he storytelling timeline of arrival is ____________, as is every visual and linguistic motif in the film.

Answers

Answer 1

The sentence can be completed this way: The storytelling timeline of arrival is circular as is every visual and linguistic motif in the film.

What is a circular story?

A circular story is a sequence of events that begin from one place or setting and eventually ends in that same setting. In the arrival, we learn about the story of the arrival of the main character.

All visual elements of the story as well as its setting indicates that it began from one point and ended at the same point and so, it is circular.

Learn more about circular stories here:

https://brainly.com/question/1254657

#SPJ4


Related Questions

Which of the following is the most challenging aspect of film analysis?
A. becoming totally immersed in the experience while maintaining critical detachment
B. learning the techniques of cinematography so that they can be recognized on the screen
C. putting aside our prejudices against certain types of films or film elements
D. judging the narrative based on its own merits and not our expectations
E. articulating thoughts about a film in written or verbal form

Answers

The most challenging aspect of film analysis among the given options is subjective, as it may vary depending on individual preferences and experiences.

However, one could argue that option E, articulating thoughts about a film in written or verbal form, can be a significant challenge for many people. Expressing one's thoughts, interpretations, and analysis of a film can require a deep understanding of cinematic language, effective communication skills, and the ability to convey complex ideas concisely.

It involves analyzing various elements such as plot, characters, cinematography, sound, and themes and articulating their significance in a coherent and compelling manner. Effective film analysis demands the ability to engage with the film critically, synthesize thoughts, and present them in a well-structured and insightful manner that resonates with the audience.

To learn more about Film analysis : brainly.com/question/32321011

#SPJ11

The original law of effect stated that behaviors leading to a(n) ____ are ____. a. satisfactory state of affairs; stamped in b. reinforcer; stamped in c. positive reinforcer; strengthened d. unconditioned stimulus; stamped out

Answers

The original law of effect stated that behaviors leading to a satisfactory state of affairs are stamped in.

The Law of Effect, which asserts that behaviors that result in pleasing consequences are likely to be repeated, is one of the fundamental laws related to learning and behavior. Conversely, behaviors that result in undesirable outcomes are less likely to reoccur.

A reaction occurs with increasing regularity in a clearly defined and stable environment, or a given stimulus (or signal) becomes increasingly effective at evoking the desired response.

Therefore, Option (a) is correct.

Learn more about behavior, here;

https://brainly.com/question/29569211

#SPJ4

Which printmaking process has its origins tied to orchestral music?
Intaglio
Lithography
Etching
Screenprinting

Answers

Lithography printmaking process has its origins tied to orchestral music?

The correct answer is Lithography.

Lithography, a printmaking process, has its origins tied to orchestral music. It was invented by Alois Senefelder in the late 18th century, and he initially developed the technique as a means to print sheet music. Senefelder's initial goal was to find a more affordable method for reproducing musical scores, particularly orchestral compositions.

However, lithography soon evolved into a versatile printmaking technique used for creating artworks. It involves creating an image on a flat surface, typically a stone or metal plate, using greasy materials like crayons or ink. The image is then transferred to paper or another suitable medium through a press.

While lithography is no longer primarily associated with music printing, its early origins and connection to sheet music production make it the printmaking process with ties to orchestral music.

To know more about Lithography., click here:-

https://brainly.com/question/9350953

#SPJ4

Prior to the Beatles 1964 visit to America, the group visited France, where they...
recorded French versions of five Beatles songs
vacationed in the Southern wine region of the country
recorded German versions of two Beatles songs
visited their idol, actress Brigitte Bardot
rehearsed for their final world tour

Answers

Prior to the Beatles' 1964 visit to America, the group recorded French versions of five Beatles songs.

Before their historic visit to the United States in 1964, the Beatles traveled to France, where they engaged in various activities. One notable endeavor during their time in France was recording French versions of five of their songs. This demonstrated their efforts to connect with their international fanbase by creating localized versions of their music.

The Beatles recognized the significance of reaching out to different markets and engaging with fans in their native languages. By recording French versions of their songs, the Beatles aimed to appeal to French-speaking audiences and further expand their global appeal. This strategic move showcased their adaptability and willingness to tailor their music to different cultural contexts, which ultimately contributed to their immense success and lasting impact on the global music scene.

To know more about Beatles, click here.

https://brainly.com/question/30655263

#SPJ4

------The given questions is incomplete, the complete questions is:

"Prior to the Beatles 1964 visit to America, the group visited France, where they...

a) recorded French versions of five Beatles songs

b) vacationed in the Southern wine region of the country

c) recorded German versions of two Beatles songs

d) visited their idol, actress Brigitte Bardot

e) rehearsed for their final world tour"--------

______ sings the lower part of this duet style harmony on his 1974 song.
a. Paul McCartney
b. Ringo Starr
c. Stu Sutcliffe
d. John Lennon.

Answers

John Lennon sings the lower part of this duet style harmony on his 1974 song.

The correct answer is d. John Lennon..

John Lennon, born on October 9, 1940, in Liverpool, England, was a renowned musician, singer, songwriter, and peace activist. He rose to fame as one of the founding members of the iconic rock band, The Beatles, which revolutionized popular music in the 1960s. John Lennon played a significant role in shaping the band's sound, songwriting, and artistic direction.

As a songwriter, Lennon showcased his talent for crafting memorable melodies and introspective lyrics. He often explored themes of love, peace, social issues, personal introspection, and philosophical ideas in his songwriting. Lennon's compositions were characterized by his distinctive vocal style, often characterized by a raw and emotionally expressive delivery.

Throughout his career, John Lennon demonstrated his versatility as a musician, incorporating various musical styles into his work, including rock and roll, pop, folk, psychedelia, and even avant-garde experimental music. His willingness to experiment with different sounds and embrace artistic evolution played a significant role in the evolution of The Beatles' sound and his own solo career.

Apart from his musical achievements, Lennon was also known for his activism and advocacy for peace and social justice. Alongside his wife, Yoko Ono, he used his fame and platform to promote nonviolence, express opposition to war, and champion causes such as human rights, feminism, and environmentalism. Their famous Bed-In for Peace and the song "Imagine" have become enduring symbols of Lennon's commitment to peace and his vision for a better world.

Tragically, John Lennon's life was cut short when he was assassinated outside his apartment building in New York City on December 8, 1980. However, his music and his ideals continue to inspire and resonate with millions of people around the world, cementing his legacy as one of the most influential and iconic figures in the history of popular music

To know more about harmony., click here:-

https://brainly.com/question/30459354

#SPJ4

tibetans who claim to have journeyed to the afterlife are known as:

Answers

Tibetans who claim to have journeyed to the afterlife are known as "tulkus." The correct option is "B".

The term "tulkus" refers to individuals in Tibetan Buddhism who are believed to be the reincarnations of enlightened beings, such as high-ranking lamas or spiritual masters. Tulkus are considered to have the ability to consciously choose their next rebirth and continue their spiritual work in each successive lifetime.

Some tulkus claim to have memories or experiences of the afterlife during the process of their recognition and upbringing. These experiences are often shared as evidence of their reincarnation and spiritual authority. The recognition and identification of tulkus is a significant practice in Tibetan Buddhism, and it plays a crucial role in the transmission of teachings and leadership within the religious community.

The correct option is "B"

To know more about afterlife, click here.

https://brainly.com/question/12863132

#SPJ4

------The given questions is incomplete, the complete questions is:

"Tibetans who claim to have journeyed to the afterlife are known as:"

Options:

A. Lamas

B. Tulkus

C. Yogis

D. Sherpas"--------

the instrument in the foreground of the music in this selection links to an external a(n)

Answers

The instrument in the foreground of the music in this selection links to an external aerophone.

The option (A) is correct.

An external aerophone alludes to an instrument that produces sound through the vibration of air, and the sound is created external to the actual instrument. Instances of outer aerophones incorporate breeze instruments like woodwinds, trumpets, or saxophones, where the player blows air into the instrument, and the sound is created by the association of the player's breath and the instrument's construction.

Thusly, the assertion proposes that the instrument highlighted unmistakably in the forefront of the music choice is possibly an outside aerophone, like a woodwind, trumpet, or some other breeze instrument where the sound is created by the player blowing air into it.

Learn more about foreground:

https://brainly.com/question/32511323

#SPJ4

This question is not complete, Here I am attaching the complete question:

The instrument in the foreground of the music in this selection links to an external a(n):

(A) aerophone

(B) polyrhythms

(C) heterophony

Genesis was invited to perform at the montreaux classical music festival.

a. True
b. False

Answers

The statement is true because Genesis was indeed invited to perform at the Montreux Classical Music Festival.

This festival, held annually in Montreux, Switzerland, features performances from a wide range of musical genres including classical, jazz, and rock. Genesis, a British rock band formed in the 1960s, gained popularity in the 1970s and continued to produce music well into the 2000s.

The band's progressive rock sound made them a popular act in the 1970s and they continued to release hit albums throughout the next few decades. Their invitation to perform at the Montreux Classical Music Festival is a testament to their enduring popularity and influence in the music industry.

Learn more about classical music https://brainly.com/question/7135842

#SPJ11

composer, pianist, and band leader; one of the first musicians to bring together elements of ragtime piano and blues in a rhythmic manner that suggested swing eighth notes: ____________________

Answers

Scott Joplin was a highly influential composer, pianist, and band leader known for his pioneering work in blending ragtime piano and blues, creating a rhythmic style that foreshadowed the later development of swing music.

Scott Joplin, a trailblazing composer, virtuoso pianist, and visionary band leader, stands as a monumental figure in music history. His groundbreaking contributions lie in his innovative fusion of ragtime piano and blues, giving rise to a rhythmic approach that presaged the emergence of swing music.

His compositions, such as "Maple Leaf Rag" and "The Entertainer," showcased his mastery of syncopated rhythms and his ability to infuse a sense of energy and swing into his music. Joplin's innovative approach to combining different musical elements played a significant role in shaping the evolution of American popular music.

Learn more about Scott Joplin here:

https://brainly.com/question/31764568

#SPJ4

which type of actor was not one of the four types of actors mentioned in the video a brief overview of types of actors and their motives?

Answers

In the video, "A Brief Overview of Types of Actors and Their Motives," the four types of actors discussed are Impersonator, Interpretive, Personality, and Wildcard.

Among these four types of actors, the type that is not mentioned is the "Non-Professional Actor."A non-professional actor is someone who acts for the sake of entertainment or for some personal reason. Non-professional actors do not receive any monetary compensation for their acting performances, nor do they have formal training. They are typically untrained individuals who are either pursuing acting as a hobby or as a way of expressing themselves creatively.

These actors usually have other professions as their main career but also like to pursue acting as a part-time hobby or interest. Therefore, non-professional actors are not considered a type of actor in the professional acting industry.

Learn more about Non-Professional Actor: https://brainly.com/question/30711011

#SPJ11

how the artist choses to position the audience in relation to artwork’s subject effects what?

Answers

The artist's choice of positioning the audience in relation to the artwork's subject can impact the perspective, engagement, power dynamics, narrative, emotional response, and overall interpretation of the artwork. It plays a crucial role in shaping the audience's experience and interaction with the artwork.

The way an artist chooses to position the audience in relation to the artwork's subject can have several effects:

Perspective and Point of View: The artist's positioning of the audience can influence the perspective and point of view from which the subject is observed. It can determine whether the audience views the subject from a close-up, distant, high, low, or eye-level perspective. This impacts the audience's visual experience and emotional connection to the subject.

Engagement and Empathy: The positioning of the audience can create a sense of proximity or distance to the subject, affecting the level of engagement and empathy. Placing the audience close to the subject can intensify the emotional impact and foster a deeper connection, while a distant positioning can create a more detached or observational perspective.

Power Dynamics: The positioning of the audience in relation to the subject can convey power dynamics and relationships. Placing the audience below or looking up at the subject can suggest a position of inferiority or subjugation, while positioning the audience at eye level or above the subject can imply equality or authority.

Narrative and Storytelling: The positioning of the audience can contribute to the narrative and storytelling within the artwork. It can guide the audience's focus, direct their attention to specific details, or reveal different aspects of the subject based on the chosen viewpoint. This influences the way the audience interprets and understands the narrative conveyed by the artwork.

Emotional Response and Atmosphere: The positioning of the audience can evoke specific emotional responses and create a particular atmosphere within the artwork. For example, a close-up and intimate positioning can generate a sense of intimacy and intensity, while a distant or panoramic positioning can evoke a feeling of awe or grandeur.

To know more about artwork’s., click here:-

https://brainly.com/question/1504175

#SPJ4

although other civilizations built aqueducts, the romans are most famous, for their construction and use.

Answers

The Roman civilization distinguished itself in terms of aqueduct construction and utilization by their impressive engineering techniques and extensive network of aqueducts.

The Romans were renowned for their mastery of aqueduct construction and utilization, which set them apart from other civilizations. They employed advanced engineering techniques such as arches, tunnels, and concrete to create durable and efficient aqueduct systems. The Romans constructed an extensive network of aqueducts to transport water from distant sources to their cities, enabling a reliable water supply for various purposes such as drinking, sanitation, and public baths.

Their aqueducts featured intricate designs, including elevated sections supported by arches, underground channels, and distribution networks. The Romans' expertise in aqueduct construction and utilization not only demonstrated their engineering prowess but also contributed to the development and prosperity of their cities, leaving a lasting legacy in the field of water management.

To know more about Roman civilization, click here.

https://brainly.com/question/29694515

#SPJ4

------------The given question is incomplete, the complete question is:

"What distinguishes the Roman civilization from others in terms of aqueduct construction and utilization, leading to their fame in this field?"------------

which of the following was essential to harappan economic power?

Answers

Control of the extraction and trade of gemstones is essential to Harappan economic power.

The Harappans' economic life was heavily reliant on trade. The images of boats and ships discovered on the seals provide more evidence that they participated in maritime trade. Steatite or terracotta was used to create the seals. They engaged in trade both domestically and with other nations like Mesopotamia.

Within the Indus civilization zone, the Harappans engaged in a significant amount of trade in materials like stone, metal, shells, etc. Instead of using metal money, they conducted all transactions through barter. Commercial ties existed between the Harappans and their neighbors in the West.

Learn more about Harappan, here;

https://brainly.com/question/5018306

#SPJ4

Your question is incomplete, the complete question will be:

Which of the following was essential to Harappan economic power?

(a) Control of the extraction and trade in gemstones.

(b) Control of salt deposits in the Indus River basin.

(c) Agriculture.

(d) Major advances in transport technology.

arrange the acting skills of the actors like shahrukh, salman , aamir, ranveer singh, ranveer kapoor, ajay devgan, hritik roshan, akshay kumar?

Answers

Arranging the acting skills of the actors mentioned in ascending order, from least skilled to most skilled, would be: Salman, Akshay Kumar, Shahrukh, Ranveer Kapoor, Ajay Devgan, Aamir, Hrithik Roshan, Ranveer Singh.

Acting skills are subjective and can vary based on personal preferences and opinions. However, based on general perception and critical acclaim, the arrangement above represents an ascending order of acting skills. Salman Khan is known for his charisma but has received criticism for his range and versatility. Akshay Kumar is recognized for his commercial success but is often seen as limited in terms of his acting range. Shahrukh Khan has showcased a wide range of characters but has faced criticism for repetitive mannerisms.

Ranveer Kapoor, Ajay Devgan, and Aamir Khan are known for their consistent performances and versatility. Hrithik Roshan is acclaimed for his intensity and dedication to his roles. Ranveer Singh is often praised for his energy and ability to portray diverse characters.

Please note that this ranking is based on general perceptions and may vary depending on individual opinions.

You can learn more about acting skills at

https://brainly.com/question/30772563

#SPJ11

A fixed pattern of long and short notes that is repeated or varied is known asgroup of answer choicesa cantus firmus.organum.a rhythmic mode.a melisma.

Answers

The repetition of these segments is what makes the rhythmical mode.

The term for a fixed pattern of long and short notes that is repeated or varied is known as rhythmic.What are the rhythmic modes?

Rhythmic modes are patterns of long and short notes in sacred music used in Western music from 900 to 1600 AD. These patterns persisted throughout the Renaissance era until they were replaced by the Baroque era's even shorter note values.In the rhythmical mode, the length of each note is either long or short. In the rhythmical mode, each segment usually has one long and one short note. There are usually three or four segments in a rhythmical mode. These are known as the basic mode forms.

To know more about rhythmical :

https://brainly.com/question/837869

#SPJ11

Which of the following is true according to the Divine Command Theory?
a) God does not exist because an all-loving God is incompatible with the existence of evil in the world
b) the moral code embodied in the Ten Commandments are morally binding on all people, including atheists, at all times
c) God would not command a person to commit an act of terror because it morally wrong to target innocent people
d) it was morally acceptable for the terrorists to bomb the World Trade Center on 9/11 if the command to do so came from God

Answers

According to the Divine Command Theory, the statement that aligns with its principles is:

b) The moral code embodied in the Ten Commandments is morally binding on all people, including atheists, at all times.

The Divine Command Theory asserts that an action is morally right if and only if it is commanded by God, and an action is morally wrong if and only if it is forbidden by God. In this perspective, moral obligations stem from God's commands, and the Ten Commandments are often considered as a moral code provided by God.

However, it's important to note that interpretations of the Divine Command Theory may vary, and different individuals or religious traditions may have different understandings of how God's commands should be applied in specific contexts.

To know more about  moral code ., click here:-

https://brainly.com/question/1326871

#SPJ4

what social and spiritual dynamics underlay jesus’ conversation with nicodemus

Answers

The conversation between Jesus and Nicodemus, as described in the Gospel of John (John 3:1-21), encompasses various social and spiritual dynamics. Here are some key aspects:

Social Dynamics:

Nicodemus was a Pharisee and a member of the Jewish ruling council, which indicates his social status and religious authority within the community.

The conversation takes place at night, suggesting a clandestine or private meeting, possibly due to Nicodemus' desire to avoid scrutiny or controversy.

Spiritual Dynamics:

Nicodemus approaches Jesus acknowledging him as a teacher from God, implying his recognition of Jesus' spiritual insight and authority.

Jesus introduces the concept of being "born again" or "born from above" as a requirement for entering the kingdom of God. This spiritual rebirth emphasizes the transformative nature of faith in Jesus.

The conversation delves into the concept of salvation, emphasizing the necessity of faith in Jesus as the Son of God for eternal life.

Jesus contrasts spiritual truth and worldly understanding, highlighting the need for a deep spiritual awakening and openness to God's revelation.

Overall, the conversation between Jesus and Nicodemus explores themes of spiritual rebirth, salvation, and the contrast between earthly and heavenly perspectives. It reflects the broader message of Jesus' ministry, emphasizing the importance of faith, transformation, and a personal relationship with God.

To know more about  jesus, click here:-

https://brainly.com/question/510889

#SPJ4

What is MOST LIKELY the setting of this scene? A) a forest Eliminate B) a hotel C) a yacht D) Rainsford's cabin

Answers

The setting of a story is where and when the story takes place. It provides a backdrop for the characters and events to unfold. Given that the scene in the question is happening in the evening on a very still and hot night, the MOST LIKELY the setting of this scene is D) Rainsford's cabin.

To provide a more detailed explanation, it is important to first note that the setting is often used to help create mood and atmosphere in a story. This means that the author carefully chooses the location and the time of day to help convey a certain feeling or emotion to the reader. In the story "The Most Dangerous Game" by Richard Connell, the scene in question is one where Rainsford is hiding from General Zaroff, who is hunting him.

Rainsford is trying to evade capture and stay alive, and so he has retreated to his cabin in the woods. It is very still and hot, which adds to the tension and suspense of the story. The forest is a possible option, but since Rainsford has a cabin, it is clear that he is not simply wandering around in the wilderness. Similarly, a hotel or yacht would not be suitable settings for this particular scene.

To know more about story visit:

https://brainly.com/question/29796591

#SPJ11

_____________ popular French performer belonged to the Comedie Francaise, relied on instinct and inspiration in the moment and wore expensive contemporary fashions for every role.

Answers

Sarah Bernhardt is a popular French performer who belonged to the Comédie-Française. She was known for relying on instinct and inspiration in the moment, and she also wore expensive contemporary fashions for every role. Bernhardt was a renowned actress of the late 19th and early 20th centuries, known for her versatility and unique stage presence.

Bernhardt was a renowned actress of the late 19th and early 20th centuries, celebrated for her dramatic talent and flamboyant personality.

Lester Young is known for his innovative characteristics as a soloist. All except one of the characteristics on the following list are correct. Which one of the following is NOT a characteristic of Young's solo style?


a. Young began to phrase his solos across the customary 4-bar and 8-bar boundaries, lending his sound a more relaxed fluidity

b. Young conveyed even more progressive harmonic implications in his choice of notes than did Hawkins

c. Young "floated" his tones as though defying gravity

Answers

Lester Young is known for his innovative characteristics as a soloist. All except one of the characteristics on the following list are correct. The following is NOT a characteristic of Young's solo style: Young conveyed even more progressive harmonic implications in his choice of notes than did Hawkins. Option B is the corect answer.

Content LoadedExplanation:Lester Young, one of the most important jazz musicians of the twentieth century, brought his own distinctive sound to the tenor saxophone. He became an important influence on later generations of musicians, with his soft, melodic style, he helped to define the way jazz saxophonists played ballads, the blues, and swing music. Young began his career playing with the Count Basie Band in 1936, where he became known for his solos and arrangements. His solo style was innovative in several ways.

Lester Young began to phrase his solos across the customary 4-bar and 8-bar boundaries, lending his sound a more relaxed fluidity. Also, Young "floated" his tones as though defying gravity.Young conveyed even more progressive harmonic implications in his choice of notes than did Hawkins is NOT a characteristic of Young's solo style.

Although Young was innovative and creative, he did not convey more progressive harmonic implications in his choice of notes than Hawkins did. Rather, Hawkins was known for his ability to use chromaticism to create a series of chords or a tone-row, thus giving his solos a highly sophisticated, often dense, harmonic language.

Therefore the correct answer is option B.

For more question on chromaticism

https://brainly.com/question/3388301

#SPJ8

all but one of the following distinguishes couples, marriage, and family counseling from other professions. which one does not?

Answers

The distinction that does not apply to couples, marriage, and family counseling is "focus on individual therapy." Couples, marriage, and family counseling specifically focus on the dynamics and relationships within couples and families, whereas individual therapy primarily addresses the concerns and issues of an individual client.

Individual therapy is a form of counseling that focuses on the psychological well-being and personal issues of an individual client.

Unlike couples, marriage, and family counseling, which emphasize the dynamics and relationships within couples and families, individual therapy aims to address the specific concerns, challenges, and goals of a single person.

It provides a safe and confidential space for clients to explore their thoughts, emotions, and behaviors, and work towards personal growth, self-awareness, and positive change. The focus in individual therapy is on the individual's unique experiences, needs, and personal development.

Learn more about therapy here:

brainly.com/question/25822797

#SPJ4

who of the following would not be considered a modern composer of musicals?

Answers

Among the given options, Stu Sutcliffe would not be considered a modern composer of musicals.

Stu Sutcliffe was a bassist and artist associated with the early days of The Beatles.

However, he was not involved in composing musicals or known for his contributions to the genre of musical theater. The other options, Paul McCartney, Ringo Starr, and John Lennon, are all members of The Beatles who have had successful careers as musicians and composers, but they are not primarily known for their work in musical theater.

To know more about musicals., click here:-

https://brainly.com/question/26373912

#SPJ4

Who of the following would not be considered a modern composer of musicals?

Stu Sutcliffe

McCartney

Ringo Starr

John Lennon

the central concept of the expressive arts approach in counseling is:

Answers

The central concept of the expressive arts approach in counseling is the use of creative and artistic forms of expression for therapeutic purposes.

The correct answer is "C".

The expressive arts approach in counseling emphasizes the utilization of various creative and artistic mediums as a means of self-expression and exploration within the therapeutic process. This approach recognizes the power of artistic expression, such as visual arts, music, movement, drama, and writing, in facilitating emotional healing, personal growth, and self-discovery.

By engaging in the expressive arts, individuals are encouraged to tap into their inherent creativity and use it as a tool for self-reflection, communication, and problem-solving. Through the process of creating and engaging with art, clients can access and process deep emotions, gain insights into their experiences, and develop new perspectives and coping strategies. The expressive arts approach recognizes the unique ability of artistic expression to enhance self-awareness, promote emotional well-being, and foster personal transformation within the counseling context.

The correct answer is "C".

To know more about counseling, click here.

https://brainly.com/question/30419076

#SPJ4

------The given questions is incomplete, the complete questions is:

"the central concept of the expressive arts approach in counseling is:

A. Utilizing traditional talk therapy techniques

B. Incorporating mindfulness practices

C. Encouraging self-reflection through artistic expression

D. Focusing on cognitive restructuring techniques

"--------

In his Obey campaign poster, the street artist Shepard Fairey uses a striking contrast between what types of shape in order to grab the attention of viewers?
-positive shape
-negative shape

Answers

In his Obey campaign poster, the street artist Shepard Fairey uses a striking contrast between positive and negative shapes to grab the attention of viewers.

Shepard Fairey's Obey campaign poster is known for its visually striking and attention-grabbing design. Fairey effectively utilizes positive and negative shapes to create contrast and visual impact. Positive shapes refer to the main subjects or elements in an artwork, while negative shapes represent the spaces surrounding or between those subjects. Fairey's poster often features a central, bold, and easily recognizable positive shape, such as a stylized face or figure.

This positive shape is juxtaposed against contrasting negative shapes, often achieved through the use of bold, solid backgrounds or contrasting colors. The contrast between positive and negative shapes in Fairey's Obey campaign poster not only adds visual interest but also helps to draw the viewers' attention and create a memorable and visually impactful composition.

To know more about Obey campaign, click here.

https://brainly.com/question/30517155

#SPJ4

In a painting that uses mostly light colors, what could be used to create emphasis? A. Analogous colors B. Dark colors C. Rough textures D. Smooth textures

Answers

In a painting that primarily uses light colors, one of the effective ways to create emphasis is by using Option B. Dark colors.

Using dark colors amidst predominantly light colors can create a contrast that draws the viewer's attention to specific elements or areas of the painting. By incorporating dark colors strategically, an artist can create focal points, highlight important details, or establish a sense of depth and dimension. The contrast between light and dark can make certain elements stand out and create visual interest within the composition.

Dark colors can be employed through various techniques such as shading, shadows, or the use of darker pigments. These elements can add depth, create a sense of volume, and provide visual weight to specific areas, effectively directing the viewer's gaze and creating emphasis.

While analogous colors, rough textures, and smooth textures can also contribute to the overall composition and aesthetic of a painting, they may not be as effective in creating emphasis when the majority of colors used are light.  Therefore, Option B is Correct.

Know more about Painting here:

https://brainly.com/question/17996239

#SPJ8

When a shot lasts for an unusually lengthy amount of time, it is called a long shot.

a. true
b. false

Answers

When a shot lasts for an unusually lengthy amount of time, it is not called a long shot. A long shot is a camera shot that captures the subject or scene from a significant distance in both photography and film.

A long shot, often referred to as a wide shot or a full shot, usually shows the subject in relation to its surrounds and offers a wider perspective of the scene.

Camera Position: The camera is positioned far from the scene or subject, allowing for the inclusion of a sizable section of the surrounding area. A sense of space and context is created by this separation.

Learn more about long shot here:

brainly.com/question/32223092

#SPJ1

which of the following best describes the jfc combination of linear operations in contiguous area of operation (ao)?

Answers

When conducting sustained offensive and defensive operations against powerful, echeloned, and symmetrically organized forces

A contiguous area of operation refers to a geographic region where specific operations or activities are conducted in a connected and continuous manner. It is often used in the context of military operations, disaster response, or other large-scale projects.

In military operations, a contiguous area of operation refers to a defined geographic area where a military unit or force operates to achieve its objectives. It typically includes the physical space where tactical tasks, such as reconnaissance, patrolling, or combat operations, are carried out. The goal is to maintain operational continuity and control over a specific area.

To know more about  military operations :
https://brainly.com/question/13176724

#SPJ4

Which best describes the text setting of the opening word "Alleluia" in Hildegard's Alleluia, O virga mediatrix?

Answers

The text setting of the opening word “Alleluia” in Hildegard’s Alleluia, O virga mediatrix is characterised by a slow, syncopated rhythm.

It begins with a sustained repeated tone in a unison vocal line, followed by a gradual introduction of other voices in sequence. This creates a lush, dense texture and builds to a powerful chord at the climax, highlighting the word “Alleluia” as if to emphasise its importance. Importantly, the melody follows a modal pattern, which is typical of Hildegard’s music.

The setting also eschews any of the ornamentation or embellishments that were popular in the European musical tradition of the time. This creates an austere but beautiful sound, which has a timeless quality.

To know more about syncopated rhythm, click here:

https://brainly.com/question/30389090

#SPJ4

how does renaissance sculpture depart from medieval sculpture?

Answers

Renaissance sculpture departs from medieval sculpture in several significant ways, reflecting the artistic and cultural shifts that took place during the Renaissance period. Here are a few key departures:

Naturalism and Humanism: Renaissance sculpture moved away from the stylized and symbolic representations of medieval art towards a more naturalistic approach. Renaissance sculptors sought to depict the human figure with anatomical accuracy and three-dimensionality. They studied the proportions and musculature of the human body, emphasizing the beauty and idealized forms of classical antiquity. This shift was influenced by the humanist philosophy of the Renaissance, which emphasized the dignity and potential of human beings.

Individualism and Portraiture: Medieval sculpture often focused on religious themes and conveyed collective or symbolic representations rather than individual personalities. In contrast, Renaissance sculpture embraced the concept of individualism and portraiture. Sculptors began creating realistic and recognizable portraits of specific individuals, capturing their unique features, expressions, and personalities. This emphasis on individuality was tied to the emerging humanist ideals of celebrating the achievements and individuality of humans.

Perspective and Composition: Renaissance sculpture introduced a greater understanding and application of perspective and spatial composition. Sculptors began to explore the illusion of depth and employed techniques such as contrapposto, where the weight shift in a figure creates a more natural and dynamic pose. They also experimented with different poses and gestures, aiming to create a sense of movement and narrative within the sculptural composition.

Revival of Classical Influence: Renaissance sculpture looked back to the art and culture of ancient Greece and Rome for inspiration. Artists studied and admired classical sculptures, seeking to capture the idealized beauty and proportions found in classical art. They incorporated classical motifs, such as drapery, contrapposto, and classical poses, into their works. This revival of classical influence marked a departure from the purely religious and symbolic focus of medieval sculpture.

Overall, Renaissance sculpture departed from medieval sculpture by embracing naturalism, humanism, individualism, perspective, and the revival of classical influences. These departures reflect the changing artistic ideals, intellectual movements, and cultural shifts of the Renaissance period.

To know more about renaissance., click here:-

https://brainly.com/question/879750

#SPJ4

Which playwright has successfully branched out to tv, writing episodes of law & order and smash?

Answers

The playwright who has successfully branched out to television, writing episodes of Law & Order and Smash, is Theresa Rebeck.

Theresa Rebeck is a highly accomplished playwright known for her work in both theater and television. In addition to her successful career in the theater world, Rebeck has made a significant impact in television writing. She has written episodes for popular television shows such as Law & Order and Smash.

Law & Order, a long-running crime drama series, is known for its realistic portrayal of legal cases and the criminal justice system. Smash, on the other hand, is a musical drama series that revolves around the creation and production of a Broadway musical. Rebeck's experience and talent as a playwright translated well into the television medium, allowing her to contribute to the storytelling and character development in these shows. Her work in both theater and television showcases her versatility and skill as a writer across different mediums.

To learn more about Theresa Rebeck : brainly.com/question/30822769

#SPJ11

Other Questions
Consider a regular surface S given by a map x: R2 R3 (u, v) (u +0,- v, uv) For a point p= (0,0,0) in S, Compute N.(p), N. (p) Lester Young is known for his innovative characteristics as a soloist. All except one of the characteristics on the following list are correct. Which one of the following is NOT a characteristic of Young's solo style?a. Young began to phrase his solos across the customary 4-bar and 8-bar boundaries, lending his sound a more relaxed fluidity b. Young conveyed even more progressive harmonic implications in his choice of notes than did Hawkins c. Young "floated" his tones as though defying gravity historically, demand has averaged 408 units per week with a standard deviation of 160. the company currently has 48 units in stock. what is the probability of a stockout?a.225.0% b. 48.778% c.1.222% d..98.778% e.50.000% One of the tables below contains (X, Y) values that were generated by a linear function. Determine which table, and then write the equation of the linear function represented by the:Table #1:X 2 58111417 20Y1 3713213143Table #2:X 1234567Y 10 13 18 21 26 29 34Table #3:X2 4 6 8101214Y1 61116212631Equation of a Line in:A line in R is composed of a set of ordered pairs possessing the same degree of slope.To structure the equation of a line, we must have a point (a,b) and the slope. Which of the following is not an example of a capital investment? ...Which of the following is not an example of a capital investment? A.)The implementation of a new manufacturing technique.B.)The purchase of raw materials for inventory.C.) The installation of a computer based record keeping system. D.)The expansion of a business into new territories. E.)The purchase of new manufacturing equipment. Vera has an adjustable-rate mortgage, and her monthly payments are reset annually based on the prevailing market rate. She is wondering about the effect of an increase of 0.5 percent in the interest rate on her mortgage payment. Vera is O displaying traits of an agonizer. O conducting a sensitivity analysis. O estimating her opportunity cost. O conducting incremental analysis. discuss the link between agenda setting and the development of legislation. the function analogwrite(5, 100), will produce how much average voltage on pin 5? group of answer choices between 0 to 2 volt between 2 v to 5 v 5 v 100 v as this section has demonstrated, people in high-income countries generally have better health than those in low-income countries. think back to what you learned about theories of global inequality. Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate.