in your own words, what is the definition for Diffusion?

Answers

Answer 1

Answer:

Diffusion basically means the spreading of something that's wide or the action of spreading the light from a light source that reduce glare and harsh shadows.


Related Questions

pls help ASAP i will mark brainliest

Answers

Answer:

ok

i can help you ..............

Explanation:

drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.

Conchoidal fracture in minerals creates a smooth _______________________ surface that is similar to the surface of a conch or seashell.

Answers

Conchoidal fracture in minerals creates a smooth, [tex]\sf\purple{curved}[/tex] surface that is similar to the surface of a conch or seashell.

[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Happy\:learning.}}}}}∘[/tex]

Which process comes first in the process of protein synthesis?
A. Transcription

B. Translation

Answers

Answer:

A. Transcription

Explanation:

Transcription comes first in the process of protein synthesis.

Answer:

A.Transcription

Explanation:

Transcription is the process of making an RNA copy of a gene sequence. This copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein, which it encodes.

Which type of weather is associated with the eye of the hurricane?

calm

stormy

windy weather

Answers

Answer:

A windy weather

Explanation:

Tree will began to swayed

Para cada una de las historietas "la penicilina, Francisco Redi y Louis Pasteur" indiquen:
a) ¿Qué estudió el científico?
b) ¿Cuál fue el descubrimiento?
c) indica con que viñetas se relacionan cada paso del método científico, puedes subrayarla o transcribirla

Answers

Answer:

a)

Explanation:

je suis ask teacher

There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins​

Answers

Answer:

c information storage

Explanation:

information is stored in dna which provides the instructions required to make proteins . proteins do not store information

Fossils show that some of those extinct organisms evolved into organisms that survived today like _____.
A. ants

B. humans

C. wolves

D. birds

Answers

Answer:

c wolves would be your Excellent answer

Answer:

D. birds

Explanation:

Fossils show that some of those extinct organisms evolved into organisms that survived today like birds.

Please help me with this

Answers

Answer:

bro ineed help to

Explanation:

Answer:

option 1 is the crt answer

Explanation:

B and j show more dna similarity as B is the direct ancestor of j

Identify the main floral organs
of a flower.

Answers

petals, sepals, stamen, and carpel

Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

what do you mean by mental labour​

Answers

Answer: Mental Labour, According to this definition, mental work refers to planning, organizing, coordinating, and managing duties and tasks that we perform during the course of our lives. People's worries about their ability to manage their time efficiently and effectively.

Explanation:

I explained at the top-

Discuss how a soil, a natural body, differs from soil, a
material that is used in building a roadbed.

Answers

Answer:

Soil is a material made up of gases, organic substances, water, and microorganisms. This material may be used in building a roadbed and is often referred to as dirt. In comparison, a soil is a natural body that is three-dimensional much like a lake or mountain.

Explanation:

Hope this helps

Gases, organic materials, water, and microbes are all components of soil. This substance, which is frequently referred to as dirt, can be utilized to construct a roadbed. In contrast, the soil is a three-dimensional natural structure similar to a lake or a mountain.

What is soil?Soil is the loosely packed organic or mineral material that makes up the Earth's immediate surface and acts as a habitat for land plants. The unconsolidated organic or mineral matter that has been exposed to relief-conditioned macro- and microbes operating on parent material throughout time, as well as genetic and environmental factors such as climate (including water and temperature effects). A product-soil is distinct from the source material in many ways, including in terms of its physical, chemical, biological, and morphological qualities.

This is how natural soil is different from the material used in constructing roadbeds.

Learn more about soil erosion here:

https://brainly.com/question/17905503

#SPJ2

what is photo synthesis?​

Answers

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

Answer:

photo synthesis is the green plants which making other organisms to convert engry into chemical

Which sample formed from the solidification of lava near Earth's surface

Answers

Answer: Granite and Basalt


Explanation: Igneous rocks (from the Latin word for fire) form when hot, molten rock crystallizes and solidifies. The melt originates deep within the Earth near active plate boundaries or hot spots, then rises toward the surface. So in this case it would be Granite and Basalt

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

What is a scavenger?
A) an organism that lives in or on another organism
B) an organism that feeds on dead matter
C) an organism that produces food from the energy in sunlight
D) organisms that eat plants and grasses

Answers

The correct answer is B) an organism that feeds on dead matter.

A scavenger is an organism that obtains its food by consuming dead or decaying organic matter.

These organisms play a crucial role in ecosystems by recycling nutrients and breaking down organic material that would otherwise accumulate.

Scavengers are often attracted to carcasses or decaying organic material, where they feed on the remains of dead plants or animals.

Scavengers can include a variety of organisms from different taxonomic groups, such as vultures, hyenas, flies, beetles, and certain species of bacteria and fungi. They have adaptations that allow them to consume and digest dead matter efficiently.

By consuming dead organic material, scavengers help in the decomposition process, returning nutrients to the ecosystem and maintaining ecological balance. They prevent the accumulation of dead matter, which can lead to the spread of diseases and the release of harmful substances.

In contrast to the other options, which describe different ecological roles or processes, option B accurately characterizes the feeding behavior and ecological role of scavengers in consuming dead matter as a source of nutrition.

Therefore, the correct answer is B.

For more such answers on scavenger

https://brainly.com/question/259333

#SPJ8

In 2012, excitement rippled through the scientific community with the discovery of an enzyme that appeared to be, just maybe, a powerful new tool for combating Alzheimer’s. At the Mayo Clinic in Florida researchers identified a gene, BACE2, which appeared to destroy beta-amyloid — a protein, then understood to be toxic, which is found in clusters in the brains of people living with Alzheimer’s. Alzheimer's is often diagnosed by measuring the amount of buildup of this protein. A large amount of it is an indicator of the disease. People with this buildup often do not have enough of the BACE2 enzyme created naturally in their body. If a way to synthesize this enzyme artificially or to prompt the body to create more were discovered, it could be hailed as a cure for Alzheimer's. How does the BACE2 enzyme work?

Answers

Answer:

BACE2 cuts both beta-amyloid and beta-amyloid precursor protein.

Explanation:

What makes BACE2 so effective in fighting Alzheimer's is its efficiency in cutting both beta-amyloid and the protein that develops it. There are other enzymes, which have the ability to break down beta-amyloid, but BACE2 is the only one that breaks it down into such small pieces that it completely destroys it. Furthermore, BACE2 is able to break down the beta-amyloid precursor protein, which prevents the formation of beta-amyloid from taking place.

Please help the picture is above I’ll mark as brainliest.

Answers

Answer: The last one im pretty sure.

Explanation:

CAN u pLZZ help me anwser my question

A cactus is adapted for life with limited water. The green
part of this cactus is its stem. Its stems are fleshy and
have a thick waxy coating.
What are two ways the structure of this cactus's stem helps the plant survive?
A. It takes in minerals from the soil.
B. It prevents water loss.
C. It carries out photosynthesis.
D. It holds the plant in the ground.

Answers

Answer:

i think its B hope it helps

Explanation:

Adaptations are the alteration that allows the survival of the fittest. The adapted structure of the cacti allows it to take the minerals from the soil and prevents water loss. Thus, options A and B are correct.

What are adaptations of cactus?

Adaptation is seen as the modified physical and chemical characteristics that allow the organism to survive in stressful conditions. A cactus has adapted spines, roots, waxy skin, and deep-layered stomata.

These adaptation has allowed the cactus to survive the harsh conditions of dessert. The wide fibrous roots allow it to draw nutrients and minerals from the soil.

The thick, expandable stem with deep-layered stomata prevents the loss of water from the surface in high-temperature conditions and keeps the plant hydrated.

Therefore, options A and B. the adapted attributes of cacti prevent water loss.

Learn more about adaptations here:

https://brainly.com/question/12501143

#SPJ5

PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:

A. decomposers, B. producers, C. consumers, D. demagorgans

Answers

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.

What is the function of the class of macromolecules represented in the following diagram

Answers

Answer:

lods ayarn na:)

Explanation:

The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.

Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.

Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.

Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.

Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.

Once mRNA is made it travels

A. out of the cytoplasm, into the nucleus where a ribosome will attach to it.

B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.

Answers

Answer:

B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.

Explanation:

Once mRNA is made, it travels out of the nucleus, into the cytoplasm where a ribosome will attach to it.

What is the function of the Sebaceous Gland * To produce Sweat
To produce water
To produce natural oils for the skin protection None of the Above​

Answers

Answer:

To produce natural oils for the skin

Explanation:

The normal function of sebaceous glands is to produce and secrete sebum, a group of complex oils including triglycerides and fatty acid breakdown products, wax esters, squalene, cholesterol esters and cholesterol.

Sebum lubricates the skin to protect against friction and makes it more impervious to moisture

DNA acts as a _____________ for living things
A. map

B. blueprint

Answers

Answer:

A. map

Explanation:

DNA acts as a map for living things.

Meiosis makes sperm and egg cells which are called

A. Gametes

B. Somatics

C. Spindles

Answers

Answer:

A. Gametes

hope it is helpful to you ☺️

the answer is gametes

Which equation summarizes the process of respiration​

Answers

Explanation:

i hope this helps you ok like

Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.

Answers

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

Question 2 of 10
What is the term for the condition of the atmosphere in a given area at a
given time?
A Weather
B. Latitude

C Climate
D. Altitude
SUBMIT
Need ASAP

Answers

A is the answer to this

Answer:

A .Weather

Explanation:

The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.

What type of RNA acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide
chain?

Answers

Answer:

messenger RNA (mRNA)

Explanation:

mRNA or messenger RNA is one of the three types of RNA molecules (the other being tRNA and rRNA) that is specifically responsible for carrying genetic information previously encoded and stored in the DNA into the ribosomes for translation to occur.

The process of translation results to the synthesis of amino acid sequences, which make up a polypeptide. Hence, it can be said that mRNA is that type of RNA that acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide chain.

Other Questions
1: Please write one sentence using each of the following STEM-CHANGING verbs.EXAMPLE: Yo duermo los sbados.1. almorzar (to each lunch)2. contar (to count)3. rogar (to beg)4. colgar (to hang)5. resolver (to resolve)6. dormir (to sleep)2: Use the 5 verbs provided below to tell your students what they are not supposed to do during class. You must first write the sentences (orders) in Spanish.1. Hablar2. Jugar3. Correr4. Empujar5. Dormir What did the Compromise of 1850 show?A. the issue of slavery was becoming a larger problem B.popular sovereignty would not work to settle the slavery issue c. the people of California wanted their state to become a slave stateD. Americans were unable to resolve their differences A train is moving with a speed of 100 m/s. If the train is traveling south, at what position will it be 3 minutes after passing the +1,000-meter position marker ?Remember, south is the negative direction and when you use the time, it must be in units of seconds. You will be applying one of the equations from above to solve this problem. And you must include a + sign if the final position is positive or a - sign if the final position is negative. A 56-year-old man with an insufficient aortic valve is scheduled for surgery. Identify the chamber of the heart that the regurgitated blood most likely enter. Will the blood regurgitated primarily during systole or diastole? An electron in a hydrogen atom moves from level 1 to level 4. The electron then drops from level 4 to level 2. Whichstatement describes the most likely result?O The energy absorbed in the first move equals the energy released in the second move.O The energy absorbed in the first move is greater than the energy released in the second move.O The energy released in the first move equals the energy absorbed in the second move.O The energy released in the first move is greater than the energy absorbed in the second move. g e-Dynamix Technologies, another electronics manufacturing firm, in important factors such as manufacturing capability and adaptability to market conditions. Which of the following terms best describes Futura-Core's abilities in comparison to Core-Dynamix? A. absolute advantage B. collective bargaining C. comparative advantage D. competitive advantage please help me! whats the answer?1) Two points2) One point 3) One equation Which of the following was not a consequence of early civilizations?O Development of religionsSpecialization of skillsO Consistent source of foodo Gender equality Kanye, Jonny, Jaco, and Neil are trying to form a band. They each have some basic skills on most instruments, so their current plan is for each of them to rotate among vocals, guitar, bass, and drums. After a year of practice and rehearsals the band still sounds awful. Kanye cannot keep a steady beat when on bass or drums, Jaco sounds terrible on everything except the bass, nobody except Jonny can remember all the chords on guitar, and even Neil's own mother thinks his singing sounds like a dying cow. At their current rate, they expect it will be several years before they are good enough to land their first paid performance. None of them have enough money saved up to last that long. They all know you are taking economics and ask your advice. What would you say to them? Determine the horizontal asymptote for the rational function. Answer choices:A.) y= 1B.) y= -5C.) y= 1D.) y= -1 I REALLY NEED HELP, PLEASE! EXPLAINING UR ANSWER = BRAINLIESTA prism with volume 7750 cm is dilated by a factor of 1/5.The volume of the dilated prism is ___ cubic centimeters. please help me with this.theres a picture attached with the fill in the blanks i have to dothe activity instructionsActividad 3: Pedir o preguntar?Completa lo que dicen algunas personas en un colegio con la forma apropiada de pedir o preguntar. Which organism, roadrunner or the owl, competes more for its food?Support your answer with evidence from the food web. HELLPPPPPPPPPPP PLEASSSEE IM BEGGING " Which linear function has a greatery-intercept than the function depicted in the graph." ***will mark brainliest* A fully loaded and fueled spacecraft can weigh close to 4.6 million pounds. What is this weight converted to tons? Find a equation of a line that is perpendicular to y=-4x+3 and passes through the point (4,-1). Which of the following statements about parts of speech is true? a. An abstract noun refers to a state of mind or idea. b. An adjective modifies a verb, adverb, or other adjective. c. Common nouns name particular persons, places, or things. does anyone know how to solve this? asap please:(( Select the correct answer. The variable g varies directly as the cube root of h. If g=128 when h=8, which equation can be used to find other combinations of g and h? [tex]g \sqrt[3]{h} = 256[/tex][tex]g = 64 \sqrt[3]{h} [/tex][tex]gh = 1024[/tex][tex]g = 16h[/tex] During WWII the US government did the following EXCEPTA. Allow women to stay out of the workforce.B. Relocated hundreds of thousands of Japanese Americans to internment camps. C. Relied on media personalities and comics to promote war programs and restrictions. D. Encouraged rationing and the growing of victory gardens.