Jimmy needs to rent a banquet hall for a charity dinner. Facility A charges customers a one-time fee of $500 plus $15 for every meal. Facility B charges customers a one-time fee of $1000 plus $5 for every meal.

Which inequality can be used to find m, the minimum number of meals that can be served so that the total charge at Facility A is less than the total charge at Facility B?


#1. 500+15m<1000+5m

#2. 500+15m>1000+5m

#3. 500m+15<1000m+5

#4. 500m+15>1000m+5

Answers

Answer 1
I would believe it to be option 2 Because (m) will be meals but for it to be less would be 500+15m>1000+5m

Related Questions

10 < 2 - d solve for d

Answers

10 < 2 - d

10 - 2 > -d

8 > - d. When dividing with negative the sign switches so..


d > -8

Hope this helps!
Brainliest is much appreciated!

Answer:

d< -8

Step-by-step explanation:

10 < 2 -d

Add d to both sides: 10 + d < 2 -d + d

Simplify: 10+d<2

Subtract 10 from both sides: 10 + d - 10 < 2 - 10

Simplify: d < -8

Sorry if I'm wrong or didn't explain right. I tried my best. Enjoy your answer and have a great day. Thanks :)

19=5+7x i need explanation it’s two step equation btw

Answers

Answer:

x = 2

Step-by-step explanation:

subtract both sides by 5. left with 14=7x. divide both sides by 7. x=2

Answer:

[tex]\boxed{\sf x=2}[/tex]

Step-by-step explanation:

[tex]\sf 19 =5+7x[/tex]

First, let's swap sides so that all variable terms are on the left hand side.

[tex]\sf 5+7x=19[/tex]

Subtract 5 from both sides:

[tex]\sf 7x=19-5[/tex]

Subtract 5 from 19:

[tex]\sf 7x=14[/tex]

Divide both sides by 7:

[tex]\sf \cfrac{7x}{7} =\cfrac{14}{7}[/tex]

[tex]\sf x=2[/tex]

_____________________________________

I need Unit 3 parallel and perpendicular lines Homework 5 slope of lines it’s due today!

Answers

Answer:

1. 4/2

2. -3/5

3. 2/2

4. undefined

5. -5/1

6. zero

7. -4/5

8. 1

9. 0

10. 3/4

11. undefined

12. -9/4


The required slope for the lines is given below.

Given that,
Pot of line and points on the lines are given, we have to determine the slopes of the lines.

What is the slope of the line?

The slope of the line is a tangent angle made by line with horizontal. i.e. m =tanx where x in degrees.

Here,
Slopes of the line can be given as,
m = [y₂ - y₁ ] / [x₂ - x₁]
for points, (-1, -11), (-6, -7)
m = -7 + 11 / -6 + 1
m = -4/5

Similarly,
Slopes of the line can be calculated as
1.) 4/2  2.) -3/5  3.) 2/2
4.) not defined because the denominator becomes zero or perpendicular to x-axis.
5.) -5/1
6.) zero  because the line is parallel to the x-axis
7.) -4/5      8.) 1   9.) 0  10.) 3/4
11.) not defined because the denominator becomes zero or perpendicular to the x-axis.
12.) -9/4

Thus, the required slope for the lines is given above.

Learn more about slopes here:
https://brainly.com/question/3605446

#SPJ2


Help me, please! I'll give 20 points.

Answers

Answer:

A = 97.5

Step-by-step explanation:

Since A & B are supplementary, the general equation would be:

180 - 82.5 = A

A = 97.5

Please not answer just for points! I really need help~

Answers

Answer:

All I know is that it is the   Last  Option

Step-by-step explanation:

I did most of this mentally but I can kinda help you out :D

original R: (-5,-5)     New R: (-11,-11)

To go back to original R: (-11+6, -11+6)

original U: (-5, 1)        new U: (1,7)

HOPE THIS HELPEDDDD :333

Does anybody know how to does this pleaseee helppppp. The first 2 my teacher did them for me but I’m still confused pleaseee helpppp

Answers

Answer:

below

Step-by-step explanation:

A triangle can only be a triangle if the two shortest sides add up to be greater than the longest side.

For example on the first one, the segments 1 2 and 3 will not make a triangle as 1 + 2 = 3 and if the two smallest sides of a triangle are equal to the longest side it will not be a triangle at all.

So to make this easy, out of the three numbers given: add the two smallest numbers. This number has to be greater than the third number given, and it cannot be equal.

For question three: 3+9 = 12

And 12 is greater than 11, therefore this can make a triangle.

From a can containing 10 liters of milk, mrs menon used 3.8 litres in the morning and 2.3 litres in the evening how many hectolitres of milk is in the can?


Plz write the steps cause i want to understand it bcuz tomorrow is my exam

Answers

Answer:

0.039 hectolitres are left in the can

Step-by-step explanation:

One hectolitre equals 100 liters

The can:

10-3.8-2.3=3.9 liters

In hectolitres:

3.9/100 = 0.039

Hope this helps

pls answer don’t scam

Answers

Answer:

y=x

step by step:

graph equation is y=mx+c

y intercept (c) is 0

gradient (m) is 1

gradient is represented as (m), so the equation is just y=1x, simplified-> y=x

Answer:

  money = 2×tickets

Step-by-step explanation:

For 1 ticket sold, $2 is collected. for 8 tickets sold, $16 is collected. The relationship appears to be proportional with a constant of proportionality of $2 per ticket.

The axes are labeled "money" and "tickets", so we can write the equation ...

  money = 2×tickets . . . . . where money is in dollars

__

If you like, you can use y to represent dollars collected, and x to represent tickets sold. Then the equation is ...

  y = 2x

1) 2x – 3y - z = 7
3x + 5y - 3z = -2
4x – y + 2z = 17
When this system of equations is solved, what is the value of x?

Answers

Answer:

x = 3

Step-by-step explanation:

2x - 3y - z = 7 (equation 1)

3x + 5y - 3z = -2 (equation 2)

4x – y + 2z = 17 (equation 3)

(1) * 3 : 6x - 9y - 3z = 21 (1)'

(1)' - (2) :  3x - 14 y = 23 (equation 4)

(1) * 2 : 4x - 6y - 2z = 14 (1)"

(1)" + (3) : 8x - 7y = 31 (equation 5)

(5)*2 : 16x - 14y = 62 (5)'

(5)' - (4) : 13x = 39

              x = 3

So thus, x = 3 in this system of equations, you can plug x back into equation 4 or 5 to find y and then plug x and y back into equations 1, 2, or 3 to find z

HELP PLZ I NEED THIS DONE ASAP

Answers

[tex]\text{Given that,}\\\\y^2 +9y +3 \\\\\text{when}~ y = -2,\\\\(-2)^2 +9(-2) +3 = 4-18+3 = 7 -18 = -11,[/tex]

20x+10x-8=0 solution set of equation

Answers

1. Combine like terms (30x -8 =0)
2. Isolate the variable (30x =8)
3. Divide both sides by the coefficient (x= 8/30)
4. Simplify (x= 4/15)

Answer:

0.2666666666

Step-by-step explanation:

20x+10x-8=0

first of all, you will +8 on both sides so there are no negative numbers onany side

20x+10x=8

now gather everything up

30x=8

divide everything by 30 now to get the value of 1x

30x/30=x

8/30=0.2666666666

will give brainliest
Evaluate.

(−16+0.6(−13)+1)2

What is the value of the expression?

Enter your answer as a simplified fraction in the box.

Answers

-45.6 is the answer if you evaluate

what are the next three terms in the sequence below? 2, 5, 10, 50, ___, ___, ___

Answers

Answer:

2, 5, 10, 50, 55, 275, 280

Step-by-step explanation:

hope this heled you.. :)

One serving of ice cream has 320 calories. If there are 6 servings in the container and you ate of the container, how many calories did you eat?

Answers

Answer: You ate 1920 calories

Step-by-step explanation:

It’s pretty simple,

all you have to do is multiply 6 by 320.

this then gets you 1920

Answer:

1920 calories

Step-by-step explanation:

6servings*320cal/servings = 1920cal (servings cancel)

Milan needs to read 3 novels each month.
Let N be the number of novels Milan needs to read in M months.

Write an equation relating N to M. Then use this equation to find the number of novels Milan needs to read in 17 months.

Answers

Answer:

N=3M, 51

Step-by-step explanation:

The total number of novels is equal to 3 x Months, For every month, Milan reads 3 books, so for 17 months, 17 x 3 = 51, So N = 51

equation: 1/3n=m

answer: 51 novels

33 + 55 = __ (3+5)
Help me with this

Answers

Answer:

11 I think and hi how are u ::):):):):):):):):):):):):):

11 I’m pretty sure I got it right

What is the degree of 5x^5+8x^2+2x-3x^9-8x^4-4x^5

Answers

Answer:

9

Step-by-step explanation:

It is the greatest exponent.

negative three eights times a number,z, equals 12.

Answers

Answer:

the answer is 32

Step-by-step explanation:

3/8=0.375

0.375 x 12 =32

Answer:

-0.5

Step-by-step explanation:

If we reverse the math, 12/ -3/8=-0.5, therefore -0.5 is the answer. Please mark brainliest if possible

1/2(10p-7q) if p=9 and q=2

Answers

Answer:

38

Step-by-step explanation:

1/2(10p-7q)

1/2(10(9)-7(2))

1/2(90-14)

1/2(76)

76/2

38

On Monday, 412 students went on a trip to the zoo. All 8 buses were filled and 4
students had to travel in cars. How many students were in each bus?
Let s = number of students on each bus?

