Hi. You did not submit any image, table or description of a molecule for the functional groups to be pointed out. This makes it impossible for your question to be answered. However, I will try to help you as best I can.
A functional group is a set of atoms of different chemical elements that take the place of a hydrogen atom that was part of a hydrocarbon (it is a molecule composed of carbon and hydrogen atoms). The most common functional group is −OH, but you also often encounter −SH, −NH2, and −OPO2−3 functional groups.
-
PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:
A. decomposers, B. producers, C. consumers, D. demagorgans
Answer:
a. decomposers
Explanation:
Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.
two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad
Answer:
A. wheter the producers are located on land or in the water.
Which type of weather is associated with the eye of the hurricane?
calm
stormy
windy weather
Answer:
A windy weather
Explanation:
Tree will began to swayed
pls help ASAP i will mark brainliest
Answer:
ok
i can help you ..............
Explanation:
drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.
which two molecule do green plants use to make glucose
Answer:
Carbon Dioxide and Water
Meiosis makes sperm and egg cells which are called
A. Gametes
B. Somatics
C. Spindles
Answer:
A. Gametes
hope it is helpful to you ☺️
What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species
Answer:
genus and species are combined to form a scientific nameAnswer:
GenusSpeciesExplanation:
The word is genus and species. These two taxon make up the scientific name.
Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars
Answer:
essentially glucose and oxygen are the products of photosynthesis
Explanation:
Starch is a polysaccharide used as a component of cell walls in plants.
True
False
Answer:
false
Explanation:
is type of carbohydrates
False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.
What are structural component of cell wall?Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.
Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.
Learn more about cell wall, here:
https://brainly.com/question/965751
#SPJ2
What could be inferred from suntans?
Group of answer choices
A tan might indicate sun damage to the skin.
Tanning produces healthier skin.
A tan strengthens the elastic in the skin.
Tanning makes skin look younger.
Answer:
A tan might indicate sun damage to the skin.
Explanation:
Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.
A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.
Describe the processes involved in photosynthesis
Explanation:
During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. ... Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.
Answer:
During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.
the tRNA for GUCAUCGAUCGAUCGGAUGCC
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
hiii! ill give brainliest if u answer this :))
Why are enzymes important?
1. They contain the genetic material.
2. They speed up chemical reactions.
3. They bring water into the cell.
4. They help the cell maintain its shape.
Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.
Please select the best answer from the choices provided
A
B
C
D
Answer:
a
Explanation:
just did it
Answer:
the answer should be "B"
What is the source of the carbon dioxide that is used in photosynthesis?
Answer:
Photosynthetic cells
Explanation:
photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen
I’m 98% sure it’s c but it might be B could someone check pls
Answer:
I think C
Have a great day
[tex]#Liliflim✌[/tex]
Answer:
Explanation:
A
Please help me with please
Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4
Answer:
(1) a table tennis ball
Explanation:
The earth will most closely resemble any type of sphere or circular ball.
species I
species II
species III
species IV
natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .
Answer:
viable
Explanation:
Only the animals who are able to survive will live long enough to reproduce
Question 2 of 10
What is the term for the condition of the atmosphere in a given area at a
given time?
A Weather
B. Latitude
C Climate
D. Altitude
SUBMIT
Need ASAP
Answer:
A .Weather
Explanation:
The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.
mango tree and Vanda ecological interaction
Answer:
The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.
hope it helps
Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.
Answer:
Its either a or b
Explanation:
A say the body can make all of the compound its need
my suggestion compound are made up of water ,mineral protein carbs and fat
our body produce little nutrients so we need to eat to get the nutrients we need
im am going with b
B is the answer
There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins
Answer:
c information storage
Explanation:
information is stored in dna which provides the instructions required to make proteins . proteins do not store information
What molecule forms a double helix structure composed of two complimentary strands of nucleotides?
What is the
Magnification
of a plant cell?
Answer:
400x
Explanation:
What is the function of the class of macromolecules represented in the following diagram
Answer:
lods ayarn na:)
Explanation:
The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.
Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.
Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.
Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.
Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.
Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?
Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor
Answer:
The correct answer is - pH.
Explanation:
Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.
It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.
Which correctly describes the projected growth of the world's population in
the future?
A. The rate of growth will remain the same.
B. It will not grow much higher than it is now.
C. The population will eventually begin declining.
D. The rate of growth will slow down by 2100.
Answer:
D the rate of growth will slow down by 2100
Explanation:
Sorry if it’s wrong
World's population growth rate will slow down by 2100 in future.
What is world's population growth ?The rise in the number of people in a population or dispersed group is known as population growth. Global population growth is roughly 83 million people per year, or 1.1 percent per year. From 1 billion in 1800 to 7.9 billion in 2020, the world's population has increased dramatically. What will be the world's population growth rate in future?The world's population is expected to reach 10.9 billion by 2100 in future, with yearly growth of less than 0.1 percent – a significant decrease from present rates. Between 1950 and today, the world's population increased by 1% to 2% per year, going from 2.5 billion to more than 7.7 billion people.Hence, the correct option is D.
To know more about population growth here,
https://brainly.com/question/17487289
#SPJ2