Given m || n, find the value of x and y.
X =
(7x+18)º
y =
Do
(9x-14)°
m

Given M || N, Find The Value Of X And Y.X =(7x+18)y =Do(9x-14)m

Answers

Answer 1

Answer:

x = 16y = 130

Step-by-step explanation:

You want the values of x and y when corresponding angles at parallel lines are marked (9x -14)° and (7x +18)°, and a vertical angle to those is marked.

Corresponding angles

Corresponding angles where a transversal crosses parallel lines are congruent:

  (9x -14)° = (7x +18)°

  2x = 32 . . . . . . . . . . divide by °, add 14-7x

  x = 16

Then these angles are ...

  (9(16) -14)° = (144 -14)° = 130°

Vertical angles

Vertical angles are congruent, so ...

  y° = 130°

  y = 130


Related Questions

can someone help with this thank you so much .

Answers

Answer:

15

Step-by-step explanation:

Help please!!!!!!!! I’m confused

Answers

Answer:

y = 0

Step-by-step explanation:

x + 2y = 2 ( subtract 2y from both sides )

x = 2 - 2y → (1)

x = - 4y + 2 → (2)

substitute x = 2 - 2y into (2)

2 - 2y = - 4y + 2 ( add 4y to both sides )

2 + 2y = 2 ( subtract 2 from both sides )

2y = 0 , then

y = 0

A farm currently has 10 large male cattle. The farmer adds a pregnant rabbit to increase the livestock population. The novice farmer estimates that her rabbit population will double in size every month. Including the 10 cattle, how many animals will the farmer have after 7 months?

Answers

The number of animals will the farmer have after 7 months including the 10 cattle are 1280.

Explain the term rate of population growth?The country, territorial, or territorial area's average yearly rate of change in population size over a certain time period. It expresses the proportion, usually multiplied by 100, between the annual growth in population size and indeed the overall population for that year.

For the stated question-

There are ten huge male cattle on a farm right now. In order to boost the number of animals, the farmer brings in a pregnant rabbit. The inexperienced farmer expects her rabbit population to double each month.

Thus, number of animals after years;

= 10 x  2⁷

= 1280

Thus, number of animals will the farmer have after 7 months including the 10 cattle are 1280.

To know more about the rate of population growth,here

https://brainly.com/question/27779235

#SPJ4

What’s the value of x?

Answers

For the given similar triangle the value of x will be 9 inches.

What is the similarity law for triangles?

It is defined as the law to prove that two triangles have the same shape, but it is not compulsory to have the same size. The ratio of the corresponding sides is in the same proportions and the corresponding angles are congruent.

Since the two triangles are similar,

Suppose the unknown side is x,

Since the ratio of the sides of the similar triangles is equal the obtained expression is,

8/6=12/x

x=12×6 / 8

x=9 inches

Thus, for the given similar triangle the value of x will be 9 inches.

Learn more about the similarity of triangles here:

brainly.com/question/8045819

#SPJ1

Use the coordinates J(7, 8), K(1, 2) and L(5, 2) for AJKL.
The orthocenter for AJKL is at point N. What is KN rounded to the nearest tenth?

Answers

The KN is 21.4 rounded to the nearest tenth.

What is an orthocenter?

The orthocenter of a triangle is the place where the perpendicular drawn from the vertices to the opposing sides of the triangle intersect each other. The orthocenter for a triangle with an acute angle is located within the triangle. The orthocenter for a triangle with an acute angle is outside the triangle.

Now we need to find the slope of JL.

From that we have to find the slope of the perpendicular line through B.

Slope of JL=  (y₂ - y₁) / (x₂ - x₁)

J (7, 8) and L (5, 2)

here x₁=  7,y₁  = 8, x₂ = 5 and y₂ = 2

=  -6 / -2

= 3

Slope of the altitude KM  =  -1/ slope of JL = -1/3

Equation of the altitude KM : (y - y₁)  =  m (x -x₁)

Here K(1,2);

(y - 2)  =  -1/3 (x -1)

(y - 2)  =  -x/3 +1/3

Now we need to find the slope of JK.

From that we have to find the slope of the perpendicular line through D.

Slope of KL=  (y₂ - y₁) / (x₂ - x₁)

J(7,8) and K(1,2)

here x₁=  7,y₁  = 8, x₂ = 1 and y₂ = 2

 = 1

Slope of the altitude JO  =  -1/ slope of JL

                                         = -1

Equation of the altitude JO : (y - y₁)  =  m (x -x₁):

 (y - 8)  =  -1 (x - 7)

Solving the equation, x = 21 and y = -6

So the orthocenter N is (21 , -6)

Now the distance of KN is = √(21 - 1)² + (-6 -2)²

                                             =√464

                                             = 21.5

Therefore, the KN is 21.5 rounded to the nearest tenth.

To learn more about the Orthocenter;

https://brainly.com/question/29576583

#SPJ1

Answer:6.3

Step-by-step explanation:

I got it correct on my test

Will give brainliest to the correct answer!:)

What is the value of the logarithm?
In(81)
Round the answer to the nearest ten thousandth.

Answers

Answer: log81 = 1/4

Step-by-step explanation:

Log81^3

81^x = 3

The common base is 3, so

(3^4)^x=3

3^4x = 3^1

4x = 1

x= 1/4

5x + 3y = 6
- 5x - 3y = -6

Elimination method step by step

Answers

Answer:

x = 0 and y = 2

Step-by-step explanation:

5x + 3y = 6

-5x - 3y = -6

Adding the equations gives 0 = 0, so the equations are equivalent.

x = 0 and y = 2

m% of n is what percent of p?

Answers

can you send a picture of the question?

-4/5x = -4 show work and answer pls and I'll give brainliest please hurry


new answer
m +4 13/

new answer
3/5=5/2x

Answers

the answer:

x = 5

hope this helps!

answer the question linked

Answers

The answer would be yes.
If we distribute the X in Tony’s equation, it would be the same as Mai’s.

Find each measure.
H
5. m/KML
a. 50
b. 90
c. 40
d. 60

Answers

Based on the definition of an equilateral triangle, the measure of angle KML is: d 60.

What are the Angle Measures of the Angles of an Equilateral Triangle?

An equilateral triangle can be described as a triangle that has three sides that are equal and also equal interior angles that measures 60 degrees each.

The image shows that the three sides of triangle KML are marked equally by three strokes. This shows that the three sides of triangle KML are congruent to each other. Since they are congruent, they have equal length.

Therefore, triangle KML is an equilateral triangle that has interior angles that measures 60 degrees.

Angle KML is an interior angle of the equilateral triangle, therefore:

The measure of angle KML is: d. 60 degrees.

Learn more about the equilateral triangle on:

https://brainly.com/question/15294703

#SPJ1

Candice is trying to drink more water, so she has been keeping a log of how much water she drinks. Two days ago, Candice drank 32 ounces of water, in comparison to 16 ounces yesterday. What was the percent of decrease in Candice's daily water consumption?

Answers

Answer:

I think it's 0.5%

Step-by-step explanation:

16/32 x 100% = 0.5%

50% I think because 16 oz is half of 32 oz

El punto A está en (-6,5) y el punto B. en (3,-7).

Answers

Entonces, la distancia entre los puntos A y B es de aproximadamente 15.

¿Cuál es la distancia entre los puntos?

Generalmente, Para encontrar la distancia entre los puntos A y B, puedes utilizar la fórmula de la distancia euclidiana:

d = √((x₂ - x₁)² + (y₂ - y₁)²)

En este caso, la distancia sería:

d = √((3 - (-6))² + (-7 - 5)²)

The square root of ((3 - (-6))² + (-7 - 5)²) is equal to:

=√((3 - (-6))² + (-7 - 5)²)

= √((9)² + (-7 - 5)²)

= √(81 + 144)

= √225

d ≈15

Leer más sobre distancia

https://brainly.com/question/22595243

#SPJ1

Encontró la pregunta completa

El punto A está en (-6,5) y el punto B está en (3,-7). ¿Cuál es la distancia entre los puntos

tim buys a torch and a battery. the torch costs 11 times as much as the battery. tim pays with a £10 note and gets £4.84 change how much does the battery cost?

Answers

Answer:

43 p

Step-by-step explanation:

total cost = 10 - 4.84 = 10.00 - 4.84 = £5.16

b + t = 5.16

t = 11b


b + 11b = 5.16

12b = 5.16

12 / 12 b = 5.16/12

b = £0.43

classifying polynomials -8y

Answers

As the given polynomial -8y has only 1 term in is and hence it is classified as a monomial.

What are polynomials?

A polynomial is a mathematical statement made up of coefficients and indeterminates that uses only the operations addition, subtraction, multiplication, and powers of positive integers of the variables.

x² 4x + 7 is an illustration of a polynomial with a single indeterminate x.

The quantity of terms allows for the classification (naming) of polynomials.

A polynomial may contain exponents, constants, and variables, but it never divides by a variable.

They may also contain one or more terms, but not an infinite quantity.

The degree can also be used to categorize polynomials (the largest exponent of the variable).

An expression with only one term is called a monomial.

The sole term in an expression needs to be non-zero in order for it to be a monomial.

Therefore, as the given polynomial -8y has only 1 term in is and hence it is classified as a monomial.

Know more about polynomials here:

https://brainly.com/question/2833285

#SPJ1

Vince had 10 weeks to get in shape for a race. The line graph shows how many miles he ran per training session each week.

Answers

Answer:

13

Step-by-step explanation:

You take the number of miles from weeks 5-8 and add them up. 2+3+4+4=13

Step 1: we know that angle t s r is-congruent-to angle q r s because all right angles are congruent. step 2: we know that angle t is-congruent-to angle q because it is given. step 3: we know that line segment s r is-congruent-to line segment r s because of the reflexive property. step 4: triangle t s r is-congruent-to triangle q r s because of the asa congruence theorem. of the aas congruence theorem. of the third angle theorem. all right triangles are congruent.

Answers

With the help of congruency of triangles rules, we know that TSR ≅ QRS because of (B) the AAS congruence theorem.

What is the congruency of triangles?

Two triangles are said to be congruent if all three corresponding sides and all three corresponding angles have the same size.

These triangles can be moved, turned, flipped, and rotated to produce the same appearance.

When moved, they are parallel to one another.

So, we have two sets of angles and one common side.

Review the congruence situations.

SSS ⇒ Three sides in the first, three sides in the second.

SAS: two sides, including the angle of the first side.

Incorporating angle in the second.

2 angles and the side that joins them in the first, according to ASA

Two angles and the side that connects the two angles.

AAS = 2 angles in the first triangle, plus 1 side.

Second, and one side in △.

Let's read the statements again and fill in the blanks.

Step 1: Since all right angles are congruent, mTSR = mQRS = 90°.

Step 2: Since it is given, mT = mQ

Step 3: Due to the reflexive property, SR becomes RS (common side)

Step 4: Because of the AAS congruence theorem, TSR and QRS are required.

Therefore, with the help of congruency of triangles rules, we know that TSR ≅ QRS because of (B) the AAS congruence theorem.

Know more about the congruency of triangles here:

https://brainly.com/question/29003974

#SPJ4

The correct form of a question:
Given: TSR and QRS are right angles; T ≅ Q

Prove: TSR ≅ QRS

Step 1: We know that TSR ≅ QRS because all right angles are congruent.

Step 2: We know that T ≅ Q because it is given.

Step 3: We know that SR ≅ RS is because of the reflexive property.

Step 4: TSR ≅ QRS because __________

a. of the ASA congruence theorem

b. of the AAS congruence theorem

c. of the third angel theorem

d. all right triangles are congruent

PLSSSS helpp with these

1. Let f(x)=2x+7 and g(x)=3x^2+2
Find f(g(3))
590
65
5
29

2. Let f(x)=4x and g(x)=(x−2)^2
Find g(f(x))
16x^2-16x+4
16x^2-4
16x^2-12x-4
16x+4

3.Let f(x)=2x+1 and g(x)=−7x+1
Find g(f(2))
-26
20
-34
-35

Answers

Answer:

1. D 2. C 3. C

Step-by-step explanation:

On my test

you tossed a coin 100 times and get only 27 heads. do you have a reason to expect that the coin is unfair? explain g

Answers

Therefore, coin is unfair ,It is true that the coin can be considered unfair.

What is probability ?

Calculating or estimating how likely or "possible" something is to occur is the subject of probability. Words like "certain," "impossible," or "probable" can be used to express the likelihood of an event occurring. Probabilities in mathematics are always expressed as fractions, decimals, or percent with values ranging from 0 to 1.

Here,

Step 1: We see that a coin is tossed 100 times, but we only receive heads 27 times.

In other words, the odds of a head are 27/100 or 0.27.

It is thought that there will be an equal number of heads and tails on a fair coin (or very close, if not equal).

So, using a fair coin:

P(H)=P(T)=0.5

Step 2

But in this instance, P(H)=0.27, which is a long way from 0.5.

Therefore, coin is unfair.

It is true that the coin can be considered unfair.

To know more about probability , visit

https://brainly.com/question/11234923

#SPJ4

A large university accepts 70% of the students who apply. Of the students the university accepts, 50% actually enroll. If 10,000 students apply, how many actually enroll?

Answers

For this we have to calculate 50% of 7,000 which is 3,500

What does a math percent mean?

In essence, percentages are fractions with a 100 as the denominator. We place the percent symbol (%) next to the number to indicate that the number is a percentage. For instance, you would have received a 75% grade if you answered 75 out of 100 questions correctly on a test (75/100).

What is the formula for percentage?

By dividing the value by the entire value and multiplying the result by 100, one may determine the percentage. The percentage calculation formula is (value/total value)100%.

first we have to calculate 70% of 10,000 which is 7,000

Then now we have to calculate 50% of 7,000 which is 3,500

Learn more about percentage

https://brainly.com/question/24877689

#SPJ1

A. y = 11x
B. y = 55x
C. y equals one eleventh times x
D. y equals 1 over 55 times x

Answers

Answer:

A. [tex]y=11x[/tex]

Step-by-step explanation:

The graph is linear, meaning it follows the formula [tex]y=mx+b[/tex], where y and x are variables, m is the constant rate that the graph increases by, and b is the y-intercept. The graph is increasing at a rate of 55 calories burned per 5 minutes spent skateboarding, which simplifies to 11 calories per 1 minute, so m is 11. The graph's y-intercept is 0 because it runs through the origin, and there's no point in writing "11x + 0" so it's just "y = 11x"

ok so i did this twice but got wrong answer need help with this one rq

Answers

By solving an inequality, we will see that option a is cheaper for more than 60 miles.

For what number of miles is option A better?

We know that option A charges $25 per day plus $0.15 per mile, so the cost for x miles is given by the linear equation:

A(x) = $25 + $0.15*x

While for option B the fixed cost is $10 and the cost per mile is $0.40, so the cost equation is:

B(x) = $10 + $0.40*x

The cost of option a will be smaller when:

$25 + $0.15*x < $10 + $0.40*x

$25 - $10 < $0.40*x - $0.15*x

$15 < $0.25*x

$15/$0.25 < x

60 < x

So for 60 miles the cost is the same, for x > 60 miles the cost of option a will be smaller (because the slope is smaller).

Learn more about linear equations:

https://brainly.com/question/1884491

#SPJ1

I need help i guess?

Answers

The letters of the points that satisfy the inequalities are  points A, D, E, I

How to solve an inequality?

An inequality is a relation which makes a non-equal comparison between two numbers or other mathematical expressions.

The given parameters are:

y<-[tex]\frac{1}{2}x +2[/tex]   and

2x+y≤8

If we plot the graphs of the first inequality,

we notice that the coordinates of the origin are (0,0) then we have

Rearrange the inequality

[tex]y > -\frac{1}{2} x=2[/tex]

At origin y=0, x=0

[tex]0+\frac{1}{2}(0) > 2[/tex]

⇒ 0+0<2                (false)

Therefore the origin is not included

In the second inequality

2x+y≤8

Coordinates of the origin are (0,0)

2(0)+(0)≤8

0+0≤8             (False)

Therefore the origin is not included.

In conclusion the points that satisfy the inequalities are points A,D,E,I

Learn more about inequalities on https://brainly.com/question/28823603

#SPJ1

Which is an equation of the line through the origin and (-5, 6)?

Answers

The equation of line through the origin and (-5, 6 ) is y = [tex]-\frac{6}{5}x[/tex]

What is slope?

The slope of a line is the ratio of the amount that y increases as x increases some amount. Slope tells you how steep a line is, or how much y increases as x increases. The slope is constant (the same) anywhere on the line.

the coordinates of the origin is (0, 0) and h other coordinates are (-5, 6)

at x = 0 and y = 0

using the equation of straight line y = mx + c

0 = 0(m) + c

so c = 0

at x = -5, y = 6

6 = -5m +c

but c = 0

6 = -5m

m = -6/5

Equation of line becomes y = -6/5x

Learn more about slope: https://brainly.com/question/3493733

#SPJ1

3(4x+2)=(?)x+( )
Enter the number that goes in the green box

Answers

12x+6
3*4x = 12x 3*2= 6

4.
La abuelita de Pedro quiere hacer tamales para esta navidad.
Ella sabe que para la fiesta de Lupita gastó $170 y pudo hacer 30
tamales de dulce y 20 de rajas. En la fiesta de José gastó $420 para
hacer 40 de dulce y 60 de carne y en otra ocasión con $230 le ajustó
para 20 de rajas y 30 de carne. ¿Cuánto dinero ocupa para hacer 40
tamales de cada uno?

Answers

Answer:

Step-by-step explanation:

o.67891

a population mean is 13. the sample mean is 12.8, and the sample standard deviation is two. the sample size is 20. what distribution should you use to perform a hypothesis test? assume the underlying population is normal.

Answers

To perform a hypothesis test we use students' t distribution.

What is a hypothesis test?

A statistical hypothesis test is a technique for determining if the available data are sufficient to support a specific hypothesis. We can make probabilistic claims regarding population parameters thanks to hypothesis testing.

Here, we have

Given, the population mean is 13. the sample mean is 12.8, and the sample standard deviation is two. the sample size is 20.

We have to find distribution to perform a hypothesis test.

The students t distribution is used when

1- sample size less than 30. Here 20.

2-population standard deviation not given.

3-population is normal.

Hence, we concluded that to perform a hypothesis test we use students' t distribution.

To learn more about the hypothesis test from the given link

https://brainly.com/question/15980493

#SPJ1

What is the slope of the line through (-9,6)(−9,6)left parenthesis, minus, 9, comma, 6, right parenthesis and (-3,9)(−3,9)left parenthesis, minus, 3, comma, 9, right parenthesis?

Answers

The slope of the line passing through the points  (-9, 6) and (-3, 9) is (1/2).

What is slope?

The slope is the rate of change of the y-axis with respect to the x-axis.

The equation of a line in slope-intercept form is

y = mx + b, where

slope = m and y-intercept = b.

We know the greater the absolute value of a slope is the more steeper is it's graph or rate of change is large.

We know slope(m) = (y₂ - y₁)/(x₂ - x₁).

Given, A line passes through the points (-9, 6) and (-3, 9).

∴ Slope(m) of the line is = (9 - 6)/(- 3 + 9) = 3/6 = 1/2.

learn more about slopes here :

https://brainly.com/question/3605446

#SPJ1

Determine the equation of the ellipse with foci (-6,-1) and (-6,-7), and co-vertices (-2,-4) and (-10,-4)

Answers

The equation of ellipse with foci (-6,-1) and (-6,-7), and co-vertices (-2,-4) and (-10,-4) is [tex]\frac{(x+6)^2}{25}+\frac{(y+4)^2}{16}=1[/tex]

What is equation of an ellipse?

The standard equation of an ellipse centered at (h, k) with a major axis parallel to the x-axis is given by:

[tex]\frac{(x-h)^2}{a^2}+\frac{(y-k)^2}{b^2}=1[/tex]

where the coordinates of the vertex are (h±a, 0), coordinates of co-vertex are (h, k ± b) and the coordinates of foci are (h±c, k), where a² = c² + b².

According to the given question:

Given foci of the ellipse :

(-6, -1) and (-6, -7)

Co-vertices of the ellipse :

(-2, -4) and (-10, -4)

From the given foci and vertices ,

c = -1 - (-7) /2 = 3

b = -2 - (-10) /2 = 4

c² = a² + b²

∴ a² = 3 x 3 + 4 x 4 = 25

( h, k) = (-6 - 6 /2 , -1 - 7 / 2) = (-6, -4)

Equation of the ellipse is given by:

(x - h)²/ a² + (y - k)²/b² =1

(x - (-6))²/ 25 + (y - (-4))²/16 = 1

[tex]\frac{(x+6)^2}{25}+\frac{(y+4)^2}{16}=1[/tex]

To know more about equation of ellipse visit

https://brainly.com/question/29655222

#SPJ1

Given the figure below, find the values of x and z.
(10x + 55)
N
O
(5x + 50)

Answers

1. 5(2x + 11)

Common factor
Other Questions
sonata form consists of three main sections, exposition, development, andquestion 10 options:introductionrecapitulationmotivestransition a nurse teaches an adolescent client with asthma to independently administer breathing treatments. which principle should the nurse keep in mind when planning the teaching session? 1. compute total variable cost per unit. 2. compute total fixed costs. 3. prepare a flexible budget at activity levels of 12,000 units and 16,000 units. Can anyone help me out. Really need this turned in Solve x for this diagram why did the framers of the constitution put the principles of checks and balances and separation of powers in the constitution? can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT HELPPP PLEASE ASPPP!!!!!! Examine the graph below. Calculate the slope. Find the absolute extrema if they exist, as well as all values of x where they occur, for the function f(x)=(x-64)^{1/11} on the domain [-8,9]Select the correct choice below and, if necessary, fill in the answer boxes to complete your choice.A. The absolute maximum is , which occurs at x= (Round the absolute maximum to two decimal places as needed. Type an exact answer for the value of x where the maximum occurs. Use a comma to separate answers as needed.)B. There is no absolute maximum.