Answers

Answer:

51

Step-by-step explanation:

Let x be the number of people in a bus. Since we have the total and the people in the car in addition to the number of busses, we can write an equation like this:

total students = (number of people in a bus) * (number of busses) + leftovers

Our equation we come up with is:

412 = s * 8 + 4

Solve

s*8=408

s=51

A 12 ounce Starbucks latte costs $3.36. What is the constant of proportionality that relates the cost in dollars, y, to the number of ounces, x, in a Starbucks latte?

Answers

Answer:

Y = X times 0.28

Step-by-step explanation:

1. You set it up as a proportionality

12/1 and 3.36/x

The x stands for how much money it takes to get 1 ounce

2. You do the old man line.

12 times x = 3.36 times 1

12x = 3.36

3. Now you divide 3.36 by 12

3.36 divided by 12

.28

4. You insert 0.28 into the problem

12 times 0.28 = 3.36

X = 0.28

So 1 ounce costs $0.28

So Y = X times 0.28

Answer:

Step-by-step explanation:

10/11 x 3/7 x 1/2 Multiply. Write your answer as a fraction in the simplest form.

Answers

ffhhuff fffchuyrx we’re

Robby took his dog to the pet grooming store. The service costs $30. He tips the groomer 25%.
How much in total does the groomer get?

CAN SOMEONE SHOW ME HOW TO DO THE WORK?

Answers

Answer: $37.50

Step-by-step explanation:

You multiply the $30 by the percentage tip so 25% in this case, first make it a decimal that would be 0.25. 30*.25=7.50 then you add the 7.50 to the 30 which is gives you the $37.50

Answer:

$37.50

Step-by-step explanation:

25% of 30 is 7.50   $7.50+$30=$37.50

can someone please help me with this

Answers

Answer:

a or b.

Step-by-step explanation:

divide x² +x +1 by x+ 1 by long division method​

Answers

Answer:

I hope it will help you.

help ASAP please hmmmm ​

Answers

Answer:

the 3rd and 4th one r correct

Step-by-step explanation:

hope this helps!!!!

This is for the real ones- find the missing side x. Giving brainliest.

Answers

Answer: The answer is X equals 10 2/3.

Explanation: This is a proportion. We see that the right rectangle when turned to the right is proportional to the left rectangle. On the left rectangle, the smaller side is 6 ft, and the larger side is 16 ft. On the right rectangle, the smaller side is 4 ft. 6 ÷ 1.5 = 4, therefore 16 ÷ 1.5 = 10 2/3.

What is another word for change in y

Answers

When finding the slope of real-world situations, it is often referred to as rate of change. change in y Rate of change = change in x change in height change in time The average rate of change or a rider between 0 and 5 seconds is —24 ft/s. magnitude relation. Another synonym is "velocity".

Hope this helps

Zack buys some potatoes from a store. The potatoes cost $6.78 for 3 pounds. He wants to buy more vegetables, but at the same price per pound as the potatoes. Which of the following vegetables could Zack buy?

Answers

Answer:

well we dont know other vegis are going for each pound is 2.26 but any vegtable thats is going 2.26 per pound works  

Step-by-step explanation:

im having a mental breakdown can someone please just do this for me

Answers

the slopes of the original function y = |x| are m = 1 and m = -1 (m is the variable used to represent slope).

when you add a coefficient (number) in front of |x|, it will either make the slopes steeper or more flat. the larger the value of the coefficient, the steeper the slope will be (vice versa for a coefficient smaller than 1, which would make the slope more flat than the parent(original) function).

because these are absolute value functions, they will have two slopes. one slope for the end going up from left to right, and one for the end going down from left to right. this means that one slope must be positive and the other slope must be negative for each function.

with this in mind, the slopes of y = 2|x| are m = 2 and m = -2. the coefficient of 2 narrows the function by a factor of 2 (it is twice as narrow as the parent function). the same rules apply to y = 4|x| with the slopes of this function as m = -4 and m = 4 (it is 4 times narrower than the parent function).

with the fraction coefficients, the function is being widened. therefore, the slopes of y = 1/2 |x| are m = -1/2 and m = 1/2. the slopes of y = 1/5 |x| are m = -1/5 and m = 1/5.

Answer:

it only changes the magnitude.

for any general a let f(x) be =a|x| , a>0

so for any x say ±3 your function will throw out a×3.

Other Questions
What do the following two equations represent?. 4x + 2y = 10 4x 2y = 10Choose 1 answer:The same lineDistinct parallel linesPerpendicular linesIntersecting, but not perpendicular lines If you are the driver or owner of a vehicle which is in a crash that is your fault and you are not. Malik jogged 2 miles in 20 minutes.What was his rate in miles per hour?10 miles per hour6 miles per hour23 mile per hour110 mile per hour the smallest division value of electronic balance Astatine-218 has a half-life of 1.6 seconds. If you begin with a 1.7 g sample of astatine-218, how much of the sample remains after 3.2 seconds? explain different users of computer in briefly? Find the area of the cuboid. The valence electrons of a krypton (Kr) atom in the ground state are located in theA. first energy level (shell).B. second energy level (shell).C. third energy level (shell).D. fourth energy level (shell). Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT.