pls help me on this iready question I beg u

Pls Help Me On This Iready Question I Beg U

Answers

Answer 1

Answer:

We conclude that for 1/2 batch, Faird would require 3/8 cups of sugar.

Step-by-step explanation:

Suger needed for a full batch = 3/4Given that Farid is making 1/2 of batch

We need to determine the expression for the amount of sugar Freed needs to make 1/2 batch.

Let 'x' be the batch and 'y' be the amount of sugar

Suger needed for a full batch = 3/4 cup of a sugar

so

x = 3/4y

But, Farid is making 1/2 of the batch.

Thus, multiply both sides by 1/2

[tex]x\times \frac{1}{2}\:=\:\frac{3}{4}y\times \frac{1}{2}[/tex]

[tex]\frac{x}{2}=\frac{3y}{8}[/tex]

Therefore, we conclude that for 1/2 batch, Faird would require 3/8 cups of sugar.


Related Questions

simplify the fraction 15/20

Answers

15/20

Figure out what number to use for simplify

Which is 5

Divide the numerator and denominator by 5

15/5=3

20/5=4

Answer:3/4

Find the solution set of the inequality
- 4x + 35 > 2

Answers

Answer:

Isolate the variable by dividing each side by factors that don't contain the variable.

Inequality Form:

x < 33/4

Interval Notation:

(− ∞, 33/4)

John owns a computer repair service. For each computer he charges $50 plus $45 per hour of work. linear equation

Answers

Answer:

y=50+45x.

Step-by-step explanation:

It says  $50 plus $45 So add them and x represents the hour so y=50+45x

Can someone help me?

Answers

In the first problem M bisects like AB. Because one side is thirteen we know the other side is too. So in total the line is 26. The ray MC bisects the line AB in line two. One side is eight so the other is eight. The line in total is 16

hey does anyone know whats life is

Answers

Answer:

life is a test to see if you will go to heaven :)

Step-by-step explanation:

3 r = 7/10 can anyone explain me how to do it please.

Answers

Answer:

3r = 7/10

3r = 0.7

r = 0.7/3

r = 0.23

Step-by-step explanation:

Leo found an orange caterpillar and a green caterpillar in his backyard. The green caterpillar was 3 1/3 inches long and the orange caterpillar was 1 2/3 inches long. How much longer was the green caterpillar than the orange caterpillar?

Answers

Answer:

the green caterpillar is 5/3 inches or 1 2/3 inches longer than the orange caterpillar

Step-by-step explanation:

Subtract 3 1/3 by 1 2/3

Answer:

1 2/3 in longer

Step-by-step explanation:

Green: 3 1/3 = 10/3 (Multiply the whole number by the denominator and add that to the numerator for the new numerator).

Orange: 1 2/3 = 5/3

Difference: 10/3 - 5/3 = 5/3 (When subtracting fractions with the same denominators, just subtract the numerators and leave the denominators the same).

5/3 = 1 2/3 (To convert to a mixed number, divide numerator by denominator. The remainder is the new numerator and the quotient is the whole number).

help ASAP Which expressions have a value equal to or greater than 13?


A. five sixths x 13


B. 4 x 13


C. three fourths x 13


D. ten tenths x 13

Answers

Answer:

D. ten tenths x 13

Step-by-step explanation:

ten tenths are equal to one meaning that expression is equal to 13

1 x 13=13  

Identify all the functions that have a greater rate of change and the function represented in the graph
A y= 2x+7
B y=1.5x+ 1
C y=0.5x-5
D y=2.5x-20
E y=3x+12
F y=x +7

Answers

The equation with the greater rate of change is y = 3x + 12, which has a rate of change of 3.

A linear equation is in the form:

y = mx + b

where y, x are variables, m is the rate of change and b is the y intercept.

Given the equations, the equation with the greater rate of change is y = 3x + 12, which has a rate of change of 3.

Find out more on linear equation at: https://brainly.com/question/14323743

ILL GIVE BRAINLIEST IF YOU CAN GUESS MY AGE

Answers

Answer:

sixteen i guess?

Step-by-step explanation:

abcdefghijklmnop

Hellllllllppppppppppppppppppppppp

Answers

Answer:

All of the degrees add up to 90. Therefore, right angle.

HEY THS IS WORTH 69 POINTS

The vertices of a rectangle are A(2, 0), B(5, 0), C(5, −2), and D(2, −2). Reflect the rectangle in the y-axis, and then rotate


the rectangle 180° about the origin. What are the coordinates of the image?

Answers

Answer:

A′(-2, 0), B′(-5, 0), C′(-5, 2), and D′(-2, 2)

Step-by-step explanation:

I did FLVS (Online School stuffs)

Answer:

A

Step-by-step explanation:

Help!!!!!!!!!!!!!!.
Plzzzzzzzzzzzzzzzzzzzzzzz

Answers

I’m pretty sure the answer is 12 he can buy 12 raffle tickets hope it helps

- 4(6 + 5g) equivalent expressions

Answers

Answer:

the awnser is 4g because if you multiply the -4 by 6 and 5 g you get the equation: -24+-20g.. subtract -24 from -20 you will get 4g

4 4/10 divided by 4 2/3

Answers

Answer: Responding for points

Step-by-step explanation:

Answer:

33/35

Step-by-step explanation:

I think

Given 43-x = 21, find the value of x

Answers

Answer:

x = 22

Step-by-step explanation:

Original equation:

43 - x = 21

Subtract 43 from both sides

x = 22

Hope this helps :)

Keisha runs 7 miles in 60 minutes. At the same rate, how many miles would she run in 24 minutes?​

Answers

Answer:(24/60)*7=2.8 miles

Step-by-step explanation:

24/60x7

The answer is 2.8 miles

At the Fast-Pack It shipping, the employees can unload 25 trucks in 5 hours. Which of the following is a correct unit rate for this situation? (4 points)

5 hours per truck
1 truck per hour
1 over 5. of a truck per hour
1 over 5. of an hour per truck

Answers

Answer:

five trucks per hour

Step-by-step explanation:

Image by Scientif3
Name all of the obtuse angles that share a side with ZVON.
A. ZNOS, ZNOP, ZNOQ, VOS, ZV00, ZVOP
B. ZNOS, ZNOT, ZNOV, ZVOR, ZVOU, ZVOP
C. ZNOS, ZNOT, ZNOR, ZVOR, ZVOQ, ZVOP
D. ZNOS, ZNOT, ZNOU, ZVOR, ZVOQ, ZVOP
Please select the best answer from the choices provided

Answers

I think it’s A it looks like it so I think it is

I need helpppp (10 points )

Answers

Answer:  The flagpole is about 22.3 feet tall.

This is roughly the size of a two story building, assuming each floor is 10 feet or so.

Since this height is under 25 ft, this flagpole is in compliance with the regulation.

=====================================================

Work Shown:

The horizontal leg of the triangle is 36 ft. This is the adjacent leg to the reference angle 25 degrees.

The vertical leg of the triangle is x-5.5, and this leg is the opposite side to the reference angle 25 degrees.

Use the tangent rule to connect the opposite and adjacent sides.

Solve for x.

tan(angle) = opposite/adjacent

tan(25) = (x-5.5)/36

36*tan(25) = x-5.5

x-5.5 = 36*tan(25)

x = 36*tan(25)+5.5

x = 22.28707569358

x = 22.3 ft is the approximate height of the flagpole

Make sure your calculator is in degree mode.

The height is not over 25 ft, so this flagpole meets the requirements.

After complaining about the bonus plans, you wake up
on Conglomo's private island, where you break big rocks
into smaller rocks for $10 a day. There are 999 other
employees on the island, 998 of whom get paid the same
way you do. The last employee is your overseer, who is
paid $10 million per year.
What is the mean and median income for
workers on Super Happy Fun Island?
Which method of describing central tendency
better represents this data? Why?

Answers

Answers:

mean annual income =  $13,646.35

median annual income = $3,650

The median is a better measure of center

=======================================================

Explanation:

If you earn $10 a day, and do so for 365 days, then you earn 365*10 = 3650 dollars per year.

If there are 999 employees earning this amount, then the amount earned is 999*3650 = 3,646,350

Add on the 10,000,000 to get

10,000,000+3,646,350 = 13,646,350

The total amount earned is $13,646,350

Divide this over the 1000 people (999 workers + 1 boss)

We get: (13,646,350)/(1,000) = 13,646.35

The mean is annual income is $13,646.35

--------------------------------

The median is the middle most value. If you list out the pay amounts of just the workers, you'll get the list:

{3650, 3650, 3650, ..., 3650}

We will have 999 copies of 3650 listed out. You don't have to list all 999 of them. Just a few is a good start. The three dots indicate the pattern goes on until we reach the 999th item.

If we then tack on the overseer's pay, then we have the list

{3650, 3650, 3650, ..., 3650, 10 million}

I'm using "million" instead of the digits to avoid using commas here.

The middle won't change due to one item being tacked onto the end. The middle is going to be 3650 either due to it being part of the set, or we find the midpoint between 3650 and 3650, which averages out to 3650.

The median income is $3,650

-----------------------------------

The median income is the better measure of center because it represents where the workers are instead of some distant "midpoint" between the workers and the boss. No person is making $13,646.35 a year. They are either making $3,650 or they are making $10,000,000. There's nothing in between. So it's better go lean toward the larger group when deciding where the center should go. Think of it like a balance beam or a see-saw.

As you can see the median is not affected by outliers. We can change the "ten million" to something like "a hundred million" and the median would still be the same. I recommend you compute the mean if the overseer earns 100 million dollars, and you'll find the mean will increase dramatically. However, the median will stay where it's at. The only time the median will change is if we introduce elements that are somewhere around (either higher or lower) than 3650, and these values are close to 3650. But this won't change the center very much compared to the drastic changes the mean undergoes due to such a large outlier.

The general rule of thumb is: a large outlier to the right pulls the mean to the right. An outlier to the left pulls the mean to the left. In this case, the mean is pulled to the right. The data is skewed to the right (or positively skewed).

So again, the conclusion is that the median is the better measure of center.

True or False:
If you have an odd number of negative factors your answer will be negative. *
<3

Answers

Answer:

It's true,

I'm sure about it

Fill in the blank with the correct constant of proportionality. Pounds of Bananas Cost ($) 2, 2.50, 3, 3.75, 5, 6.25, 7, 8.75 The constant of proportionality is​

Answers

Answer:

it will go up 1 dollar now i had to do it in my head

Step-by-step explanation:

mabey if im wrong sorry

I have a picture that is 30 inches wide and 20 inches tall. I would like the
picture to be a smaller scaled copy, and it needs to be 10 inches tall. How
wide should the new picture be?*

Answers

Answer:5 inches

Step-by-step explanation:

Laura has 160 pounds of green beans at her vegetable stand. If she sells 10 pounds of green beans every hour, what is the percent decrease in green beans after 3 hours?

A
18.75%

B
81.25%

C
23.07%

D
16%

Answers

Given:

Laura has 160 pounds of green beans at her vegetable stand.

She sells 10 pounds of green beans every hour.

To find:

The percent decrease in green beans after 3 hours.

Solution:

We have,

Beans sold in 1 hour = 10 pounds

So, Beans sold in 3 hours = 30 pounds

Decrease in green beans after 3 hours is 30 pounds.

Now,

[tex]\%\text{Decrease}=\dfrac{\text{Decrease in green beans after 3 hours }}{\text{Initial amount of green beans}}\times 100[/tex]

[tex]\%\text{Decrease in green beans after 3 hours}=\dfrac{30}{160}\times 100[/tex]

[tex]\%\text{Decrease in green beans after 3 hours}=\dfrac{300}{16}[/tex]

[tex]\%\text{Decrease in green beans after 3 hours}=18.75\%[/tex]

Therefore, the correct option is A.

A person draws a card from a hat. Each card is one color, with the following probabilities of being drawn: 1/25 for green, 1/15 for blue, 1/20 for pink, and 1/5 for red. What is the probability of pulling a red or pink card, written as a reduced fraction?

Answers

Answer:

Step-by-step explanation:

0.2(red) + 0.05(pink)

=0.25

=1/4

ALLWAYS REMEMBER OR MEANS ADD AND AND MEANS MULTIPLY

The probability of pulling a red card or a pink card is [tex]\frac{1}{4}[/tex].

Probability:The area of mathematics known as probability deals with numerical representations of the likelihood that an event will occur or that a statement is true. An event's probability is a number between 0 and 1, where, roughly speaking, 0 denotes the event's impossibility and 1 denotes certainty.Step-by-Step Solution -

To remember -

'OR' means add.'AND' means multiply. [tex]0.2(red)+0.05(pink)\\= 0.25\\=\frac{1}{4}[/tex]

Therefore, the probability of pulling a red card or a pink card is [tex]\frac{1}{4}[/tex].

Know more about probability here:

https://brainly.com/question/24756209

#SPJ2

Need help ASAP!!!!
Which two ratios form a proportion?

Answers

Answer:

C

Step-by-step explanation:

Pls make me brainliest

Answer:

The answer is C 1/2 and 7/14

Two equivalent ratios for a proportion

To determine whether the two ratios form a proportion, you can compare them using a common denominator

1/2 = 7/14

1x7 = 7

2x7 = 14

7/14 = 7/14

Patrick Mahomes had 229 passing yards in his last football game.
Calculate 229 yards into feet.
O 513 feet
O 452 feet
O 528 feet
O 687 feet

Answers

Answer:

687

Step-by-step explanation:

1 yard=3 feet

229 yds x 3 ft=687 ft

Mr. Ryan was setting up the percussion section of the band. The table shows the number of students who will play each instrument in the percussion section. What is the ratio of students needed to play the Xylophone in relationship to the Bass Drum?

Answers

Answer:

ummmmmmmmmmmm

Step-by-step explanation:

need help plz its math ​

Answers

Answer:

option D 41

Step-by-step explanation:

since ∠N = ∠L

this means that MN = ML    (sides opposite to equal angles are equal)

thus

3x + 1 = 5x - 7

1 + 7 = 5x - 3x

8 = 2x

8/2 = x = 4

inserting values

3*4 + 1= 13

4*4-1 =15

5*4-7 = 13

adding all

13 + 13+ 15 = 41

option D 41

Other Questions
(Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble.