of 1.6 seconds. If you begin with a 1.7 g sample of astatine-218, how much of the sample remains after 3.2 seconds? explain different users of computer in briefly? Find the area of the cuboid. The valence electrons of a krypton (Kr) atom in the ground state are located in theA. first energy level (shell).B. second energy level (shell).C. third energy level (shell).D. fourth energy level (shell). Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest