An example of how a damaged ecosystem will begin the restoration process is:
some species of pine trees only release their seeds following the extreme heat of a forest fire; option D
What is the process of regrowth in an ecosystem?The process of regrowth or restoration in an ecosystem is the process by which the ecosystem recovers when a drastic change occurs in the ecosystem that alters the equilibrium in the ecosystem.
Such changes could be caused by factors such as flooding, fires, volcanoes, and human activities.
The process of regrowth starts with primary producers first colonizing the disturbed ecosystem before other organisms then start habiting the ecosystem.
Learn more about regrowth in an ecosystem at: https://brainly.com/question/27857725
#SPJ1
Complete question:
Flooding, fires, volcanoes, and human changes can all damage ecosystems. The process of regrowth in an ecosystem tends to restore a state of equilibrium. Which is an example of how a damaged ecosystem will begin the restoration process?
A Seasonal turnover in a lake replenishes oxygen to deep water and cleanses waste products from the lake.
B Rain forest species can spread their seeds over a wide area to begin growing in new regions.
C Mining companies plant trees and add wildlife to restore an area after a mining operation.
D Some species of pine trees only release their seeds following the extreme heat of a forest fire.
Which systems work together so oxygen can be
distributed to the cells of your body? How do these two
systems work together to accomplish this task?
Circulatory system and respiratory system work together so oxygen can be distributed to the cells of your body.
The circulatory and respiratory systems collaborate to move blood and oxygen around the body. The trachea, bronchi, and bronchioles transport air into and out of the lungs. The pulmonary arteries and veins connect to the heart and transport blood into and out of the lungs.
To obtain oxygen, blood travels from the heart to the lungs. The respiratory system includes the lungs. The exchange of gases between tissues and blood is a critical function of the circulatory system. Blood absorbs oxygen and emits carbon dioxide in the lungs of humans, other mammals, and birds. Thus, the circulatory and respiratory systems work in tandem to obtain oxygen and expel carbon dioxide.
To learn more about Circulatory system and respiratory system, here
https://brainly.com/question/3305440
#SPJ1
31. Use the diagram to answer the question below.
What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w
(1 point)
30/100
Earth's albedo
30% reflected
and scattered
Earth's surface
Atmosphere
Clouds
Incoming
solar radiation
100 units
Drect
and
diffuse
51 absorbed at surface
Top of atmosphere
19 absorbed
by atmosphere
and clouds
O More solar radiation would be absorbed at the surface
O More solar radiation would be reflected and scattered
O More solar radiation would be absorbed by the clouds
O More solar radiation would reach Earth's atmosphere
More solar radiation would be reflected and scattered and More solar radiation would be absorbed by the clouds to the solar energy that reaches Earth's atmosphere.
A variety of methods, including solar power to produce electricity, solar thermal energy (including solar water heating), and solar architecture, are used to capture the radiant light and heat from the Sun.
It is a crucial source of renewable energy, and depending on how solar energy is captured, distributed, or transformed into solar power, its technologies can be roughly categorised as either passive solar or active solar.
Utilizing concentrated solar power, photovoltaic systems, and solar water heating are examples of active solar approaches. Passive solar strategies include aligning a structure with the Sun, choosing components with favourable thermal mass or light-dispersing qualities, and creating air-circulated areas.
To know more about Solar radiation visit:
https://brainly.com/question/12509139
#SPJ1
The evidence that stimulated Newton to propose the law of universal gravitation emerged from a study of
a. the motion of the moon and other celestial or heavenly bodies
b. the fall of an apple to the Earth
c. the gravitational interaction of smaller objects upon the Earth
d. ...nonsense! There was no evidence; it was just proposed as a theory.
Explanation:
b. the fall of an apple to the Earth
Vhich of the following demonstrates the central dogma of molecular biologists? (1 point) O Gene expression relies on environmental factors that determine which traits are dominant. O DNA and RNA hold the code to create proteins that are the key to gene expression. O DNA and RNA mutate into either harmful or helpful effects on the human body. O Proteins replicate DNA which gives the expression of traits to an organism.
The following demonstrates the critical dogma of molecular biologists option B DNA and RNA maintain the code to create proteins that are the important thing to gene expression.
Option B alternative B DNA and RNA maintain the code to create proteins which are important things to gene expression.
The primary dogma of molecular biology is “DNA makes RNA makes protein.” This general rule emphasizes the order of activities from transcription thru translation and gives the premise for tons of genetic code research within the post-double helix 1950s.
The crucial dogma of molecular biology states that DNA contains instructions for creating a protein, which might be copied with the aid of RNA. RNA then makes use of the instructions to make a protein. In quick DNA → RNA → Protein, or DNA to RNA to Protein.
Learn more about molecular biology here
https://brainly.com/question/26044300
#SPJ4
DNA and RNA hold the code to create proteins that are the key to gene expression demonstrates the central dogma of molecular biologists.
The basic idea of molecular biology describes how genetic material goes from DNA to RNA to create a protein, which is an important final result. The central dogma is that RNA acts as a messenger, carrying information from the DNA to the ribosomes, where it is utilised to make all of our proteins.
Ribosomes serve as factories in the cell where information is "transformed" from a code into a useful part. The process by which the DNA instructions are converted into a usable product is known as gene expression. The two critical stages of gene expression are transcription and translation. Every cell's DNA includes information that, during transcription, is converted into succinct, transportable RNA messages.
To know more about central dogma visit : https://brainly.com/question/16580285
#SPJ9
You wish to investigate how exercise affects the rate of cellular respiration. You decide to squeeze a ball for 5 minutes and around 3 minutes you begin to experience a burning sensation and fatigue. This means your muscles are beginning to run out of oxygen. What process is causing the burning in your muscles?
You wish to investigate how exercise affects the rate of cellular respiration. You decide to squeeze a ball for 5 minutes and around 3 minutes you begin to experience a burning sensation and fatigue. This means your muscles are beginning to run out of oxygen. What process is causing the burning in your muscles?
Electron transport chain
Alcoholic fermentation
Lactic acid fermentation
Krebs cycle
During muscle contraction, if feeling fatigued it means that muscles do not get in the required oxygen to generate ATP causing lactic acid fermentation, hence option c is correct.
What is Lactic acid fermentation?A metabolic process called lactic acid fermentation turns six-carbon sugars like glucose or other six-carbon sugar disaccharides like sucrose or lactose into the metabolite lactate.
It generates carbon dioxide as well as lactic and acetic acids, which swiftly reduce pH levels and prevent the growth of bacteria that may otherwise ruin crispness.
Therefore due to anaerobic conditions muscle gate fatigue creates lactic acid fermentation, hence option c is correct.
Learn more about fermentation, here:
https://brainly.com/question/29404976
#SPJ1
Which are examples of
infections caused by
protists?
A. Strep throat, botulism, and anthrax
B. common cold, flu, and chicken pox
C. Malaria, African Sleeping sickness,
and intestinal disease this
D. Trichinosis, hook worm, and
elephantiasis
Answer:
c) Malaria, African Sleeping sickness, and intestinal diseases.
Explanation:
Malaria, African Sleeping sickness, and intestinal diseases are the examples of infections caused by protists. Therefore, the option (c) is the correct answer.
Primary succession involves the _____ establishment of communities of different species in mostly lifeless areas.
A. rapid
B. gradual
C. orderly
Primary succession involves the gradual establishment of communities of different species in mostly lifeless areas.
The correct answer choice from above is option b.
What is meant by primary succession?Primary succession can simply be defined as that association of living things whereby these organisms are the first that first colonizes a barren habitat. In order words, it simply refers to the ecological association of plants and animals such that they are are ones that inhabit the region first.
In conclusion, we can now confirm from the explanation above that this primary succession is a succession which starts from scratch.
Read more primary succession:
https://brainly.com/question/678251
#SPJ1
In the science field we use the metric units, this is due to
A. Metric units are universally accepted.
B. Metric is a universal scientific language.
C. Both
In the science field we use the metric units because of both the given reasons i.e. A. Metric units are universally accepted. B. Metric is a universal scientific language.
What is a metric unit system?The decimalized system based on the meter that had been adopted in France in the 1790s was replaced by the metric system, which is a system of measurement.
What do you mean by universal?Including or covering all or a whole collectively or distributively without limit or exception.
Why we use Metric System ?A standardized approach that enables international scientists to communicate and compare notes is necessary. Without a standard, they would have to spend extra time converting measurements between different systems of measuring, which would reduce accuracy. SI or metric unit is favoured because, among other things, it is not based on the bodily parts of individuals who lived hundreds of years ago. A universal standard that anyone can verify serves as the foundation of this sleek and straightforward system.
Hence, 'In the science field we use the metric units because of both the given reasons i.e. A. Metric units are universally accepted. B. Metric is a universal scientific language.
To know more about Metric unit visit
https://brainly.com/question/28524514
#SPJ1
the transformation of energy during cellular respiration can be followed from glucose to
Answer:
ATP OR adenosine triphosphate
Explanation:
is chemical energy the cell can use
Label the diagram:
Pyrimidine, Nucleotide, Deoxyribose, Purine, Phosphate, Hydrogen bond
Nucleotides are the subunits of nucleic acids. These monomers are composed of three parts, the base, the phosphate group, and the sugar. In the xposed emage, 1- nucleotide. 2- pyrimidine. 3- purine. 4- phosphate. 5- deoxyribose. 6- Hydrogen bond.
What are nucleotides?
Nucleotides are monomers composed of a sugar molecule, joined with a phosphate group and a nitrogenated base. Many of these monomers comprise nucleic acids, which are polymer.
Monomers are composed of carbon, oxygen, and hydrogen atoms, which establish covalent bonds.
Nitrogenated bases are molecules carrying nitrogen and exhibiting the chemical properties of a base. These are purines (Adenine and Guanine) and pyrimidines (Thymine, Uracyl, and Cytosine.).DNA ⇒ Adenine, Guanine, Thymine, and Cytosine.
RNA ⇒ Adenine, Guanine, Uracyl, and Cytosine
Adenine pairs with thymine or uracil, while guanine pairs with cytosine.
Sugar group: Sugar is always a pentose.DNA sugar group contains deoxyribose
RNA sugar group contains ribose
Phosphate groupIt is composed of a central phosphoric atom surrounded by four oxygen atoms arranged in a tetrahedron layout.
Nucleotides have a certain order or sequence in nucleic acids, which is significant since these sequences carry biological information necessary to carry out cellular functions.
In the exposed emage, we can see
1- Represents the whole nucleotide.
2- Is a pyrimidine.
3- Is a purine.
4- Represents the phosphate.
5- This is the DNA deoxyribose.
6- Hydrogen bond.
You can learn more about nucleotides at
https://brainly.com/question/13062517
https://brainly.com/question/13185536
#SPJ1
Which of the following
describes parasitic worms?
A. single-celled eukaryotes that are usually
found in contaminated water or insect bites
B. living, single celled organism that are the
most common pathogen and can be treated
with antibiotics
C. multicellular pathogen that lives in the
intestinal tract of host to absorb nutrients this
D. non-living pathogen that can't be treated
with antibiotics and reproduces with a host
Answer:
C. multicellular pathogen that lives in the intestinal tract of host to absorb nutrients this.
Explanation:
Answer:
c) multicellular pathogen that lives in intestinal tract of host to absorb nutrients
Explanation:
Parasitic worms are the multicellular pathogen that lives in the intestinal tract of host to absorb the nutrients. Therefore, the option (c) is the correct answer.
with reference to trophic levels compare the survival of organisms in the terrestrial hand aquatic habbitat
The survival of organisms in both the terrestrial and aquatic habitat depends on the first trophic level, which is represented by the producers in these ecosystems.
What are producer organisms?The producer organisms are those organisms that generate biomass by using solar radiation through a process known as photosynthesis, which includes algae in aquatic environment and plant in terrestrial environments. These organisms serve to sustain al trophic levels in the food chain.
Therefore, with this data, we can see that the producer organisms sustain life in all types of ecosystems and they are located at the first trophic level.
Learn more about producer organisms here:
https://brainly.com/question/23651484
#SPJ1
what symbiotic relationship between a wolves & Bear
Because bears easily oust wolves from their kills, bears may discover more ungulate carcasses over a longer period of time because wolves forage on ungulates all year long.
what coexists harmoniously with wolves?Petroglyphs on cave walls depict the symbiotic interaction between the wolf and the grizzly bear. Since the end of the last Ice Age, these two wild animals of the North have been involved in an amazing survival dance.
What is the bear's symbiotic relationship?Bear Lice, which are around 2 mm long and dwell on the surface of the bear and eat, coexist in harmony with Black Bears.
To know more about wolves & Bear visit:-
https://brainly.com/question/12383298
#SPJ1
Which statement BEST describes why warm ocean currents are usually surface currents?
Answer:
density
Explanation:
the warm currents are usually at the surface because they are less dense then the cold currents the colder current is the farther down in the ocean it will be
A model of onion root meristem cells during cell division is shown here. Which explanation is true about the cell labeled with the letter A? Select all that apply.
A) The chromosomes are independently assorting to ensure that the haploid daughter cells are genetically diverse.
B) The chromosomes are migrating to the center of the cell to cause a fertilization event resulting in a diploid cell.
C) The chromosomes are undergoing crossing over to ensure that the daughter cells are genetically diverse from the parent cell.
D) The chromosomes were duplicated prior to mitosis to ensure that a full complement of genetic material is passed to the daughter cells.
E) The chromosomes are being pulled to opposite sides of the dividing cell to ensure a full complement of genetic material is passed to the daughter cells.
Answer: d
Explanation:
Answer: It is D and E
Explanation:
A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER).
Which of the following functions is this cell type most likely specialized to perform?
a. The production and secretion of steroids
b. The destruction of toxic materials produced in other cells of the organism
c. The synthesis of polysaccharides for energy storage
d . The production and secretion of proteins
Cells that produce and secrete proteins have exceptionally high levels of rough endoplasmic reticulum (RER). The correct option to this question is D.
The endomembrane system, the plasma membrane, or proteins that will be secreted are the general purposes of the ER. All of the cell's membranes, including those of the endoplasmic reticulum, the Golgi apparatus, lysosomes, and vesicles, are included in the endomembrane system. Chloroplasts, peroxisomes, and mitochondria do not make up the endomembrane system.
To produce proteins in the cell, the rough endoplasmic reticulum is crucial. The cell would lack crucial proteins and other organelles would be unable to perform their duties if the rough ER were not functioning properly.
For more information on rough endoplasmic reticulum kindly visit to
https://brainly.com/question/13118914
#SPJ4
which process produce the gaseous by-product oxygen?
Oxygen is the gaseous by product released in the photosynthesis process.
The two essential biological processes that take place in plants are photosynthesis and respiration. The two processes that have been explored in the question are photosynthesis and respiration. Carbon dioxide is fixed to produce glucose and oxygen is liberated during photosynthesis.
Photosynthesis chemical equation:
6CO 2→12H 2O→C 6 H 12 O 6 +6H 2O+6O 2
↑
The oxygen from this reaction is fixed for respiration and glucose is broken down for the release of energy.
Respiration chemical equation:
C 6 H 12O 6+6O 2 →6CO 2 +6H 2
O+Energy↑
Oxygen released during photosynthesis will be used in respiration.
To know more about photosynthesis visit:
https://brainly.com/question/1388366
#SPJ9
Remember the law of conservation of mass. The human body uses cellular respiration to make energy. Using the chemical equation for cellular respiration, explain how the amounts ofoxygen and carbon dioxide inhaled by the lungs is different from the amounts exhaled. Explain your answer in 1-2 sentences. (2 points)
With the equation of cellular respiration C₆H₁₂O₆ + 6O₂ → 6CO₂+ 6H₂O, gaseous exchange takes place, glucose reacts with oxygen forming Adenosine Triphosphate used by cells.
About 21% of oxygen and 0.4% of carbon dioxide of air is inhaled while the air we breathe out contains 16.4% of oxygen and 4.4% of carbon dioxide because cells use oxygen inhaled to release energy and carbon dioxide as byproduct.
