help me pleaseeeeeeeeeeeeeeeeeeeeee!!!!!!!!!!!!!!!!

Help Me Pleaseeeeeeeeeeeeeeeeeeeeee!!!!!!!!!!!!!!!!

Answers

Answer 1

5% of $1100 = 55

Year given = 7

So, 55 × 7 = 385

She would get after 7 years all total  = (1100 + 385) = $1485


Related Questions

Dee chose A as the correct answer. What was her error? Answer in a complete sentence.

Answers

Number of square feet of wall painted in 1 hour is 243 square feet. Therefore, option C is the correct answer.

Given that, it takes Zach 10 minutes to paint [tex]40\frac{1}{2}[/tex] square feet of his bedroom wall.

What is the unitary method?

The unitary method is a technique for solving a problem by first finding the value of a single unit, and then finding the necessary value by multiplying the single unit value.

Here,  square feet = 40.5 square feet

Rate at which he paints the wall =40.5/10

= 4.05 square feet per minute

As we know 1 hour =60 minutes

Now, number of square feet

= 4.05×60

= 243 square feet

Number of square feet of wall painted in 1 hour is 243 square feet. Therefore, option C is the correct answer.

To learn more about the unitary method visit:

brainly.com/question/22056199.

#SPJ1

Question 1
Is this a function? Explain, why or why not!
X
-2
-4
-6
y
1
1
1
Edit View Insert Format Tools Table
2 pts

Answers

Yes it is a function because for every output there is a different input

1. please Prove that the angle that an are of a circle subtends at the centre is twice that which it substends at any point on the remaining part of the circumfrence.​

Answers

To prove that the angle that an arc of a circle subtends at the center is twice that which it subtends at any point on the remaining part of the circumference, we will use the definition of an arc and the definition of an angle.

An arc is a portion of the circumference of a circle. If we draw an arc with central angle A, the arc will subtend an angle A at the center of the circle.

An angle is a measure of rotation. If we draw a radius from the center of the circle to any point on the arc, the angle formed by the radius and the arc will be half of the angle A.

Since the arc subtends an angle A at the center of the circle, and the angle formed by the radius and the arc is half of the angle A, it follows that the angle that an arc of a circle subtends at the center is twice that which it subtends at any point on the remaining part of the circumference.

This can be formally stated as follows:

For any arc of a circle with central angle A, the angle that the arc subtends at the center of the circle is 2 times the angle that the arc subtends at any point on the remaining part of the circumference.

This conclusion holds true regardless of the size of the arc or the size of the circle.



Please brainliest

Hi can someone solve this with steps?

Answers

Answer:

42

Step-by-step explanation:

Given function:

[tex]f(x)=4x^4-2x^3-3x^2+3x[/tex]

Use the method of synthetic substitution to find the value of the function when x = 2.

Place the value of x in the left box and write the coefficients of the function in descending order, remembering to write a zero for the coefficient of any missing term.  

(As there is no constant term in this function, the last coefficient should be written as zero).

       [tex]4x^4-2x^3-3x^2+3x[/tex]

[tex]\begin{array}{c|ccccc}2&4&\:\:-2&\;\;-3&\;\:\:\:\:3&\;\;0\\\cline{1-1} \end{array}[/tex]

Bring the leading coefficient down:

[tex]\begin{array}{c|ccccc}2 &4&-2&-3&3&0\\\cline{1-1}&\downarrow &&&\\\cline{2-6}&4\end{array}[/tex]

Multiply the number you brought down with the number in the box and put the result in the next column (under the -2):

[tex]\begin{array}{c|rrrrr}2 &4&-2&-3&3&0\\\cline{1-1}&\downarrow &8&&\\\cline{2-6}&4\end{array}[/tex]

Add the two numbers in the second column together and put the result under them in the bottom row:

[tex]\begin{array}{c|rrrrr}2 &4&-2&-3&3&0\\\cline{1-1}&\downarrow &8&&\\\cline{2-6}&4&6\end{array}[/tex]

Repeat:

[tex]\begin{array}{c|rrrrr}2 &4&-2&-3&3&0\\\cline{1-1}&\downarrow &8&12&\\\cline{2-6}&4&6&9\end{array}[/tex]

[tex]\begin{array}{c|rrrrr}2 &4&-2&-3&3&0\\\cline{1-1}&\downarrow &8&12&18\\\cline{2-6}&4&6&9&21\end{array}[/tex]

[tex]\begin{array}{c|rrrrr}2 &4&-2&-3&3&0\\\cline{1-1}&\downarrow &8&12&18&42\\\cline{2-6}&4&6&9&21&42\end{array}[/tex]

The last value, 42, is the value of the function when x is 2.

Therefore,

[tex]f(2)=4x^4-2x^3-3x^2+3x=42[/tex]

i need help with this ​

Answers

Rounding to the nearest tenth, we get that the length of KN is approximately 21.8.

What is a Pythagoras theorem?

The theorem states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides. This relationship is often expressed in the form of the equation:

a² + b² = c²

To find the length of KN in this right triangle, you can use the Pythagorean theorem. This theorem states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides.

In this case, the hypotenuse is KL, and the other two sides are KM and KN. The theorem can be written as:

KL² = KM² + KN²

Substituting the given values, we get:

24² = 10² + KN²

Solving for KN, we get:

KN² = 24² - 10²

= 576 - 100

= 476

KN = √476

= 21.84

Hence, rounding to the nearest tenth, we get that the length of KN is approximately 21.8.

To learn more about Pythagoras' theorem, visit:

https://brainly.com/question/343682

#SPJ1

Rounding to the nearest tenth, we get that the length of KN is approximately 21.8.

What is a Pythagoras theorem?

The theorem states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides. This relationship is often expressed in the form of the equation:

a² + b² = c²

To find the length of KN in this right triangle, you can use the Pythagorean theorem. This theorem states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides.

In this case, the hypotenuse is KL, and the other two sides are KM and KN. The theorem can be written as:

KL² = KM² + KN²

Substituting the given values, we get:

24² = 10² + KN²

Solving for KN, we get:

KN² = 24² - 10²

= 576 - 100

= 476

KN = √476

= 21.84

Hence, rounding to the nearest tenth, we get that the length of KN is approximately 21.8.

To learn more about Pythagoras' theorem, visit:

brainly.com/question/343682

#SPJ1

A university will spend Atmos 6000 by monitors and keyboards for computer lab each monitor will cost $200 and each keyboard will cost $25 which inequality represents all possible combinations of x the number of monitors and y the number of keyboards the university can buy for the computer lab?

Answers

Answer:

Answer: 200x + 25y <= 6000

Step-by-step explanation:

1.03 of 0.054 is what number?

Answers

Answer:

1.03% of 0.054=0.0005562

I think it’s 0.05562

Cara wants to build an 80 foot long rectangular sheep pen in back of her barn. If she bought 180 feet of fencing and used her barn wall as one side of the pen equaling the width, what would be the area of the sheep pen?.

Answers

180 ft2 be the area of the rectangular  sheep pen .

What is rectangle?

A quadrilateral is a shape with two opposed sides that are equal and parallel.

                     There are four 90-degree angles on its four sides, making it a four-sided polygon. The shape of a rectangle is two dimensional.

Length of the sheep pen =60ft

150 ft of fencing bought

One side of rectangular sheep pen is covered with barn which is equaling the  width

perimeter of rectangular sheep pen = 2(length +width)

length need to covered is 2 Length+ width

150 =2 length+width

150 = 2 x60 +width

150-120= width

30= width

Area of rectangle = 60 x 30

                         =      180 ft2

Learn more about Rectangle

brainly.com/question/15019502

#SPJ4

Drag each label to the correct location in the equation. not all tiles will be used.
the density of mercury is 13.6 grams per cubic centimeter. complete the steps for converting 13.6 g/cm3 to kg/m3. (1 kg = 1,000 g, 1 m3 = 106 cm3)
13,600 10^6 1,360 1 g 1 kg 1 m3
13.6g/cm^3 x ( )/1000g x ( ) cm^3/( ) = ( ) kg/m^3

Answers

As per the given equation, the resulting conversion is written as,

13.6g/cm³ x 1kg/1000 x 10⁶cm³/m³ = 13600kg/m³

Equation:

An equation consist the value of the variable, numbers and the constants.

Given,

Here we have the density of mercury is 13.6 grams per cubic centimeter.

Now, we have to convert this one into kg/m3.

Here the process of conversion of  13.6 g/cm3 to kg/m3

We know that, 1 Kg of weight is equal to 1000 grams of weight

Then it can be written as

=> 1 g = 1 kg/1000

Then the first blank (numerator) will be filled with 1 Kg

Similarly, 1 meter is equal to 100 centimeter

So, for cubic unit it can be written as,

=> 1 cm³ = 1m³/100³

It can be simplified as,

=> 1 cm³ = 1m³/10⁶

Now, the second blank (numerator) will be filled with 10⁶

Finally, the third blank (denominator) will be filled with 1m³

Therefore, the last blank will be 13600

Hence, we have find the all the values on the blanks.

To know more about Equation here.

https://brainly.com/question/10413253

#SPJ4

Please name these last two shapes

Answers

Answer:

Step-by-step explanation:

Square, Irregular shape


161% of 200 = what ?

Answers

Answer:332

Step-by-step explanation:Solution for 161 is what percent of 200:

161:200*100 =

(161*100):200 =

16100:200 = 80.5

Now we have: 161 is what percent of 200 = 80.5

Question: 161 is what percent of 200?

Percentage solution with steps:

Step 1: We make the assumption that 200 is 100% since it is our output value.

Step 2: We next represent the value we seek with $x$.

Step 3: From step 1, it follows that $100\%=200$.

Step 4: In the same vein, $x\%=161$.

Step 5: This gives us a pair of simple equations:

$100\%=200(1)$.

$x\%=161(2)$.

Step 6: By simply dividing equation 1 by equation 2 and taking note of the fact that both the LHS

(left hand side) of both equations have the same unit (%); we have

$\frac{100\%}{x\%}=\frac{200}{161}$

Step 7: Taking the inverse (or reciprocal) of both sides yields

$\frac{x\%}{100\%}=\frac{161}{200}$

$\Rightarrow x=80.5\%$

Therefore, $161$ is $80.5\%$ of $200$.

it is 322 i believe

A lione ha 4 cub that weigh 1. 7 kg, 2. 1 kg, 3 kg, and 2. 7 kg. Each cub eat 1. 25 kg of food a day. How much food will be needed to feed all the cub for one year?

Answers

The food will be needed to feed all the cub for one year is 1825 kg.

Given :

A lion ha 4 cubs that weigh 1. 7 kg, 2. 1 kg, 3 kg, and 2. 7 kg. Each cub eat 1. 25 kg of food a day.

one cub eats food = 1.25 kg

4 cubs eats food = 1.25 kg * 4

= 125 / 100 * 4 kg

= 500 / 100 kg

= 5 kg

5 kg for one day.

cub eats food for one year = 365 * 5 kg

= 1825 kg.

Therefore the food will be needed to feed all the cub for one year is 1825 kg.

Learn more about the year here:

https://brainly.com/question/14510285

#SPJ4

multiplications of matrices

Answers

The product of A x B of matrix is

a)  [tex]C = \left[\begin{array}{ccc}8 & 12 \\ 10 &15 \\\end{array}\right][/tex]

b) [tex]C = \left[\begin{array}{ccc}3 &6 \\ 4 &8 \\\end{array}\right][/tex]

c) [tex]C = \left[\begin{array}{ccc}-7 &-2 \\ 42 &12 \\\end{array}\right][/tex]

d) [tex]C = \left[\begin{array}{ccc}24 &-96 \\ 15 &-60 \\\end{array}\right][/tex]

What is multiplication of matrices?

The product of two matrices A and B is defined if the number of columns of A is equal to the number of rows of B. The first matrix must have the same number of columns as the second matrix has rows. The number of rows of the resulting matrix equals the number of rows of the first matrix, and the number of columns of the resulting matrix equals the number of columns of the second matrix

Given data ,

a)

Let the 2 matrices be A and B

The value of matrix A is

[tex]A = \left[\begin{array}{ccc}4\\5\\\end{array}\right][/tex]

The value of matrix B is

[tex]B = \left[\begin{array}{ccc}2&3\\\end{array}\right][/tex]

Now , the dimensions of matrix A is 2 x 1 and of matrix B is 1 x 2

So , matrix multiplication is possible

Now , let C be the result of A x B

And ,

[tex]C = \left[\begin{array}{ccc}4\\5\\\end{array}\right] *\left[\begin{array}{ccc}2&3\\\end{array}\right][/tex]

So  , the value of matrix C is calculated as

[tex]C = \left[\begin{array}{ccc}( 4 * 2 ) &( 4 * 3 )\\( 5 * 2 ) &(5 * 3 )\\\end{array}\right][/tex]

On simplifying the matrix , we get

[tex]C = \left[\begin{array}{ccc}8 & 12 \\ 10 &15 \\\end{array}\right][/tex]

Therefore , the value of matrix C is   [tex]C = \left[\begin{array}{ccc}8 & 12 \\ 10 &15 \\\end{array}\right][/tex]

b)

C be the result of A x B

The value of matrix A

[tex]A = \left[\begin{array}{ccc}3\\4\\\end{array}\right][/tex]

The value of matrix B is

[tex]B = \left[\begin{array}{ccc}1&2\\\end{array}\right][/tex]

Now , let C be the result of A x B

And ,

[tex]C = \left[\begin{array}{ccc}( 3 * 1 ) &( 3 * 2 )\\( 4 * 1 ) &(4 * 2 )\\\end{array}\right][/tex]

On simplifying the matrix , we get

[tex]C = \left[\begin{array}{ccc}3 &6 \\ 4 &8 \\\end{array}\right][/tex]

Therefore , the value of matrix C is [tex]C = \left[\begin{array}{ccc}3 &6 \\ 4 &8 \\\end{array}\right][/tex]

c)

C be the result of A x B

The value of matrix A

[tex]A = \left[\begin{array}{ccc}-1\\6\\\end{array}\right]\\[/tex]

The value of matrix B

[tex]B = \left[\begin{array}{ccc}7&2\\\end{array}\right][/tex]

Now , let C be the result of A x B

And ,

[tex]C = \left[\begin{array}{ccc}-7 &-2 \\ 42 &12 \\\end{array}\right][/tex]

Therefore , the value of matrix C is [tex]C = \left[\begin{array}{ccc}-7 &-2 \\ 42 &12 \\\end{array}\right][/tex]

d)

C be the result of A x B

The value of matrix A

[tex]A = \left[\begin{array}{ccc}8\\5\\\end{array}\right]\\[/tex]

The value of matrix B

[tex]B = \left[\begin{array}{ccc}3&-12\\\end{array}\right][/tex]

Now , let C be the result of A x B

And ,

[tex]C = \left[\begin{array}{ccc}24 &-96 \\ 15 &-60 \\\end{array}\right][/tex]

Therefore , the value of matrix C is [tex]C = \left[\begin{array}{ccc}24 &-96 \\ 15 &-60 \\\end{array}\right][/tex]

Hence , the matrix multiplication is done and the results are given

To learn more about matrix multiplication click :

https://brainly.com/question/13198061

#SPJ1

1 and (-1,-4) y-intercept

Answers

The graph's intersection with the x-axis is known as the x-intercept. The graph's intersection with the y-axis is known as the y-intercept.The y-intercept is (0,-4).

what is X-intercept and Y intercept?

To find Y intercept substitute x=0;

here X interept is (1,-1)

Y intercept (0,-4)

The x- and y-intercept visual concept is quite straightforward. Where the graph crosses the x-axis is known as the x-intercept, and the y-intercept is where the graph crosses the y-axis. A line's X-intercept provides information about the point where the x-axis is crossed.In a similar manner, the line's y-intercept represents the location at which the y-axis is crossed. In a given equation, only one intercept can be determined at once.The point at which a line crosses the x axis is known as the line's x-intercept. (i.e., in the case where y = 0) X interept=(x,0)The point at which a line crosses the y axis is known as the line's y-intercept. (i.e. in the case where x = 0)  Y interept =(0,y)

To learn more about X-intercept and Y intercept refer to:

https://brainly.com/question/28773339

#SPJ1

You have 2 different aving account. For Account​ A, the imple interet earned after 15 month i ​$9. 25. For Account​ B, the imple interet earned after 18 month i ​$25. 20. If the interet rate i 3. 7​% for Account A and 2. 4​% for Account​ B, how much i the principal in each​ account? Which account earned you the mot interet the firt​ month? Explain your anwer

Answers

The principal amount for account A is $200 and for account B is $700.

Account B earns more simple interest than account B in first month.

Given,

Account A

Simple interest, SI = $9.25

Time period, T = 15 months = 1 1/4 = 5/4 years

Rate of interest, R = 3.7%

Account B

Simple interest, SI = $25.20

Time period, T = 18 months = 1 1/2 = 3/2 years

Rate of interest, R = 2.4%

We have to find the principal amount for each account and also the account which earned the more simple interest;

Here,

Simple interest, SI = PRT/100

P is the principal amount

Now,

Account A.

Principal amount,

SI = PRT/100

9.25 = (P × 3.7 × 5/4) / 100

9.25 × 100 = P × 4.625

P = 925/4.625

P = $200

Simple interest for first month,

SI = PRT/100

SI = (200 × 3.7 × 1/15) / 100

SI = 2 × 3.7 × 1/15

SI = $0.493

Next,

Account B

Principal amount,

SI = PRT/100

25.20 = (P × 2.4 × 3/2) / 100

25.20 × 100 = P × 3.6

P = 2520/3.6

P = $700

Simple interest for first month,

SI = PRT/100

SI = (700 × 2.4 × 1/18) / 100

SI = 7 × 2.4 × 1/18

SI = $0.933

Here,

The principal amount for account A is $200

The principal amount for account B is $700

Simple interest for first month;

Account A = $0.493

Account B = $0.933

Therefore,

In first month account B earns more simple interest than account A.

Learn more about simple interest here;

https://brainly.com/question/29709325

#SPJ4

Milan runs7 miles in 60 minutes. At the same rate, how many miles would he run in 24 minutes

Answers

Answer:

2.8 Miles in 24 minutes

Step-by-step explanation:

60 / 24 = 2.5

2.5 / 7 = 2.8

Answer:

17.5mi

Step-by-step explanation:

7mi = 17.5mi

60min = 24min

60/24=2.5

2.5*7=17.5

A bread is cut into 10 equal parts. How many children can share all parts of the bread if each child takes 0.2 parts​

Answers

5 children can share all parts of the bread if each child takes 0.2 parts.

What are Fractions?

Fraction are numbers of the form [tex]\frac{a}{b}[/tex] where a and b are real numbers. It is represented as a portion or part of a whole.

The number on the top is called numerator and the number on the bottom is called denominator.

There are 10 equal parts of bread and each child takes 0.2 part.

Total parts of the bread = 10

Part each child takes = 0.2 = [tex]\frac{2}{10}[/tex]

2 parts out of 10 are taken by each child.

Remaining are  [tex]\frac{8}{10}[/tex] parts.

[tex]\frac{2}{10}[/tex] × 4 =  [tex]\frac{8}{10}[/tex]

Remaining parts can be shared by 4 children.

Hence number of children who can share the bread if each takes 0.2 parts = 5

To learn more on Fractions, click:

https://brainly.com/question/10354322

#SPJ1

can some one help me with this please​

Answers

Answer:

  3⁰ = 1

  x⁰ = 1

Step-by-step explanation:

You want powers of 3 filled in your table from an exponent of 4 down to an exponent of 0.

Powers of 3

3⁴ = 3·3·3·3 = 81 . . . . . . 3 is a factor 4 times

3³ = 3·3·3 = 27 . . . . . . .  3 is a factor 3 times

Each row of the table has 3 being a factor of 3^x one fewer times, so each value of 3^x is 1/3 of the previous value.

The last two rows of the table are ...

  3¹ = 3

  3⁰ = 1

See the attachment for the whole table.

In general, the meaning of x⁰ is ...

  x⁰ = 1

__

Additional comment

In algebra, 0⁰ = 1 is the usual definition. In some contexts (mathematical analysis, calculus), it may be "undefined."

That means x⁰ = 1 for all real numbers x, including x = 0.

I don’t feel like typing

Answers

Answer:

A

Step-by-step explanation:

mass / volume

m/v

Answer: d = m/V

Step-by-step explanation: density is the mass divided by volume or d= m/V

Like ha blue and red ball. Every day he win 2 blue ball and loe 3 red. After 5 day he won the ame amount of blue ball a red. After 9 day he had twice a many blue ball a red. How many red ball he have at the beginning

Answers

He started out with 47 balls after winning 2 blue balls and losing 3 red balls.

What is equation?

The definition of an equation in algebra is a mathematical statement that demonstrates the equality of two mathematical expressions. For instance, the equation 3x + 5 = 14 consists of the two equations 3x + 5 and 14, which are separated by the 'equal' sign. Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation. Equal treatment should be given to each party.

Here,

Let the number of blue balls be x and the number of red balls be y,

after 5 days ,

x + 10 = y - 15      

after 9 days ,

x + 18 = 2 * ( y - 27 )  

subtracting both,

8 = y - 39

y = 47

The number of red balls in beginning is 47.

He had 47 balls in the beginning as he win 2 blue ball and lose 3 red balls.

To know more about equation,

https://brainly.com/question/2228446

#SPJ4

A laptop computer originally priced at $2100 now ell for $2,200. What i the percent of increae?

Answers

The percent of increase is 4.761 %

Given :

A laptop computer originally priced at $2100 now and sell for $2,200.

Percentage :

In mathematics, a percentage is a number or ratio that can be expressed as a fraction of 100.

If we have to calculate percent of a number, divide the number by the whole and multiply by 100.

Difference = sell price - original price

= 2200 - 2100

= 100

Percent of increase = 100 * 100 / 2100

= 100 * 1 / 21

= 100 / 21

= 4.761 %

Therefore 4.761 % increase in percent.

learn more about the percent here:

https://brainly.com/question/28840349

#SPJ4

Circle a ha a diameter of 9cm. Cirlce b ha a radiu of 5 cm. 1. Which circle ha a larger circumference? 2. About how many centimeter larger i it

Answers

Circle B will have larger circumference by 3.14 centimeter

What is Circumference of Circle ?

The distance along a circle's perimeter is referred to as its circumference. In other words, the circumference of a circle is equal to the length of a straight line formed by opening up the circle.

The circumference of the circle is = 2пr where r is radius

According to the information

Circle A has diameter = 9 cm

Radius of circle A = [tex]\frac{9}{2}[/tex] cm

Circumference of Circle A = 2пr

                                            = 2 × 22/7 × 9/2

                                            = 28.28 centimeter  

Circle B has radius = 5 cm

Circumference of circle B = 2 × 22/7 × 5

                                             = 31.42 centimeter

Circle B will have larger circumference by 3.14 centimeter

To know more about Circumference

https://brainly.com/question/28757341

#SPJ4

the sum of 5 and a number x
show work

Answers

Answer:

x+5 or 5+x

Step-by-step explanation:

It seems we are looking for a math expression that is the same as English expression you wrote.The sum is what we get when we add numbers. Therefore, we could restate the English expression as what do we get when we add 5 to the number x? While we do not know what specific number x represents, we do know that if we add 5 to the number x we get 5 plus x. Now the question can be restated as, "How do we write 5 plus the number x?" Do you know the answer now? Does 5 + x sound right? How about x + 5? Both of these expressions are correct as they both represent the sum of 5 and the number x.

(1). 7/10 - 2/5
(2). 3/4 + 5/6
(3). 17/9 - 11/12
(4). 2/3 + 1/4 - 7/12

Answers

Answer:

1. 3/10

2. 19/12

3. 35/36

4. 1/3

Step-by-step explanation:

A certain state uses the following progressive tax rate for calculating individual income tax: Progressive Income Range ($) Tax Rate 0 - 10,000 10,001 - 50,000 50,001 - 100,000 3% 5% 5.5% Calculate the state income tax owed on a $90,000 per year salary. tax = $[ ? ] Round your answer to the nearest whole dollar amount.

Answers

The required state income tax owed on a $90,000 per year salary is $4950.

Given that,
A table shows the income tax owed by the state on the particularar salary,
Income Range ($)      Tax Rate

0 - 10,000                     3%
10,001 - 50,000             5%
50,001 - 100,000           5.5%

What is percentage?

The percentage is the ratio of the composition of matter to the overall composition of matter multiplied by 100.

Here,
on $90,000
Tax owed = 5.5% of 90000, because this salary lies in the segment 50,001 - 100,000.
Tax owed = 0.055[90000] = $4950

Thus, the required state income tax owed on a $90,000 per year salary is $4950.

Learn more about percentage here:

brainly.com/question/13450942

#SPJ1

Bennett has 107 photographs to place in the school yearbook. He will put the same number of photos on each of the 13 pages. If he can put 4 pictures in a row, how many photographs will not be placed in the yearbook?

Answers

Answer:

2 rows on each page equals 104, which means that there would be 3 non-used photos

Step-by-step explanation:

Jon bought 6 gallons of gas for $24
A( Find the cost of 1 gallon
B( Find the cost of 12 gallons

Answers

Answer:

A/ $4 for 1 gallon

B/ $48

Step-by-step explanation:

Take 24 divided by 6 = $4 per gallon

Then take 4 times 12 = $48 for 12 gallons

If you can please give me a Brainliest, thank you!

how do negative exponents represent reapeated division NEEED THIS DONE BEFORE MIDNIGHT 12/4/22

Answers

the positive reciprocal of the base multiplied by itself x times.

Hope this helps you

question is in the screenshot

Answers

The base length of the isosceles triangle is 23. Therefore, the correct option is C.

How to find the side of an isosceles triangle?

An isosceles triangle is a triangle with (at least) two equal sides. It also has two angles equal to each other.

The base angle of an isosceles triangle is equal in length.

The legs of an isosceles triangle are equal. Therefore,

3x - 1 = - 3x + 41

3x + 3x = 41 + 1

6x = 42

divide both sides by 6

x = 42  /6

x = 7

Let's find the length of the base side.

Therefore,

4x - 5

where

x = 7

4(7) - 5 = 28 - 5 = 23

learn more on isosceles triangle here: https://brainly.com/question/28412104

#SPJ1

Find the value of a b c if 173a i diviible by 9, 173b i diviible by 11 and 173c i divible by 6

Answers

The value of a , b and c are 7, 11 and 1 respectively.

173a is divisible by 9.

Rule of divisible by 9 is:

The number itself is divisible by 9 if its digit sum is also divisible by 9.

digits sum  =  1+7+3+a  = 11+a.

11+a is divisible by 9. a can be 7 so that 11+7 = 18 is divisible by 9.

minimum positive value of a = 7.

173b is divisible by 11

Rule of divisible by 11 is:

A number is completely divisible by 11 if the difference between the sum of its alternative digits is divisible by 11.

sum of its alterative digits:

1+3 =4  

7+b =7+b

difference of alternative digits sum = 7+b-4 = b+3 is divisible by 11 b = 8

so that 8+3 = 11 is divisible by 11.

minimum positive value of b = 11.

173c is divisible by 6.

Rule of divisible by 11 is:

Any number that can be divided by both 2 and 3 is also divisible by 6.

sum of digits of number = 1+7+3+c = 11 + c if divisible by 2 then it should be even if we put c = 1  , 11+1 = 12 which is divisible by both 2 and 3.

minimum positive value of c = 1.

So the value of a ,b and c are 7, 11 and 1 respectively.

To know more about divisibility here

https://brainly.com/question/10703980

#SPJ4

Other Questions
can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope. Find the absolute extrema if they exist, as well as all values of x where they occur, for the function f(x)=(x-64)^{1/11} on the domain [-8,9]Select the correct choice below and, if necessary, fill in the answer boxes to complete your choice.A. The absolute maximum is , which occurs at x= (Round the absolute maximum to two decimal places as needed. Type an exact answer for the value of x where the maximum occurs. Use a comma to separate answers as needed.)B. There is no absolute maximum. What challenges you face during a searching for a business conference ? Explain when in psychoanalysis, the patient is asked to reveal whatever thoughts, feelings, or images come to mind, this technique is called: ACTIVITY 3: What is the message of the picture? Why did mom and dad hace ti hice marjis posters? Northerners were concerned about expansion because they felt it couldpossibly lead to:OA. war with foreign powers over land in the West.B. an attack on their cultural traditions and economy.O C. a system where they would pay more for goods and services.O D. new federal policies that would only benefit the South. Please help !!! John paid $280 for a new mountain bicycle to sell in his shop. He wants to price it so that he can offer a 30% discount but still make 10% of the price he paid for it. At what price should the bike be marked?