into the firestorm in chapter three what do nick and tommy have in common

Answers

Answer 1

A vocalist, Because he was a nice dog, he had to acquire one. Nick doesn't enjoy having his decisions made for him, so he gets up and leaves. He makes his way to San Francisco in the hopes of starting over far from the cotton fields of Texas.

For what is San Francisco renowned?

The steep streets, Alcatraz, Golden Gate Bridge, and - you guessed it, dude! - Full House are all well-known features of San Francisco. The thirteenth-largest city in the United States has a few interesting historical tidbits.

Why is San Francisco so wealthy?

San Francisco has become one of the wealthiest cities in the world as a result of its near proximity to Silicon Valley, which is regarded as the world's capital for technology.

To know more about the San Francisco visit :-

https://brainly.com/question/17250173

#SPJ1


Related Questions

Which in-text citation is correct for Kim Parrish's "Learning Does Wonders" on page 4?
A: Parrish writes, "Curiosity is a good trait to have" (4).
B: Parrish 4 writes, "Curiosity is a good trait to have" (4).
C; Parrish writes, "Curiosity is a good trait to have."
D: Parrish writes "Curiosity is a good trait to have" (4)

Answers

╭┄┈┄────────❥

Answer:

↣ A: Parrish writes, "Curiosity is a good trait to have" (4).

Explanation:

A proper in-text citation should include the surname of the writer, page number, and the punctuation must be outside the parentheses; therefore, option A is correct.

. . • ☆ . ° . • °: . * ₊ ° . ☆

I hope this helps!

peachtea ^-^

╰┄┈┄──❥

1. Feedback on our new package design has been positive_________

Answers

Feedback on our new package design has been positive and overwhelming.


What is the package?

A bundle is a packaged, folded, or packed collection of items that are often small to medium in size. the covering that surrounds a product or service and works to clean the area and attractive while also serving to confine, identify, characterize, preserve, showcase, and advertise it.

Our new packaging design has received tremendously good feedback. The design of packaging design is crucial for establishing the identity of your products in the shopping environment. A thing to keep in mind is that a style will draw in more viewers if it is "better written." Additionally, effective packaging can help you set your items apart from those of your rivals.

Learn more about the package, here:

https://brainly.com/question/28283519

#SPJ1

A substance's chemical structure depends on the number and types of atoms in each of its molecules, as well as on how those atoms are arranged. Substances with different chemical structures have different physical and chemical properties.
When a substance is a reactant in a chemical reaction, its chemical structure changes. During the reaction, the atoms that make up the reactants are rearranged to form products. After the reaction, the products together are composed of the same atoms as the reactants, but those atoms are arranged in a different way. So, the products have different chemical structures than the reactants.

The chemical reaction that produces soap is called saponification. During one type of saponification, oil and sodium hydroxide undergo a chemical change to produce glycerol and soap. As a result of this reaction, the soap has different properties than the oil and sodium hydroxide. Some of these properties are what give soap its cleaning ability.
Which of the following statements are true? Select all that apply.
Together, the products of a chemical reaction have the same arrangement of atoms as the reactants.
A chemical change occurs during saponification.
A substance's chemical structure affects its properties.
Soap is a reactant in the saponification reaction.

Answers

Answer:

A substance's chemical structure affects its properties.

A chemical change occurs during saponification

A chemical change occurs during saponification and a substance's chemical structure affects its properties are true.

What is saponification?Saponification is the name for the chemical process that creates soap. Oil and sodium hydroxide go through a chemical transformation to produce glycerol and soap during one type of saponification.When manufacturing soap, triglycerides are mixed with a powerful base through the process of saponification to create fatty acid metal salts. Hardness, scent, cleaning power, lather, and moisturizing properties of soaps are all influenced by the ratio of saturated to unsaturated fatty acids. Many elements in oil paintings remain unsolved, and saponification does not always occur.The only restoration technique that is currently known is retouching.Through the development of observable lumps or protrusions that might scatter light, the saponified areas may alter the surface of the painting. So, options 2 and 3 are correct.

To learn more about restoration, refer:

https://brainly.com/question/26816327

#SPJ1

How does Saki use pacing and order to create tension and surprise in the end? Use specific examples from the story.

Answers

Answer:

allie blad

Explanation:

nah still fam

Read the excerpt from "Keynote Address."

At a time when guns are still heard in some areas of the world, we have laid in place such building blocks of mankind’s survival as the nuclear test ban treaty of 1963, the banning of atomic weapons in space of 1967, and the nuclear non-proliferation treaty of 1968. These are vital foundations, vital foundations of peace, and we must build on them.

Read the excerpt from "Keynote Address."

At a time when guns are still heard in some areas of the world, we have laid in place such building blocks of mankind’s survival as the nuclear test ban treaty of 1963, the banning of atomic weapons in space of 1967, and the nuclear non-proliferation treaty of 1968. These are vital foundations, vital foundations of peace, and we must build on them.

Which best describes the type of appeal Inouye is making?

authority
emotion
logic
timeliness

Answers

Best as would be timelines, because in the end it’s states “These are vigilant foundations, vital foundations and we must build on them” he repeats vital foundations repetition means it’s something important so I would say time is of the essence

Inouye seems to be making a logical argument by highlighting the value of international treaties for laying the groundwork for peace based on the substance of the text. So, the correct option is C.

What is Logical argument?

A logical argument is a strategy for using logic and supporting data to prove a point or conclusion. It entails putting forth a number of premises—statements that, when taken together, lead to a conclusion. To persuade the listener to accept the conclusion based on the facts provided is the objective of a logical argument.

A logical argument adheres to a set of principles that guarantee the validity of the conclusion given the premises, such as the laws of deductive reasoning. A sound logical argument has true premises and a conclusion that flows logically from the premises.

In the above given example, Inouye seems to be making a logical argument by highlighting the value of international treaties for laying the groundwork for peace based on the substance of the text.

Therefore, the correct option is C.

Learn more about Logical argument, here:

https://brainly.com/question/4255659

#SPJ2

Why does John Proctor bring Mary Warren to court with him?

Answers

Answer:

Explanation:To swear everyone was pretending.

To swear everyone was pretending.

Black and Shannon have decided to form a partnership. They have agreed that Black is to invest $360,000 and that Shannon is to invest $120,000. Black is to devote one-half time to the business, and Shannon is to devote full time. The following plans for the division of income are being considered: Equal division In the ratio of original investments In the ratio of time devoted to the business Interest of 6% on original investments and the remainder equally Interest of 6% on original investments, salary allowances of $96,000 to Black and $168,000 to Shannon, and the remainder equally Plan (e), except that Shannon is also to be allowed a bonus equal to 20% of the amount by which net income exceeds the total salary allowances

Answers

Find the split of the net income for each plan under the two different net income assumptions (net income of $276,000 and net income of $480,000). Use the following column headers to present the data in tabular form.

What does general partnership mean?

A general partnership is formed when two or more people engage in a business for the aim of sharing profits. A general partner may be held personally accountable for the deeds of other general partners since general partners have unrestricted joint and several responsibility.

What function does a general partnership serve?

Without the knowledge or consent of the other partners, a general partner is able to act on behalf of the company. The general partner may be subject to limitless liability for the obligations of the company, unlike a limited or silent partner.

Know more about investment:

brainly.com/question/25300925

#SPJ1

How do the details in this passage support the authors'
purpose?
• The comparison of honey to sugar production helps
persuade readers that honey is better than sugar.
The details about sugar's dependency on slavery
help inform readers about why sugar was
inexpensive.
The details about the sugar's strong flavor entertain
the reader with stories of how people invented sugar.
The comparison of the invention of sugar to steel
helps persuade readers that sugar is easier to make
than steel.

Answers

The details in this passage support the authors' purpose are the details about sugar’s dependency on slavery help inform readers about why sugar was inexpensive. Option B is correct.

What is slavery?

Forced work and a lack of freedom are two characteristics of slavery. Additionally, it was a system in which one class of people; slave owner could compel another and the slaves to work and restrict their freedom. Some forms of slavery have existed throughout history as a form of debt repayment or as a form of punishment for crimes.

So as per the author's view in "Sugar Changed the World," Marc Aronson and his wife Marina Budhos, wanted to educate readers about the numerous lives that were lost, the suffering that slaves endured, and the lengthy journeys that were required to produce sugar for Europe's sweet tooth in order to "enjoy" a substance that was so much less expensive than the honey they had nearby.

Thus, due to the fact that slaves are not paid, it was inexpensive.

Learn more about slavery:

https://brainly.com/question/9331183

#SPJ1

Select the best choice for how a classic piece of literature can meaningfully influence a contemporary piece of literature.

The use of the same literary theme
The use of the same figurative language
The use of the same rhetorical device
The use of the same setting

Answers

The best choice for how a classic piece of literature can meaningfully influence a contemporary piece of literature is A. The use of the same literary theme.

What is a literary theme?

A literary theme is the pivotal or main issue that is discussed in a literary work, whether it is poem, novel, article, short stories, etc.

A classical piece exposes us to various perspectives or way of doing things  in comparison to now. In many Contemporary literature we can still see authors make share themes like slavery, racism, American war, war crimes, love, and justice.

Learn more about literary themes here:

https://brainly.com/question/29498718

#SPJ1

Your English teacher has assigned you a research paper on the theme of childhood in Mark Twain’s book Adventures of Huckleberry Finn. Which of the following would be the most effective keyword combination to begin your search? Check all that apply.

Answers

Answer:

"Mark Twain" AND "Adventures of Huckleberry Finn" AND "childhood"

"Huckleberry Finn" AND "childhood"

"Mark Twain" AND "childhood"

"Adventures of Huckleberry Finn" AND "childhood"

All of the above keyword combinations would be effective in beginning a search for information on the theme of childhood in Mark Twain's book Adventures of Huckleberry Finn. By including the name of the author and the title of the book, you can narrow your search to specific sources that are relevant to your research topic. Adding the keyword "childhood" will further narrow your search to sources that specifically address this theme in the book.

Explanation:

What element of a myth is featured in the title "The Beginnings of the Maasai”?


an attempt to explain a supernatural god

an attempt to explain a fantastic setting

an attempt to explain an origin

an attempt to explain a conflict

Answer: C, an attempt to explain an origin.

Answers

The phrase "the beginnings of the maasai" contains a mythical element that seeks to provide an explanation for origin. The best option is C.

What characteristics of a myth exist?

Make it clear to them that myths, like other types of stories, have the same main elements: characters, setting, conflict, plot, and resolution. In addition, myths frequently offered an explanation for an occurrence in nature or a behavior in people. A myth is a story that has been passed down through the centuries in literature in an effort to explain the origin of something or a natural occurrence.

It has occult qualities that contribute to the explanation of why the Maasai people's house underwent a volcanic explosion.

To know more about myth visit:

https://brainly.com/question/18487597

#SPJ1


Today Jesus Christ intercedes for believers in .

Answers

Answer:

Explanation:

,mn

URGENT ESSAY "Importance of sleep for healthy life"

Answers

Answer:

Without a question, one of the most important conditions for the human body to operate correctly is sleep. The wellbeing of the human body, both physically and emotionally, is greatly influenced by it. In fact, the value of sleep is demonstrated by the way it supports a healthy lifestyle over the course of a lifetime. Along with assuring safety against a variety of dangerous ailments, it not only helps you preserve your bodily and mental health but also your decent and healthy lifestyle.

It's common knowledge that your mood when you get up has a significant impact on the quality of your sleep.

According to Anthony Bourdain, do Americans understand Mexican culture? Yes or no?

Answers

Answer:

no

Explanation:

The rate of incarceration in prison increased from 27 per 100,000 women in 1985 to 57 per 100,000 in 1998. Men still outnumber women in the inmate population by a factor of about 14 to 1, but the gap is narrowing – from 17 to 1 a decade ago. Women constituted only 4 percent of the total prison and jail population in the United State in 1980 but more than 6 percent in 1998.



Which sentence best states the main idea of this passage?

Answers

The Increasing Number of Women in Jail  best states the main idea of this passage. Thus, option A is correct.

What is a sentence?

A sentence can be defined as the part where the phrase and the words are. This often contains a subject and a predicate. There should be proper punctuation marks that are needed in a sentence. The sentence helps in communicating the thoughts.

Men still outnumber women by a factor of about 14 to 1, but the gap is narrowing. Women constituted only 4 percent of the total prison and jail population in 1980, but more than 6 percent in 1998.

Therefore, option A is the correct option.

Learn more about sentence, here:

https://brainly.com/question/27891489

#SPJ1

The question is incomplete, the complete question will be:

A. The Increasing Number of Women in Jail

B. Men Versus Women in Jail

C. Overcrowded Prisons.

D.Incarceration in America

Brave New World Chapter 16 Questions(PLEASE I NEED HELP!)

1. What do the controller and John read in common?

2. What does John want the people to read or watch?

3. Why don't they make everyone an alpha double plus.?

4. Why does the controller say they don't make people work less?

5. Why does the controller say science is dangerous?

6. What does the controller say he's going to do with Bernard and Helmholtz

7. Why does the controller say that the islands are a good place?

8. Why does Helmholtz want to go to a worse island than the controller suggests?

Answers

He was only given two books to read when John's mother Linda started teaching him to read English.

Why does John interpret Othello if they are drawn to one another?

Lenina uses soma to comfort herself while John calms himself by reading Othello by Shakespeare. The feelies are comprehensive films that appeal to all the senses of the viewer while also offering a sexual release to keep people happy and pleased.

In the brave new world, who is the controller?

Muhammad Mond The powerful political and intellectual figure known as the World Controller. At the start of the book, he presents a historical perspective of the new world, and subsequently, he engages in a discussion with John and Helmholtz about societal values.

To know more about john visit:

https://brainly.com/question/1550338

#SPJ1

don't wait up my sentence by adding the present perfect tense to the ropes errol jackson what the ball to first base

Answers

a year ago No Comments | englishstudyhere 100 Sentences in the Present Perfect Tense | Examples of the Present Perfect Tense Previous Article Next Article 1. A large cake was previously created by my sister. 2. Since I last saw you, you have grown. 3. It hasn't ingested any water. 4. I've seen the film.

The present perfect continuous tense is made up of helping verbs and major verbs, just like the present perfect tense. The present perfect continuous tense uses two assisting verbs and a major verb in present participle form instead of one helping verb and one main verb in past participle form. The past participle and have/has combine to generate this tense. Consequently, you will observe that this verb tense's formulation .

To learn more about Tense please click on below link

https://brainly.com/question/11222622

#SPJ4

Which sentence from the text best demonstrates the central idea of feeling defeated?

Answers

Answer:

2nd choice

But I got mixed up on the first words and stood there, holding on to my desk, my heart beating, and not daring to look up.

steps :

other answer choices were too cheerful


How did Hester Prynne character develop throughout the novel The Scarlet Letter

Answers

The sin of adultery had two main consequences for its sinners in The Scarlet Letter. Hester Prynne's immorality helped her become a more powerful and independent woman in society. She was able to get past the guilt she was constantly reminded of and her punishment of wearing the letter.

Why you should not write in the first person in APA format.

Answers

Answer:

APA has no rule in the Manual to not use 1st-person point-of-view.

Explanation:

The following explains why this is a debatable issue: The APA manual does not specifically forbid the use of first-person narration. False perceptions

 

For:  

Some writers believe that APA Style forbids them from using the first-person pronouns "I," "we," and "our" in their work.

The myth states that writers should never refer to themselves in the first-person narration.

To avoid any ambiguity about who should get credit for what, the use of first-person pronouns is not only accepted but recommended in APA style.

Against:

Myth, you should not use the first person in APA. Instead, you should use the third person when possible. But there are a few places in the APA rules where you can use "I." In these rules, you should only use these first-person pronouns.

Personal experiences, the research you've done, and examples are acceptable.

[W]hile the vast assembly, as if with one impulse, shrank from the centres of the rooms to the walls, he made his way uninterruptedly, but with the same solemn and measured step which had distinguished him from the first, through the blue chamber to the purple—through the purple to the green—through the green to the orange—through this again to the white—and even thence to the violet, ere a decided movement had been made to arrest him.
What is the effect of parallelism in this excerpt?

Answers

Based on the given text, "[W]hile the vast assembly, as if with one impulse, shrank from the centres of the rooms to the walls, he made his way uninterruptedly,...", the effect of parallelism that it brings is C: It emphasizes the excessive opulence of the decor

What is Parallelism?

This refers to the term that is used to describe and define the similar sequence of words that is used in a given sentence in order to give it a similar word form that helps ensure smooth flow of communication and also to avoid ambiguity.

Hence, it can be seen that the given text makes use of parallelism in order to arrange words together in a similar way and fashion and thus, it shows the grand opulence that the decor has which is option C.

Read more about parallelism here:

https://brainly.com/question/3854774

#SPJ1

What is the effect of parallelism in this excerpt?

A.It emphasizes the frantic spiral toward confrontation.

B.It emphasizes Prospero’s steady, confident approach.

C.It emphasizes the excessive opulence of the decor.

D.It emphasizes the rapid progression of time.

Answer:

it c

Explanation:

Use this picture to explan that an electrically charged object can attract an uncharged object without any contact. Your answer should be at least three sentences
long

Answers

Answer:a = b force when it is charged

Explanation:

i got it right

Looking at your notes, what was the main idea of the article “Bike Designers and Geometry?” a. The geometric shapes in a bicycle c. How to become a bike designer b. Why there a different kinds of bikes d. How geometry is used when designing bicycles Please select the best answer from the choices provided A B C D

Answers

d) The application of geometry in the creation of bicycles.

Briefly, what is geometry?

The branch of mathematics known as geometry studies the properties of space, the shapes of specific objects, and the relationships between them in space.

Its name derives from Greek phrases that mean "Earth measuring" and is one among the earliest branches of mathematics. It evolved in response to problems in the actual world, such those in surveying. It was finally realized that geometry may be used to communicate and develop even the most abstract ideas and notions rather than just being limited to the study of solid, three-dimensional objects and flat surfaces (plane geometry and solid geometry).

To know more about Geometry visit:

https://brainly.com/question/12015344

#SPJ1

During group discussion, after the group assigns roles it should?

set a time limit.

reflect.

gather ideas.

agree on one idea.

Answers

Answer:

Gather ideas

Explanation:

To gain different opinions and determine which time limit would be appropriate. Not sure if it's right.

Select the correct text in the passage.
In this excerpt from "Lines Written in Dejection" by William Butler Yeats, which words create slant rhyme?

When have I last looked on
The round green eyes and the long wavering bodies
Of the dark leopards of the moon?
All the wild witches, those most noble ladies,
For all their broom-sticks and their tears,
Their angry tears, are gone.

Answers


All the wild witches, those most noble ladies,
For all their broom-sticks and their tears,
Their angry tears, are gone.

In divergent chapter 13 the initiates take a break from fighting why did they take a break from fighting?

Answers

The initiates take a break from fighting because they are exhausted from the intensity of the fight simulation. The Dauntless leaders wanted to make sure that the initiates take a break and get some rest before continuing their initiation. This break also gives the initiates time to reflect on their performance and strategize for the rest of their initiation.

What is fight?
You dispute as well as argue when you fight. Everyone occasionally has different opinions, but it's sad once close friends argue. As a noun, fight is indeed the conflict itself. The derivational fight means to participate in a struggle which involves conflict. A fight may be physical, such as a boxing match or even a playground altercation, or verbal, such as a dispute over politics. The Proto-Indo-European suffix pek, which means "to pluck out," is where the word fight's earliest roots are found. This makes perfect sense if you picture a hair-pulling argument.

To learn more about fight
https://brainly.com/question/26233547
#SPJ4

Peter is an author who has recently finished his first self-published novel, which he has for sale on his website. In order to save money, Peter found a picture online and used it on the cover of his book. He is not sure who took the picture.

This scenario is an example of what?

Select all that apply.

A. commercial use
B. plagiarism
C. fair use

Answers

Plagiarism

Explanation: we can eliminate fair use because he is using it for the money not education and commercial use because Commercial Use is any use of the work that the contract contemplates or for which it is expected to be economically viable.
Answer;

B. plagiarism

Explanation:

This scenario is an example of plagiarism. Peter did not get consent from the photographer that took the photo for “his” book cover, nor did he notify or console the photographer for their approval. Peter is stealing something that isn’t his and is claiming it as his own. This is considered plagiarism.

All dry martinis are dangerous concoctions.
Therefore, it is false that some dry martinis are not dangerous concoctions.
M = dry martinis
C = dangerous concoctions

Answers

The martini is a gin and vermouth-based drink that is typically served with an olive or a lemon twist as a garnish.

What's the difference between wet and dry martinis?Vermouth content is referred to as being "dry" in a Martini. It gets drier the less vermouth there is. Wet Martini: This term often refers to a Martini that is a little sweeter than usual. The 'wetter' your Martini is, the more vermouth you add.The martini is a gin and vermouth-based drink that is typically served with an olive or a lemon twist as a garnish. One of the most popular mixed alcoholic beverages across time is the martini. The vodka martini is a well-liked version that substitutes vodka for the gin-based base liquor in the beverage.

To learn more about martini refer,

https://brainly.com/question/27959760

#SPJ4

What evidence does Elizabeth Warren use and is it effective in "Why Equal Pay Is Worth Fighting For" by Senator Elizabeth Warren, April 17, 2014

Answers

Warren supports her point of views with help of evidences noting that the Paycheck Fairness act was introduced to provide women the tools to fight wage discrimination.

Who is Elizabeth Warren?

The senior senator from Massachusetts is Elizabeth Warren. She belongs to the Democratic Party. Warren ran for president in the 2020 U.S. election, although she ultimately finished third behind Joe Biden and Bernie Sanders.

What are the logical justifications for the points in Warren's argument?

1. In two thirds of families nationwide, women are the primary wage earners.

2. Discrimination occurs when persons receive different wages for performing the same job.

3. Pay discrimination harms families in the middle class.

Which of the following best sums Warren's perspective on American wages?

The best perspective of Warrens on American wages is that equal remuneration for equal labor should be a goal.

To know more about Paycheck Fairness Act please click here https://brainly.com/question/2953300

#SPJ1

Which verb mood is used in the sceice If Ian and Amir could vacation anywhere in South America, they would travel to Peru to see the Incan ruins of Machu Picchu.

Answers

The mood of a verb is the manner in which it is expressed. The majority of verbs are indicative and are used to express facts or opinions. The imperative mood is used to issue commands and requests. The interrogative mood inquires.

What is verb ?

A verb is a word that conveys an action, an occurrence, or a state of being in syntax. The infinitive, with or without the particle to, is the basic form in the usual description of English. Verbs are inflected in many languages to encode tense, aspect, mood, and voice.

A tense tone keeps the reader guessing about what will happen next. When writing a mystery or thriller, an author may use a tense tone to convey feelings of worry and concern. In most stories, a tense tone leads to a resolution, and the tone shifts.

Thus, The mood of a verb is the manner in which it is expressed. The majority of verbs are indicative and are used to express facts or opinions.

To learn more about verb, follow the link;

https://brainly.com/question/8776268

#SPJ1

Other Questions
Solve x for this diagram why did the framers of the constitution put the principles of checks and balances and separation of powers in the constitution? can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope. Find the absolute extrema if they exist, as well as all values of x where they occur, for the function f(x)=(x-64)^{1/11} on the domain [-8,9]Select the correct choice below and, if necessary, fill in the answer boxes to complete your choice.A. The absolute maximum is , which occurs at x= (Round the absolute maximum to two decimal places as needed. Type an exact answer for the value of x where the maximum occurs. Use a comma to separate answers as needed.)B. There is no absolute maximum. What challenges you face during a searching for a business conference ? Explain when in psychoanalysis, the patient is asked to reveal whatever thoughts, feelings, or images come to mind, this technique is called: ACTIVITY 3: What is the message of the picture? Why did mom and dad hace ti hice marjis posters?