Provide your answer in the following format: [element name], [chemical family]

Provide Your Answer In The Following Format: [element Name], [chemical Family]

Answers

Answer 1

Answer: Bismuth (Bi) , Nitrogen family

Explanation:

As the element has 5 valence electrons in the sixth energy level, which mens it belongs to 6th period as the valence electron has entered the 6th energy level.

Now as the electrons are  filled according to afbau's rule , the electronic configuration of the element will be :

[tex][Xe]4f^{14}5d^{10}6s^26p^3[/tex]

Now as the atomic number of element is equal to the number of electrons in a neutral atom , the atomic number is 83 and the element is Bismuth (Bi). As the last electron enters p -subshell , it is  a p block element. It lies in group 15 which is nitrogen family.


Related Questions

help with this question

Answers

Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:

What is a mixture of sugar and water?

a solution

molecule

a compound

a precipitate

Answers

Explanation:

I think its a solution just me tell me in comments if right

Answer:

A solution

Explanation:

Sugar is soluble in water and would dissolve into the water to form a solution.

If you start with 14.0 grams of diatomic nitrogen (N2) how many grams of diatomic hydrogen (H2) will react with it?

Answers

Answer:

I just need points

Explanation:

whegehhwjwjwhehebebejeuhebehejejbebe

WILL GIVE BRAINLIEST (major help!!! need now!!!) David observed properties of four different compounds, only one of which is an ionic compound. His observations are shown in the chart.
A 2-column table with 4 rows. The first column labeled compound has entries W, X, Y, Z. The second column labeled observations has entries is a hard solid, melts at 44 degrees C, has a molecular structure; is a brittle solid, does not conduct electricity in water, has a crystal structure; is a hard solid, conducts electricity, has a molecular structure; is a brittle solid, melts at 801 degrees C, has a crystal structure.

Which is most likely the ionic compound?


W

X

Y

Z

Answers

Answer:I think it’s y sorry if I’m wrong

Explanation:

Answer:

i think it might be y

Explanation:

How can magnetic force be exerted on objects?

1)Over a distance and anytime an object is in a magnet's field of influence.

2)Only through objects.

3)Only by touching an object.

Answers

I think the answer is : 1

Given a balanced chemical equation it is always possible to determine
A)
the physical state of the products and reactants
B)
whether a reaction will or will not take place
C)
the relative number of moles taking part in the reaction
D)
the conditions necessary for the reaction to take place

Answers

Answer:

C)  the relative number of moles taking part in the reaction

Explanation:

From a balanced chemical equation, it is always possible to determine the relative number of moles taking part in a chemical reaction.

The number of moles is the amount of the reacting specie that makes up a chemical reaction.

In balanced chemical equation, the number of moles of reactants and products must be the same. From this understanding, we can determine the amount of reactants and products needed for a chemical reaction to take place.

Which is the correct Lewis dot structure for BeH2 ?

Answers

H• •Be• •H --> H:Be:H
Since there are 4 valence electrons in total, Beryllium has 2 and Hydrogen has 2. You would put the Be in the middle because there is only 1 of them.

The correct Lewis dot structure for [tex]BeH_2[/tex] is Be : H : H

What does the  Lewis dot structure show?

The Lewis dot structure shows the valence electrons as dots. The valence electrons of beryllium are shown as 2 dots on the left side of the atom.

The central atom, beryllium, has 2 valence electrons where each hydrogen atom has 1 valence electron. To form a stable molecule, beryllium shares its 2 valence electrons with the 2 hydrogen atoms, each of which shares its 1 valence electron with beryllium which gives each atom a full outer shell of electrons.

Learn more about Lewis dot structure at:

https://brainly.com/question/28652824

#SPJ6

The chemical equation describing the burning of hydrogen gas is: 2H2 + O2 ---> 2H2O.
Why is this both a synthesis and a combustion reaction?

Answers

Answer:

"A combustion reaction is a reaction in which a substance reacts with oxygen gas, releasing energy in the form of light and heat. Combustion reactions must involve O2 as one reactant. The combustion of hydrogen gas produces water vapor." and "A synthesis reaction occurs when two or more reactants combine to form a single product. ... In a double replacement reaction, two compounds exchange elements. A combustion reaction occurs when a substance reacts quickly with oxygen. Combustion is commonly called burning"

Explanation:

I tried

How many grams are in 7.5 moles of C6H12?



Group of answer choices

0.09g

630g

11.2

84g

Answers

Answer:

630gC₆H₁₂

Explanation:

How many grams are in 7.5 moles of C₆H₁₂?

C₆:12.011×6=72.066

H₁₂:1.008×12=12.096

72.066+12.096=84.162

84.162g/mol C₆H₁₂

7.5 molC₆H₁₂ ×84.162g/molC₆H₁₂= 631.215gC₆H₁₂

DRAW A PEDIGREE

Read the following information and ON NOTEBOOK PAPER, construct a pedigree using the symbols we went over Tuesday: Scott is married to Christa. They have 3 children, Blake (a son), Peyton (a daughter), and Ashton (a daughter). Blake is married to Allie and they have 2 children, Henry (a son) and Harper (a daughter).

When you have completed your pedigree drawing, take a picture and attach it to this assignment and submit.

Answers

Answer:

Here you go

Explanation:

Susan is investigating physical changes. To do this, she places some ice into a large bowl and seals it with a lid. She leaves the bowl on the counter for several hours until all of the ice has melted. Using a balance, Susan determines that the mass of both the water and the ice are equal. Why is the mass of the ice and the water the same? (SC.8.P.9.1)

Answers

Answer:

No mass loss

Explanation:

The mass of ice and the water in the different state are equal because the same of quantity of matter is present in both state of matter of matter.

In essence, the mass of the physical change process is conserved. When mass is conserved, matter is neither created nor destroyed but can be changed from one form to the other. This is in compliance with the law of conservation of matter. So, no mass was lost in the physical change process and the mass will remain the same.

A nitrogen molecule (N2) has one triple bond. How many electrons do the nitrogen atoms share?

A. 1
B. 3
C. 4
D. 6

Answers

Answer:

3 electrons

Explanation:

Which of the following samples of water will contain the most heat?

А-1 KL of water at 20°C
B- 1 kL of water at 70°C
C- 1 mL of water at 50°C
D- 1 mL of water at 80°C

Answers

Answer:

The answer is D- make sure you give good rate

You have discovered an element that is a poor conductor of electricity, has a low melting point, and is a gas at room temperature. How would you classify this element?


A.metal

B.metalloid

C.actinoid

D.nonmetal

Answers

AHHH ITS B SORRY I ACTUALLY KNOE THIS

21 III
Choose the geologic formation that fits the description: rocks are stretched, moved
vertically into blocks, and dropped; the lower blocks are called graben and the taller
blocks called horst.
O volcanic mountains
O ocean ridges
O fault block mountains
folded mountains

Answers

Fault block mountains folded mountains

Answer:

Lifted fault block mountains

Explanation:

the force that holds paticles together in the atomic nuecleaus?

Answers

Explanation:

i believe you meant particles*

Help me please:(:(:( with my bellwork
for brainiest

Answers

Answer:

Elements are made of only one kind of atom

Compounds are made of 2 or more elements chemically bonded together

Explanation:

Its right there????

why is a rise in sea level significant?

Answers

Answer:

I honestly dont know but its cool problably from water fill or from the waves going to much

Explanation:

the answer I can think of is it might be the way the water has waves and it moves a lot

How much oxygen (O) is in 5.41 × 106 atoms of oxygen

Answers

Answer:

They show you  how to do it sweetie

Explanation:

123456789 Common math

Are the atoms really "sharing" electrons

Answers

No they are donating them

5. Which of the following elements will have a charge of 4+ or 4- as an ion?

Answers

Answer:

The answer would either be Carbon or Silicon.

Explanation:

A group of tourists were on an outing when they noticed that precipitation began to fall. The air temperature was 32 degree Fahrenheit. What type of precipitation did they most likely see?

Answers

Answer:

The correct answer is - rain.

Explanation:

At 32 degrees c or zero degrees Celsius, droplets of water in the atmosphere do not freeze as it is not the temperature at which water freezes but it is the temperature at which ice melts.

At this temperature the water changes its state, below 32 degrees Fahrenheit the water freezes but in the atmosphere, it not freezes necessarily and remains in the liquid state and called super-cooled liquid or water. Above this temperature, water in liquid state.

Thus, the precipitation is in the form of rain.

What does the salinity of sea water represent?
the concentration of salt dissolved in the ocean
A.the concentration of all

B. dissolved chemicals in the ocean

C. the volume of salt in the ocean

D.the mass of salt in the ocean

PLEASE GIVE ME THE RIGHT ANSWER!

Answers

Answer:

the answer is b

Explanation:

HELPPPPPPPPPPPPPPPPPPP

Answers

Answer:

not sure about the first one, but i know SDS provides information about the last 3.

Explanation:

If you have 2.0 moles of sodium chloride (NaCl), what is its mass in grams?

Answers

Answer:

117g

Explanation:

Given parameters:

Number of moles = 2moles

Unknown:

Mass of NaCl  = ?

Solution:

To solve the problem, we need to use the expression below;

    Mass of NaCl  = number of moles x molar mass

Molar mass of NaCl  = 23 + 35.5  = 58.5g/mol

 

So;

Insert the parameters and solve;

     Mass of NaCl  = 2 x 58.5  = 117g

how to find the electron in an atom/element

Answers

Answer:

to find the number of electrons an element has locate it on the periodic table of elements find the atomic number and note the number of protons because they are naturally electrically neutral

Answer:

M-A=N

Explanation:

M-A=N

Here is an example.

The equation above means that the atomic number (A) subtracted from the average atomic mass (M) equals the combined amount of neutrons and protons. Since we know that 35 17Cl is Chlorine (this is because Chlorine (Cl) is the 17th number on the periodic table and has the average atomic mass of 35), we can insert our data into the equation and end up with the following:

35-17=18.

From here, we can tell that we have a mix of neutrons and protons, with the total being 18. Since the atomic number is 17, we can reasonably assume that there are 17 protons and 1 neutron.

But we still need to find the number of electrons. Fortunately, the number of electrons is always equivilant to the number of protons and the atomic mass, so we know that the number of electrons is 17.

So, we have;

17 Protons

1 Neutron

17 Electrons

ayo, have some points

Answers

Answer:

aha thank you :)

Explanation:

Answer:

thank you :)

Explanation:

How many molecules are equal to 3.25 moles of carbon dioxide?

Answers

Answer:

1.957 × 10²⁴ molecules

Explanation:

The number of carbon dioxide molecules can be found by using the formula

N = n × L

where n is the number of moles

N is the number of entities

L is the Avogadro's constant which is

6.02 × 10²³ entities

From the question we have

N = 3.25 × 6.02 × 10²³

We have the final answer as

1.957 × 10²⁴ molecules

Hope this helps you

Explain why the electron configuration of 2-3-1 represents an atom in an excited state?

Answers

Answer:

See explanation

Explanation:

If we look at the electron configuration closely, we will discover that the element must have had a ground state electron configuration of 2,4.

This is because, the innermost shell usually holds two electrons while the outer shells hold eight electrons each. The four electrons must be accommodated in the second shell in the ground state configuration of the compound.

However, when the atom is excited, one electron from this shell may move to the third shell to give the excited state configuration 2-3-1 as shown in the question.

Zinc metal (Zn) reacts with hydrochloric acid (HCI) to produce hydrogen gas (H) and zinc chloride (ZnCl2). A scientist has powdered zinc and a chunk of zinc of equal mass. Available in the lab are dilute HCl and concentrated HCl. Which combination of zinc and acid would react most quickly? Explain why the combination you chose would make the reaction occur most quickly.​

Answers

Answer:

hello I am interested in the position and would like to know if you have any questions please feel free to contact me at any time if

Other Questions
For a perfectly competitive firm in the short run, what is the lowest price the firm will continue to operate at? A. Price equal to average variable cost B. Price equal to marginal revenueC. Price equal to total cost D. Price equal to average total cost E. Price equal to marginal cost PLEASE HELP ASAP!!!! WILL GIVE BRANILESTFill a 100-milliliter container with 50 grams of sand. Fill a 100-milliliter container with 50 grams of cold tap water. Fill the last 100-milliliter container with 100 grams of cold tap water. Use the scale to measure the masses.a scale measuring 100 grams of cold water in a 100-milliliter container, with 100-milliliter containers holding 50 grams of sand and 50 grams of cold water alongsidePour all the ice cubes into a tub, and fill it with cool tap water to a depth of 2 inches. Place the sand and water samples in the ice water. Cover the entire tub.three 100-milliliter containers in an ice bath inside a covered tub, with one container holding 50 grams of sand, one holding 50 grams of cold water, and one holding 100 grams of cold waterEvery 15 minutes, remove the cover and check the temperatures of the samples using the three thermometers. Wait 30 seconds before recording the thermometer reading. Once the temperatures of the three samples are no more than a degree apart, record the temperatures.three 100-milliliter containers (each with a thermometer) in an ice bath inside an uncovered basin, with one container holding 50 grams of sand, one holding 50 grams of cold water, and one holding 100 grams of cold water If you increase the frequency what happens to the distance between the waves (wavelength)?The size of the waves stays the samethe distance increases (longer wavelength)There is no way to tell.the distance decreases (shorter wavelength) Jennifer wants to buy a new television set that regularly sells for $900. Because she works at the store, Jennifer will receive an employee discount of 30% off the regular price, but she will have to pay 6% sales tax on the adjusted price. What will be Jennifer's final cost to buy the television? where do I graph it at ??PLEASEE HELP.!! ILL GIVE BRAINLIEST.!! *EXTRA POINTS* DONT SKIP:(( Question 13 (1 point)Andrew Jackson blamed John Quincy Adams and Henry Clay for stealing the 1824 election from him due to the_____ ?big deal or corrupt bargain NEED HELP IMAGE ATTACHED!!! Rewrite the linear equation x+3y=2. Solve the Inequality3x9 The lengths of the three sides of a triangle are x +3,2x, and 5x - 35. What is the value of x if the perimeter of the triangle is 112?A.17 B.18 C.12D.14E.26 How does set(ing) forth in a solemn declaration the natural, unalienable, and sacred rights of man reflect, embody, show, or exemplify Enlightenment values and/or goals? Clearly and correctly explain how this phrase does so. What is the meaning of the phrase rising star? working harder than others more popular than others showing superiority in strength growing quickly in importance Find the product of 11/12 (-2.4) Question 19 (1 point)Which of the following is an example that includes evidence of a chemical reaction? Ms. Ayers wrote a bonus problem on the board. If Jason correctly answers, he will get extra computer time. The problem is to write a statement that correctly relates the numbers 5 and 10. Which should Jason write? How did Vargas misinterpret the Pueblo's reaction to him in his initial trip? How did the Pueblo's respond to his visit? Ughhh please helpppp!!!! Mayelle earns $18,000 a year. After a raise, she earns $19,500. What is the percent of increase in pay? Round to the nearest tenth of a percent.8.3%9.2%7.7%9.5% Another one for you! this is just a little uplifting quote for all yall out there that need it. please share your own uplifting stuff to keep this place a nice vibe!