Question 8 (5 points)
A map showing the member, candidate, and non-EU nations in Europe. The member nations colored in blue are Portugal, Spain, France, Ireland, the United Kingdom, Italy, Belgium, Germany, Denmark, the Netherlands, Czech Republic, Austria, Hungary, Slovakia, Poland, Lithuania, Latvia, Estonia, Finland, Sweden, Malta, Greece, Slovenia, Luxembourg, Bulgaria, Romania, and Cyprus. The candidate nations colored in red are Turkey, Macedonia, and Croatia. The non-EU nations colored in green are Iceland, Norway, Russia, Belarus, Ukraine, Moldova, Albania, Bosnia and Herzegovina, Serbia, and Montenegro.
© 2012 The Exploration Company

In what way will membership in the European Union most benefit candidate nations? (5 points)

Question 8 options:

1)

Economically


2)

Religiously


3)

Politically


4)

Socially

Answers

Answer 1

Answer:

It's no. 1 economically

Answer 2

Answer: Number option 1, economy

Explanation: i have taken the quiz and passed completely so ask if you need anymore help :)


Related Questions

What was the primary demand of the
newly-founded Republican Party? PLS HELP!!

Answers

The Republican Party emerged in 1854 to combat the Kansas–Nebraska Act and the expansion of slavery into American territories.

Their main demand was to oppose slavery and make it illegal on a federal level

What is the difference between rose and cabbage?​

Answers

Explanation:

rose is flower

cabbage is vegetable

Roses are different colors and cabbage is green

reduced the chances of a devastating nuclear war during the late 1960s and early 1970s? OPEC containment affirmative action détente

Answers

Answer:

Detente

Explanation:

Detente was the term given to the improvement of relations between the USA and USSR after The Cuban Missile Crisis when the two countries had almost gone to war.

Paper money printed in Canada cannot be exchanged for gold or silver. Its value is entirely based on consumers' faith in the Canadian government that
issued it. This makes paper money in Canada an example of:
A. Inflated Money
B. Commodity money
C. Representative money
D. Fiat money

Answers

Answer:

D

Explanation:

Fiat money

Based on the fact that Canadian money cannot be exchanged for gold or silver and is backed by faith in the Canadian government, this is D. Fiat money.

What is fiat money?

This refers to a type of currency that is not backed by any natural minerals such as gold or silver. It is instead backed by the faith of citizens in the government that issues it.

It is the dominant currency in the world at this point because currencies backed by minerals came with several complications.

Find out more on fiat money at https://brainly.com/question/1107162.

which argumentative statement is a claim ofvalue?​

Answers

~!+~!+~!+!+~!+~!+~!+~+!+~+!+~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+~!+~+!+~+!~+!+~+!~+!~+!~+!~+!~+!~+!~+!~+!~+~!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~

Hello! If this answer doesn’t fulfill all of your questions, or it doesn’t have the exact information you are looking for, I apologize. But, I will try to help you to my best ability! <3

Answer:The correct answer is D: Is responsible to throw away uneaten food. Explanation:Claims of value give a sense, express approval or rejection, or try to show that some action, belief, or position is right or wrong, etc.

Again, hope this helps! Good luck! :D

~!+~!+~!+!+~!+~!+~!+~+!+~+!+~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+~!+~+!+~+!~+!+~+!~+!~+!~+!~+!~+!~+!~+!~+!~+~!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~+!~

Arrange The jumbled letters below to identify some of them.

Answers

Answer:

Answer

1.SUBANEN

2.BANWAON

3.TIRURAY

4.MANOBO

5.BAGOBO

6.BILAAN

7.TALAANDING

8.MANGUWANGAN

9.DIBABAWON

10.HIGAONON

Sana makatulong po ito tama po yan lahat☺️♥️

Why did France award the Statue of Liberty to New York City>?

Answers

Answer:

Around 1865, as the American Civil War drew to a close, the French historian Edouard de Laboulaye proposed that France create a statue to give to the United States in celebration of that nation's success in building a viable democracy.

identify three documents on the timeline that are examples of social contract

Answers

So a social contract is where a "persons' moral and/or political obligations are dependent upon a contract or agreement among them to form the society in which they live".
Rousseau was most famous for coming up with the term but examples have always existed and exist right now.

An example of how a social contract works would be the legal system. For augments sake, if I say you stole all my money and you deny it, instead of fighting it out with fists or me raiding your house to find it with a gun, we both put our faith in the legal system which we both agree will be more impartial, and get to the truth. I surrender my right to take matters into my own hands on the condition that you will also do the same. Why did we do this? Because there are more benefits than not having this system in place. I may not be able to get personal revenge on you for stealing my money but I also am protected from people doing the same to me. People who are born in a state metaphorically "sign" the contract when they are born in order to live in the state.

A primitive example if you want would be that two people meet in the woods looking for berries. Both have guns and are distrustful of the other. They are constantly looking over their shoulders at each other out of fear which prevents them from going about their berry gathering. Eventually they both agree to a "contract" that they will both give up their guns at the same time. They do this because whilst you do not want to give up your gun, it means that you don't have to worry about getting shot in the back so times are more productive.
The theory is the same even if people disagree on why social contracts exist. Folk like Rousseau thought that social contracts arose because at the end of the day, humans are more interested in personal liberty and life and wish to avoid conflict as much as possible. More pessimistic people like Hobbes thought it was because humans are so naturally warlike that we needed social contracts to prevent our own violent natures.

Which of the following groups would most likely agree with the depiction of President Roosevelt in "Fearing Deficits "?

Answers

Answer: Wealthy Conservatives

Explanation: Took the test :)

Answer:

B. Wealthy conservatives

Explanation:

Took the quiz.

What was on the war clothing of a crusader?

a
A Lion
b
A Photo of Pope Urban II
c
A Church
d
A large red cross

Answers

Answer:

D. A large red cross

Explanation:

d is the answer yuhyuh

Why did Narmer establish Memphis as his capital?

Answers

Answer:

Some believe the first king of Egypt, Menes, built the city after the unification of Egypt. He was the protector of god, the area around Memphis, and became the patron deity of the city after it was built in his honor.

Explanation:

How do members of the U.S. House of Representatives vote on bills?

Answers

Answer:

A representative sponsors a bill first, If released by the committee, the bill is put on a calendar to be voted on, debated or amended. If the bill passes by simple majority, the bill moves to the Senate. At the Senate, the bill is assigned to another committee and, is released, debated and voted on

Explanation:

explain what Julius and Ethel Rosenberg and Alger hiss did to America and what effects did those actions have on america ?

Answers

Answer:

Julius Rosenberg and Ethel Rosenberg (née Greenglass) were American citizens who were convicted of spying on behalf of the Soviet Union. The couple were accused of providing top-secret information about radar, sonar, jet propulsion engines and valuable nuclear weapon designs (at that time the United States was the only country in the world with nuclear weapons). Convicted of espionage in 1951, they were executed by the federal government of the United States in 1953 in the Sing Sing correctional facility in Ossining, New York, becoming the first American civilians to be executed for such charges and the first to suffer that penalty during peacetime.

Other convicted co-conspirators were sentenced to prison, including Ethel's brother, David Greenglass (who had made a plea agreement), Harry Gold, and Morton Sobell. Klaus Fuchs, a German scientist working in Los Alamos, was convicted in the United Kingdom.[5][6]

For decades, the Rosenbergs' sons (Michael and Robert Meeropol) and many other defenders maintained that Julius and Ethel were innocent of spying on their country and were victims of Cold War paranoia. After the fall of the Soviet Union, much information concerning them was declassified, including a trove of decoded Soviet cables (code-name: Venona), which detailed Julius's role as a courier and recruiter for the Soviets. Ethel's role was as an accessory who helped recruit her brother David into the spy ring and who worked in a secretarial manner typing up documents for her husband that were then given to the Soviets. In 2008, the National Archives of the United States published most of the grand jury testimony related to the prosecution of the Rosenbergs.

Do you think the German people should have been blamed for WWI ?

Answers

Not every single German person who was alive during WWI, but the German government and officials definitely deserved blame. Children and innocent civilians have nothing to do with it.

Why was Egyptian President Anwar Sadat assassinated in 1981?
O Muslim extremists wanted to start a war with Egypt.
O Jewish extremists were retaliating for the events at the Munich Olympics.
O Jewish extremists were unhappy with the loss of territory in the Sinai Peninsula.
O Muslim extremists felt betrayed by his decision to make peace with Israel.​

Answers

The Egyptian President Anwar Sadat, assassinated in 1981 because Muslim extremists felt betrayed by his decision to make peace with Israel.​

Who was Anwar Sadat?

Anwar El Sadat served as the third President of Egypt from 1970 until his assassination in 1981. During his time as President, Sadat introduced greater political freedom and a new economic policy to Egypt.

Sadat grew up in Egypt under British rule and advocated for dialogue and building relations between countries for peace. In the early 1950s, he and several others overthrew the ruling monarchy in Egypt.

Thus, option D is true, as Muslim extremists felt betrayed by his decision to make peace with Israel.​

Learn more about Anwar Sadat here,

https://brainly.com/question/10351735

#SPJ5

Which statement best completes the diagramn?
Factors Leading to the
Rise of the Byzantine
Empire
The Roman Empire
became too big to be
ruled by one person
Byzantine troops
conquered western
European territory
?
O A. Byzantium became the center of the Catholic faith.
O B. The pope called for a crusade against Muslim invaders.
O'C. Common people in Rome were given the chance to become
leaders
O D. Strong leaders like Justinian and Theodora held power

Answers

Answer:

I think the answer is D.

Answer:

D

Explanation:

Was the Korean War a success for the United States

Answers

Although the war ended where it began, the United States and its allies did succeed and preventing communism from overtaking South Korea.

What caused so many banks to fail during the Great Depression?

A. Most banks failed due to people unwilling to use saving accounts.
B. Most banks failed due to over-investing and risky business practices.
C. Most banks failed because the outbreak of communism made private property illegal.
D. Most banks failed due to over government intervention and regulation.

Answers

Answer:

B - Most banks failed due to over-investing and risky business practices

Explanation:

Several banks failed during the Great Depression for a variety of reasons. The primary reasons for bank failure were excessive investment and risky business practices.

So, choice B is the right one.

What caused the banking system to fail in 1929?

The average price dropped by the same amount as the money that was readily available.

In addition to pushing banks, businesses, and individuals into bankruptcy, this deflation also increased debt loads, skewed economic decision-making, decreased consumption, and increased unemployment.

Visit the following link to learn more about the Great Depression:

https://brainly.com/question/27291778

#SPJ5

in which battle Salahuddin Ayubi died ?​

Answers

Answer:

jdidjdodkdkd

Explanation:

Answer:

I think he was poisoned not killed in battle

Explanation:

This Christian organization placed an emphasis on communal living and self-sacrifice. Moral Majority Focus on the Family Trinity Crusade Children of God

Answers

Answer:

Christian ethics, which is also referred to as moral theology, is a multi-faceted ethical system: it is a virtue ethic which focuses on building moral character, and a deontological ethic (divine command theory) which assesses choices. It also incorporates natural law ethics, which is built on the belief that it is the very nature of humans – created in the image of God and capable of morality, cooperation, rationality, discernment and so on – that informs how life should be lived, and that awareness of sin does not require special revelation.[1]:93 Other aspects of Christian ethics, represented by movements such as the social Gospel and liberation theology, may be combined into a fourth area sometimes

You deposit $2000 each year into an account earning 3% interest compounded annually. How much will you have in the account in 15 years?

Note: Round your answer to the nearest cent.

Answers

Answer:

She will have $30,900

Explanation:

3% of 2000 is 60

2000+60=2060

2060X15=30,900

Question 5 of 11
The U.S. government sometimes attempts to increase economic growth by:
A. spending money to create government jobs.
O B. removing all competition in specific industries.
O C. encouraging high rates of inflation.
O D. measuring the consumer price index.

Answers

A spending money to create government jobs

Answer:

A

Explanation:

A-P-E-X

SOMEONE PLEASE ANSWER THIS

Answers

Answer:

The Articles of the confederation was the first constitution that the colonists of the US created. The article created a government that was weak-centered and that was also a loose confederation of state sovereignty.  

Explanation:

The Articles of Confederation was considered a weak document because of how it was created aka it's weakly centered government and it's loose confederation of sovereign states which gave too much power to the states rather than to the government itself.

what were some of the justifications for slavery? list 4 justifications

PLEASE HELP ​

Answers

Answer:

economics, history, religion, legality,

Explanation:

The defenders of slavery included economics, history, religion, legality, social good, and even humanitarianism, to further their arguments. When a society forms around any institution, as the South did around slavery, formulating a set of arguments to support it is expected.

After early colonial losses to the British in New York,
the colonies ratified the Declaration of Independence.
General Washington set up headquarters in New Jersey.
O the Continental army set up headquarters at Fort Lee.
O General Washington withdrew his troops to Pennsylvania.

Answers

Answer:

d

Explanation:

GENERAL EISENHOWER’S ORDER OF THE DAY

Answers

Eisenhower's Order of the Day (1944) Soldiers, Sailors, and Airmen of the Allied Expeditionary Force! You are about to embark upon the Great Crusade, toward which we have striven these many months.

please mark in brain list

Question 4 of 5
What role did the shoguns play in the Japanese feudal system?
O A. The fought wars and collected taxes.
O B. They were the most respected leaders.
O C. They were important military rulers.
to food

Answers

Answer:

the answer is c.

Explanation:

The role played by Shoguns in the feudal system of Japan is of military rulers. Thus the correct option is C.

Who were shoguns?

Shoguns were military chiefs who were appointed by the high Authority in Japan. They collaborated with civil workers who managed initiatives like taxes and trade.

Shoguns were in charge of regulating and establishing legal and financial government positions. They aided in the integration of the several tribes and forced them to work together.

Therefore, option D important military rulers were important is correct.

Learn more about  shoguns, here:

https://brainly.com/question/8293345

#SPJ2

Under fascism, the government is led by
a) a democratically elected congress
b) a dictator with total power
c) a council of elected rulers
d) an international congress like the United Nations​

Answers

The government is led by a dictator with total power have a great day (:

Why was the win a "miracle"? Why was it "a lot more a than hockey game?"

Answers

Answer:

If you go to  

Sandboxxhttps://www.sandboxx.us

and look for: The miracle on ice was more than a hockey game.

You will find your answer(s) there.

Explanation:

Hope that this helps! :) It's too much for me to put here.

How did Harriet Beecher Stowe's Uncle Tom's Cabin support reform efforts?

Group of answer choices

It introduced the idea of free public education.

It showed people the horrors of slavery .It showed how slavery was a cruel and brutal system. .

It brought the housing crisis to peoples's attention.

Answers

Answer:

ow did Harriet Beecher Stowe's Uncle Tom's Cabin support reform efforts? It stirred support for women's rights. It introduced the idea of free public education. It brought the housing crisis to peoples's attention.

Explanation:

That is what I know on the subject

Other Questions
Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future? Suppose consumption is a linear function of disposable income: C(YT) = a + b(Y T), where a > 0 and 0 < b < 1. Suppose also that investment is a linear function of the interest rate: I(r) = c - dr, where c> 0 and d > 0. a. Solve for Y as a function of r, the exogenous variables G and T, and the model's parameters a, b, c, and d. b. How does the slope of the IS curve depend on the parameter d, the interest rate sensitivity of investment? Prepare a 5 mins PPT presentations with voice overs to the board members on the financial strength of Cool-Ice especially in financing its long-term loan. find the two x-intercepts of the function f and show that f '(x) = 0 at some point between the two x-intercepts. f(x) = x x 2 There are 20 problems in a mathematics competition. The scores of each problem are allocated in the following ways: 3 marks will be given for a correct answer. I mark will be deducted from a wrong answer and O marks will be given for a blank answer. Find the minimum number of candidate(S) to ensure that 2 candidates will have the same scores in the competition. In which of the following instances would the independence of the CPA not be considered to be impaired? The CPA has been retained as the auditor of a brokerage firmA. Which owes the CPA audit fees for more than one year.B. In which the CPA has a large active margin account.C. In which the CPA's brother is the controller.D. Which owes the CPA audit fees for current year services and has just filed a petition for bankruptcy. The dataset catsM is found within the boot package, and contains variables for both body weight and heart weight for male cats. Suppose we want to estimate the popula- tion mean heart weight (Hwt) for male cats. We only have a single sample here, but we can generate additional samples through the bootstrap method. (a) Create a histogram that shows the distribution of the "Hwt" variable. (b) Using the boot package, generate an object containing R=2500 bootstrap samples, using the sample mean as your statistic.