Label the part of mitosis to the action that occurs during that phase.

Label The Part Of Mitosis To The Action That Occurs During That Phase.

Answers

Answer 1

15. I

16. G

17. C

18. A

19. H

20. F

21. J

22. B

23. D

24. E

If this answer helped you, please feel free to give thanks and rate! <3


Related Questions

If the base sequence of a strand of DNA is ATGGGCCTA, what would be the base sequence of the complimentary DNA strand?

Answers

Answer:

TACCCGGAT

Explanation:

Adenine(A) always base pairs with Thymine(T) (except in the case of RNA, in which case A would base pair Uracil(U).

Cytosine(C) always base pairs with Guanine(G).

50 POINTS !!!!A credit union is a business that is owned by people who have something in common, offers you a place to keep your money, and uses your funds to make more money. A. True B. False

Answers

Answer:

true

Explanation:

Hope this helps

Answer:

The anser is FALSE

Explanation:

I just took the test and it was FALSE

What can be concluded from the graph?
The layers of Earth have different densities.
O P and S waves are absorbed in the core.
The layers of Earth do not have distinct boundaries.
O Pand S waves always originate in the mantle and travel through the core.

Answers

Answer:

Explanation: second option

Help ASAP, please
Thank you, Friends:)

Answers

irieirirkekeksksekekekekdjdjdjdkdkskdkdjdj

Help stepbro im stuck in the washer

Answers

Answer:

I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT

Laying eggs belong to which category of energy use? Maintenance, waste production, movement, growth and reproduction

Answers

Answer: it is reproduction

Explanation:

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

Question 2 (1 point)
Which two vocabulary words are synonyms (meaning similar things)?
a
revolution
b
orbit
c
latitude
rotation

Answers

Answer:orbit and rotation

Explanation:

I need help with this thank you

Answers

Answer:

A).

Explanation:

Universe > Galaxy > Solar Sytem > Earth

the anwser is A. have a good day!


"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"

Answers

Answer:

b is the answer my friend. hope this will solve your problem. mark me as brainliest

If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False

Answers

I’m pretty sure it’s true. It makes the most sense.

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

The correct answer is - proteins.

Explanation:

All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.

Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.

Select the statement(s) that is accurate about the immune system.

Answers

What’s the statements

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

Jim observes that his pet lizard is more active on warm, sunny days than at night or during rainy days.
Which statement is the most valid hypothesis he can make from this observation?
Lizards are more active when they feel more comfortable.
Lizards like warm temperatures.
O If the temperature increases, then lizards become more active.
If the lizard is active, then the temperature must be cool.

Answers

Answer:

If the temperature increases, then lizards become more active.

Explanation:

*15 points* Earth Science
Based on the picture, how many tilting events has this area undergone, and which principle tells us that this area has undergone tilting?

Answers

Just saying it says 8 points ya little baka

explain why the concentration of FSH in the blood increases after day 1​

Answers

Answer:

As the levels of FSH and LH in the blood increase with puberty, the eggs begin to mature and a collection of fluid — the follicle — begins to develop around each one. The first day of menses is identified as cycle day one. Estrogen is at a low point. ... This increase in estrogen begins to inhibit the secretion of FSH.

Explanation:

It is difficult to observe individual chromosomes
with a light microscope during prophase
because
A. The DNA has not been replicated yet
B. They are uncoiled, in long, thin strands
c. They leave the nucleus and are dispersed to
other parts of the cell
D. The spindle must move them to the metaphase
plate before they become visible​

Answers

Answer:

I think the answer is B They are uncoiled, in long, thin strands

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

how is zero, oxidation numbers, and noble gases related​

Answers

Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.

hope this helps

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland

Answers

Answer:

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.

The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

What do you mean by Endocrine Gland?

An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.

The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.

For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.

Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

To learn more about Endocrine glands, refer to the link:

https://brainly.com/question/4455660

#SPJ2

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle

Answers

Answer:

inner core

Explanation:

I looked it up

Which of the following options best depicts the flow of information when a gene directs the synthesis of a protein?

protein>RNA>DNA

RNA>DNA>RNA>protein

DNA>RNA>protein

DNA>tRNA>mRNA>protein

Answers

Answer:

DNA → tRNA → mRNA → protein.

Explanation:

I believe that the above given option should depict the flow of information when a gene directs the synthesis of a protein.

What is natural selection
In a paragraph
This is for 8 grade but can someone help me

Answers

Answer:

Natural selection is a pressure that causes groups of organisms to change over time. Animals inherit their genetics from their parents or ancestors, and the environment is constantly changing.

Explanation:

(self-explanatory)

Explain the differences between Bacteria and Decomposers?​

Answers

Answer: Decomposers like bacteria and fungi don't eat their food, they decompose it externally. Also, decomposers consume nutrients on a molecular level while detritivores eat large amount of decaying material and excrete nutrients. ... In addition to fungi, bacteria are also decomposer organisms. brainliest

Explanation:

The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species

Answers

C. beneficial to the ecosystem

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

Select the correct answer.
Which type of galaxy is the Milky Way?
A.
elliptical
✓ B.
spiral
C.
irregular
D.
lenticular
Next

Answers

Correct answer is B. Spiral

Explanation:
Answer provided by www.amnh.org

Which factor listed below is abiotic? Bacteria, water, fungi, protists

Answers

Answer:water

Explanation:

Answer:

Water

Explanation:

Water does not contain cells, therefore it is non-living.

Other Questions
hich excerpt from Part 2 of The Odyssey best supports the conclusion that Odysseuss fate is doomed? The Cyclops bellowed and the rock roared round him, and we fell back in fear. But I kept thinking how to win the game: death sat there huge; how could we slip away? Ahead of our black prow it struck and sank whelmed in a spurning geyser, But Zeus disdained my offering; destruction for my ships he had in store WILL GIVE BRAINLY - 14 points A quarterback throws a football at 35 m/s at a certain angle above the horizontal. If it took the ball 8.98 s to reach the top of its path, how long was it in the air?rearest hundreth pls!! PSand explain if u can :,) not needed but will help u get the brainliest answer!!!!!!!!!!!!!!!!1111 Diseases to which resistance is a significant issue include: _______a. TBb. Gonorrheac. Malaria which of these places is most likely to have no bacteria present? question 31 options: floor of a damp cellar farm pond human respiratory system inside of a pizza oven Instructions: Read the articles to answer the following questions/1. Where does the energy in an ecosystem come from? How do organisms use this energy?What happens to the energy after it is used by an organism? DUE SOON! PLEASE HELP! through the choice of which events and issues to cover, the media __________. evaluate the most significant influence on the development of absolutism in europe during the period 1648 to 1815. A rectangle has a width w inches and a height h inches where the width is twice the height if you come across information you think was improperly or unnecessarily classified, you should challenge the classification The table shows the location below sea level of hikers on a trail. What is the difference between tommy location and Theresa location? Write your answer in simplest form. Select the Key innovations in animal evolution According to the speaker in the poem, what happens to all humans when we die? What is the term for two identical chromosomes? Conditions connected by OR will be true O when both conditions are false only when both conditions are true O when either condition is true Oonly when just one condition is true How can I improve my relationship with friends? please help me to answer this (has to do with least common factors and stuff like that) What is traditional teacher centered approach? Which of the following commands can be used to display socket information out to the terminal screen?a. ssb. woolsocksc. opensocksd. sstat Why did the ayatollahs oppose the shah of Iran?A. The shah gave Muslim clerics political powerB. The shah catered to soviet interestsC. The shah was not religious enough D. The shah made efforts to increase womens rights