if a cell contains 40% glucose what is the rest of the cell made up of ?

Answers

Answer 1
If it’s 40% glucose then it will be 60% water

Related Questions

What cellular function is negatively impacted by an increase in cell size?

Answers

Answer:  c

Explanation:

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

Multiply (2x + 5)(3x - 4).

Answers

The answer is : 6x^2 + 7x -20

Answer:

6 [tex]x^{2}[/tex]  +  7 x  −  20

ASAP Here is a nitrogen base sequence for a piece of one of the strands of a DNA molecule: ATTCGCGAT.

What would be the base sequence of the other complementary strand at this part of the DNA molecule?

Answers

Answer:

TAAGCGCTA

Explanation:

. A protease is added to a suspension of egg protein in a test-tube and kept at 37°C. After 8 minutes, the protein changes from cloudy to transparent. Which product, or products, will now be present in the test-tube

Answers

Answer:

amino acids

Explanation:

A protease is an enzyme capable of catalyzing the breakdown of proteins into polypeptide fragments and single amino acids, which are the building block of proteins. Proteases act by breaking peptide bonds by a process called hydrolysis, a reaction where water molecules break down peptide bonds (hydro means water and lysis means split). Proteases can be classified depending on the catalytic residue into cysteine, serine, threonine, aspartic, glutamic and metalloproteases.

The product that will be present in the test tube will be amino acids.

Protease is an enzyme that acts on protein by converting it into different

types of amino acids.

Amino acids are referred to as the building block of life and are important

nutrients in growth and replacement of worn-out tissues. The protease acts

on the protein by breaking the peptide bonds under the required

temperature.

An inadequate temperature may result in the denaturing of the enzyme

which was why the test was done at 37°C. This is the body temperature of

humans which led to the formation of amino acids which is absorbed by cells

of the body.

Read more on https://brainly.com/question/20299415

28) 6CO2 + 6H20 + (energy) → C6H12O6 + 602

Where does the energy come from in the reactants side of the chemical equation?
Plz help I have 10 mins left

Answers

Answer:The energy change in a chemical reaction is due to the difference in the amounts of stored chemical energy between the products and the reactants. This stored chemical energy, or heat content, of the system is known as its enthalpy.

Explanation:

Answer: The energy in this reaction (photosynthesis) comes from light.

Sorry about cutting it close, hope this helps.

What are the answers here? Select all that apply.

Answers

Answer:

the first, second, fourth, and fifth

what is cell differentiation dependent on

many things
the number of chromatids
gene expression
the number of stages in the cell cycle

Answers

Answer:

many things..........

HELP ME WITH THIS PLEASE!!!!!!!

Answers

Answer:

c

Explanation:

Answer:

Primary consumer.

Explanation:

Ok, so a producer is stuff like grass. Then you've got decomposers, which are maggots and vultures and animals like that (ew). Our primary consumer is the bird, then you've got the snake which eats the bird, and then there's the alpha predator, the hawk, which can eat both the snake and the bird. We call the alpha predator the tertiary consumer.

Do you get it now?

HELP! I NEED IT SOON! ILL GIVE BRAINLIEST

Answers

Answer: A: People with different goals can make contributions to scientific knowledge.

Schwann and Virchow both had different goals for what they were trying to discover, but both ended up adding to the same theory.

Hope this helps :)

What do you think might be causing these changes in cells?

a
A problem with the enzymes needed for protein synthesis.
b
A mutation in the DNA.
c
A problem with transcription, or the making of mRNA.
d
A problem with the ribosomes used in translation.

Answers

Answer:

I require more Information on the changes these cells are undergoing

Mr. Szarka tries to sprint a marathon and comes up very short. Explain why foolhardy Mr. Szarka could not complete the marathon and what would happen to his energy systems once he rested and caught his breath. What processes would be restricted during this sprint attempt, and how would they be regulated?

Answers

Answer: It’s not in shape like it’s cut out

Explanation:

Answer:

he could not complete it cut he out of shape

what type of species is a key element in keeping the ecosystem in balance

Answers

Answer:

predators keep the population of mice under control, insects pollinate flowers, and worms decompose leaf litter. All species are important and help keep the ecosystem balanced.

Explanation:

Answer:

keystone species

Explanation:

A wetland that contains a mixture of fresh water and salt water is called
an estuary
a stream
a river.
a pond

Answers

Answer:

an estuary

Explanation:

A wetland which contains a mixture of fresh water and salt water is called as an estuary. Thus, the correct option is A.

What is an estuary?

An estuary is an example of a partially enclosed, coastal water body where the freshwater from rivers and streams mixes up with the salt water from the ocean bodies. Estuaries, and their surrounding lands, are the places of transition from the land area to the sea area.

Estuaries and their surrounding wetlands are the bodies of water which are usually found where the rivers meet the sea. Estuaries are the home to many of the unique plant and animal communities which have adapted to the brackish water, which is a mixture of fresh water draining from the land and the salty seawater.

Therefore, the correct option is A.

Learn more about Estuary here:

https://brainly.com/question/17564221

#SPJ6

Which of the following equations are balanced?

2Fe + Cu(NO 3) 2 → 2Cu + Fe(NO 3) 2
2K + 2H 2O → H 2 + 2KOH
Li + Cl 2 → LiCl
2H 2 + O 2 → 2H 2O
2S + 3O 2 → 2SO 3

Answers

Answer:

the second, fourth and fifth ones are balanced.

25. Which of these does natural selection work on?
a. Only animals
b. All populations
c. Only microscopic organism
d. Individuals
e. Only small

Answers

The answer is B. Natural selection will find a way to affect one, then that one will affect many others.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Red blood cells are classifed as type A or type B, based on their surface antigens. Type O
blood does not contain any antigens. The chart below shows the possible phenotypes of
each blood type.
Blood Types
Blood Type Phenotype Alleles
B:
AB
B
AB
Which mechanism explains how both A and B antigens produce type AB blood?

Answers

Answer:

codominance

Explanation:

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

what is antigen?

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles in a heterozygous individual are fully expressed in the phenotype. Therefore, in the case of blood type AB, the A and B alleles are codominant, and both antigens are expressed on the surface of the red blood cells.

Hence, The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

Learn more about the antigen here

https://brainly.com/question/30587809

#SPJ2

Which product of respiration is considered waste material and leaves the alveoli?
O oxygen
O water
O carbon dioxide
O carbon monoxide

Answers

Answer:

In our respiratory system, carbon dioxide is the waste material that we expel when we breathe out. The answer is C, Carbon Dioxide

I hope you have a great day!

The waste product of respiration is

C. Carbon dioxide

The oxygen consumed via stomata is used up by cells.

Respiration in leaves:

Oxygen from the air enters a leaf through stomata and reaches all the cells by the process of diffusion. This oxygen is used in respiration in cells of the leaf. The carbon dioxide produced during diffuses out from the leaf into the air through same stomata. The oxygen used by cells in the leaves to disintegrate glucose into water and carbon dioxide.

Thus, option C is correct.

Find more information about Respiration here:

brainly.com/question/18169685

A molecule is a unit of energy


True or False

Answers

Answer:

true

Explanation:

Molecules are both vehicles for storing and transporting energy, and the means of converting it from one form to another when the formation, breaking, or rearrangement of the chemical bonds within them is accompanied by the uptake or release of heat.

Answer:

true

Explanation: Molecules are two or more atoms held together By chemical bonds.

The music and pictures connected with a story can also show blas.
A
True
B.
False

Answers

Answer:

A

Explanation:

I took the question in a online quiz

it’s A i took a test about that question

What is the average speed of a soccer ball that travels 34 m in 2s?

Answers

Answer:

17 m/s

Explanation:

s=d/t

s=34m/2s

Answer:

34/2 = 17 m/s

Explanation:

Distance Covered: s = 34 m

Time in which distance covered: t = 2 s

----

Average Speed: v = Distance Covered/time taken = s/t  

v = 34/2

v = 17 m/s

I hope this helps explain things a little better.

What reactant is needed in the light dependent reaction

Answers

Answer:

ATP and NADPH

Explanation:

they use it to reduce carbon dioxide and convert the energy into chemical bond energy in carbohydrates such as glucose

If an organism has 30 chromosomes in its body cells, how many chromosomes would it have in its sex cells (gametes)?

Answers

Answer:

15

Explanation:

Gametes have half the amount of dipliod somatic ells

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

How does geotheHow does geothermal energy differ from solar energy?

Geothermal energy is cooler and denser than solar energy.
Geothermal energy comes from the internal heat of Earth.
Geothermal energy is transmitted through the atmosphere.
Geothermal energy results from radiation of electromagnetic waves.rmal energy differ from solar energy?

Answers

Answer: B || Geothermal energy comes from the internal heat of Earth.

Explanation:

hope it helped xx :))

Explain why Hurricane Harvey traveled from the east (Africa) towards the west (Florida) when our weather in Wisconsin starts in the west and travels east?

PLEASE HELP!

Answers

Answer:

Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.

Explanation:

Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.

Which is NOT a function of lipids?

1.Absorption of Vitamins
2.Genetic Storage
3.Insulation/Cushioning
4.Energy

Answers

Lipids don't store genetic informations so the answer is 2

they absorb liposoluble vitamins they offer insulation/cushioning they store energy

Think about the variety of biomes on Earth and differences in their weather patterns. Which list shows environments from highest
average temperature to be lowest average temperature?


A) swamp, mountain, desert

B) swamp, desert, mountain

C) desert, swamp, mountain

D) mountain, desert, mounatin

Answers

Answer:

C

Explanation:

hope this helps

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

What are biomes?

Since they belong to certain areas or zones that, due to their geographical characteristics, share a climate, vegetation, and wildlife, biomes provide the primary support for the harmony of nature.

Any biome can include a wide range of habitats because the term "biome" is more general than "habitat." An area's climate and geography determine the biome classification. Communities that have adapted to the unique climate and ecology of the biome make up each one. Depending on the surroundings, they come in a variety of forms. The temperate deciduous biome is the ideal environment for human habitation.

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

Learn more about biomes, here:

https://brainly.com/question/18601179

#SPJ6

Summarize the possible applications of gene knockout GMOs.

Answers

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Other Questions
Why is it impossible for the atomic number of an element to be greater than its mass number? pls answer will mark brainliest In your own words, define the term bad evidence" and explain how this ideamay have played a part in Adnan's case. Use a specific example the averages of the squared differences between the data values and the mean is known as If you are trying to hit a baseball as far as possible, you would want to:apply a small force over a short timeapply a small force over a long timeapply a large force over a short timeapply a large force over a long time What is the correct definition of arteriosclerosis? A: a condition that occurs when fatty substances build up on the inner lining of arteries B: a surgical procedure in which an instrument with a tiny balloon attached is inserted into an artery to clear a blockage C: a group of disorders that cause a thickening and hardening of arteries D: a condition that occurs when the blood supply to the heart slows or stops, causing damage to the heart muscle need help with this........................................................ Given f(x) and g(x) = f(x) + k, use the graph to determine the value of k. Which best describes a difference between energy transformation in power plants and dams? Why might the earthquake in Indonesia have been so less deadly than those in India or Iran, even though it's magnitude was greater than both of them. * What's the length of the diameter of the ferris wheel? Which of the above diagrams correctly reflects the Green partys well-known platform and candidate? A. diagram A B. diagram B C. diagram C D. diagram DThe answer is Ddid the test PLEASE HELP ME ITS DUE TODAY!!PLS SHOW WORK OR EXPLAIN!! need help on answer b what is the difference between cell structure and cell function? A drag racing vehicle travels from 0 to 100 mph in 5 seconds north. What is the acceleration? Red meat is a very lean protein.O TrueFalse 1) Which sentence uses a figure of speech?Our conversation, like the storm clouds forming andA) dispersing above us, never could get anywheredefinite.The music of the marching band outside waftedB) inside the gymnasium where the boys werepracticing basketballThe gymnasium had to close down for a few weekswhile the managers had the floor redone to replacebroken tile.All of the kids in the hallway sat down at one timeD) and got out their lunches, refusing to eat in thecafeteria. Select the correct text in the passage.which sentence in this excerpt from George Bernard Shaw's Pygmalion reveals that Henry Higgins is proud to be an English speaker?THE NOTE TAKER: A woman who utters such depressing and disgusting sounds has no right to be anywhere-no right to live. Remember thatyou are a human being with a soul and the divine gift of articulate speech: that your native language is the language of Shakespear (sic) andMilton and The Bible; and don't sit there crooning like a billous pigeonTHE FLOWER GIRL: (quite overwhelmed, and looking up at him in mingled wonder and deprecation without daring to raise her head): Ah-ah-ah-owowo!THE NOTE TAKER (whipping out his book Heavens! what a sound! (He writes then holds out the book and reads, reproducing her vowelsexactly Ah-ah-ah-ow-ow-oo!THE FLOWER GIRL (tickled by the performance, and laughing inspite of herself: Garn!THE NOTE TAKER: You see this creature with her kerbstone English: the English that will keep her in the gutter to the end of her days. Well, sir, inthree months I could pass that girl off as a duchess at an ambassador's garden party. I could even get her a place as lady's maid or shopassistant, which requires better English. That's the sort of thing I do for commercial millionaires. And on the profits of it I do genuine scientificwork in phonetics, and a little as a poet on Miltonic lines. Can you please help me