How does Cellular Respiration work?Cellular respiration is how organisms convert fuel into energy and nutrients by combining oxygen with food molecules, sending the chemical energy for life sustaining activities while expelling carbon dioxide and water.
We inhale 21% of oxygen and 0.4% of carbon dioxide and exhale 16.4% of oxygen and 4.4% of carbon dioxide as by product during the process of cellular respiration.
Find out more on cellular respiration here: https://brainly.com/question/25921566
#SPJ1
3. Show the possible genotypes and phenotypes of the offspring from between a homozygous male with type A blood and a homozygous female with type B blood.
Answer:
A heterozygous male with type A blood IA IO
A heterozygous female with type B blood - IB IO
a cross between a heterozygous male with type A blood and a heterozygous female with type B blood.
Possible parent genotype: IA IO x IB IO
AO X BO
possible offspring genotype: AB AO BO OO
phenotypes: AB blood type (25%), A blood type (25%), B blood type (25%) and O blood type (25%).
Explanation:
why improving Microsoft Access
is important in the workplace?
Internal and external information is brought to the brain in the process of
Answer: Consciousness
Why is Mendel's model of genetics not the only model of inheritance?
Mendel's model of genetics is not the only model of inheritance, because may be another model, was also presented by another scientist.
How is Mendelian inheritance different from Non-Mendelian inheritance?The Mendelian quality is determined by dominant and receding alleles of one gene. On the opposite, non-Mendelian traits are not determined by dominant and relapsing alleles and can be governed by more than one gene. Non-Mendelian inheritance is any design in which traits do not segregate in accordance with Mendel's laws.
The genetic traits that follow the truth of Mendel's law are known as Mendelian inheritance while the genetic traits. Non-Mendelian genetics are inheritance motif that is different from Mendelian inheritance.
So we can conclude that Mendelian inheritance reports the inheritance of phenotypes, determined by only two alleles. One of the two alleles is dominant.
Learn more about Mendelian here: https://brainly.com/question/516014
#SPJ1
Which criterion is a requirement for naturalization as a US citizen?
A.
The person must be a lawful, permanent resident for five years.
B.
The person must read, write, and speak at least two languages.
C.
The person must be related to a natural or naturalized citizen.
D.
The person must be between the ages of 18 and 55 years old
The person must be a lawful, permanent resident for five years is the criterion that is a requirement for naturalization as a US citizen.
You must be at least 18 years old, be able to read, speak, and write English, have knowledge of US history and government, adhere to the laws outlined in the US constitution, and have lived on US soil for at least 30 months prior to applying in order to qualify for citizenship as an American. There are also other requirements that must be met in order to qualify for citizenship as an American.
Following compliance with the criteria outlined by Congress in the Immigration and Nationality Act, a lawful permanent resident is granted U.S. citizenship through the naturalization process (INA).
To learn more about Naturalization visit: https://brainly.com/question/17205840
#SPJ1
Three genes, X, Y, and Z, are located either on the same chromosome, or on different chromosomes. If the recombination frequency for X and Y was found to be 25%, and Y and Z was found to be 60%, this would mean that
-genes X and Y are on the same chromosome.
-genes Y and Z are on different chromosomes.
-both of the other answers are correct
Answer: -genes X and Y are on the same chromosome.
Explanation:
A human cell containing 22 non-sex chromosomes and a Y chromosome is
O a male non-sex cell
O a fertilized egg
O a sperm
O an egg
TRUE or FALSE: As time passes, the universe is
becoming more disorderly.
Answer:
true
Explanation:
Using the following genomic sequence:
1) Underline each Intron
2) Circle each exon
GUUAUGAGUCGUUGGCAUUAAUCUUUCCUUAUGAUUGUCGCUGAUCGUUAG
UCGUCCAUGCGUGGUGGCUGACUUCCAAUGACCAAAUCUUCGGUGGCGGAG
UAACAUAUAAGAAUGACCAAAAGGCGUCGAUGAGGAUGUGGCAAUUAACAUC
Explanation:
Here the underlined parts are STOP CODONS NO INTRONS WERE FOUND IN THE GIVEN SEQUENCE
Intron: AUC, UUU, CUA, CGC, UUA, AGA, AGG, CGU, AUG, AGG, AUG, UGG
Exon: GUU AUG AGU CGU UGG CAU UAA UCU UUC CUU AUG AUU GUC GCU GAU CGU UAG, UCG UCC AUG CGU GUG GCU GAC UUC CAA UGA CCA AAU CUU CGG UGG CGG AGU, UAA C AUU AUA AGA AUG ACC AAA AGG CGU CGA UGA GGA UGU GGC AAU UUA ACA UC
What are Introns and Exons?Parts of a gene are known as introns and exons in molecular biology. While introns are the non-coding portions that break up coding sequences, exons are the coding areas of a gene that carry the information required to construct a protein.
Introns are not expressed, whereas exons are the regions of a gene that are. Introns are cut out and exons are spliced together to create the final messenger RNA (mRNA) which will be translated into a protein after a gene has been transcribed into mRNA.
Therefore, Intron: AUC, UUU, CUA, CGC, UUA, AGA, AGG, CGU, AUG, AGG, AUG, UGG
Exon: GUU AUG AGU CGU UGG CAU UAA UCU UUC CUU AUG AUU GUC GCU GAU CGU UAG, UCG UCC AUG CGU GUG GCU GAC UUC CAA UGA CCA AAU CUU CGG UGG CGG AGU, UAA C AUU AUA AGA AUG ACC AAA AGG CGU CGA UGA GGA UGU GGC AAU UUA ACA UC
Learn more about Introns and Exons, here:
https://brainly.com/question/26464408
#SPJ2
Can someone tell me a environmental problem related to biodiversity for my project?
Answer: alteration, and loss of habitats, pollution, and climate change.
Explanation: Theres 3 have a good day
Answer:
"Biodiversity,or the variety of all living things on our planet, has been declining at an alarming rate in recent years, mainly due to human activities, such as land use changes, pollution and climate change."
Explanation:
animals are a. Prokaryotic without a cell wall b. Eukaryotic without a cell wall c. Eukaryotic with a cell wall d. Prokaryotic with a cell wall please answer quickly
Answer:
b.
Explanation:
Animals, plants, fungi, and protists are all eukaryotes
What is the DNA replication process?
When a cell divides, DNA copies itself through a process called replication.
What are the steps involved in replication?
The double helix structure of the DNA molecule must first be unzipped in order to begin DNA replication. A enzyme called helicase does this by dissolving the hydrogen bonds binding the complementary nucleotides of DNA together (A with T, C with G)A replication fork is formed when the two single strands of DNA split apart. The two split strands will serve as models for creating the new DNA strands.The leading strand is the one of the strands that is orientated from 3' to 5' (towards the replication fork). The other strand, known as the lagging strand, is orientated in the 5' to 3' orientation (away from the replication fork).A little RNA fragment known as a primer, which is created by the enzyme primase, arrives and attaches to the leading strand's end. The primer serves as the initial template for the synthesis of DNA.A, C, G, and T are new complementary nucleotide bases that DNA polymerase adds to the leading strand of DNA as it walks along it in the 5' to 3' orientation.Continuous replication is what it is known as.The primase enzyme produces a large number of RNA primers that bind at diverse locations along the lagging strand.The lagging strand is then supplemented with chunks of DNA, known as Okazaki fragments, also in the 5' to 3' direction.As the Okazaki fragments will eventually need to be joined together, this type of replication is known as discontinuous replication.Once all of the bases have matched (A with T, C with G), the primer is removed by the enzyme exonuclease (s). More complementary nucleotides are subsequently added to fill in the spaces left by the primer(s) in their place.To ensure that the new DNA sequence is error-free, the new strand is proofread.Finally, the DNA sequence is sealed into two continuous double strands by an enzyme known as DNA ligase.Two DNA molecules made up of one new and one old chain of nucleotides are produced as a result of DNA replication. Due to the fact that only half of the replication chain is made up of original DNA molecules, DNA replication is referred to as being semi-conservative.The newly created DNA automatically forms a double helix after replication.Hence the process of DNA replication
To learn more about DNA replication click on the link
https://brainly.com/question/21265857
#SPJ4