Find the area of this parallelogram. Be sure to include the correct unit in your answer.

Find The Area Of This Parallelogram. Be Sure To Include The Correct Unit In Your Answer.

Answers

Answer 1

Answer:

66 sq.yd

Step-by-step explanation:

Given,

Base of the parallelogram = 11 yd

Height of the parallelogram = 6 yd

Therefore,

Area of the parallelogram = base × height

= 11 yd × 6 yd

[tex] = 66 {yd}^{2} [/tex]

Hence,

Area of the parallelogram is 66 sq. yd


Related Questions

Convert 562 hectograms to pounds to the nearest hundredth

Answers

Answer:

Is that your answer

Answer:

123.90

Step-by-step explanation:

1 Hectogram = 0.22 lbs

[tex]562*0.22=123.90\\[/tex]

Jose purchased a delivery van for his business through an online auction. His winning bid for the van was $34,750. In addition, Jose incurred the following expenses before using the van: shipping costs of $1,470; paint to match the other fleet vehicles at a cost of $1,590; registration costs of $4,836, which included $4,600 of sales tax and an annual registration fee of $236; wash and detailing for $141; and an engine tune-up for $318.

Required:
What is Jose’s cost basis for the delivery van?

Answers

Answer:

Jose's cost basis for the delivery van = $42,410

Step-by-step explanation:

Cost basis of a fixed asset can be described the original value of an asset for tax purposes which includes the purchase price, shipping, installation, sales tax, and other costs incurred that are related to the purchase of the fixed asset and to make it be in conformity with other assets in its class.

Based on this explanation, Jose's cost basis for the delivery van can be calculated as follows:

Jose's cost basis for the delivery van = Winning bid + Shipping costs + Cost of painting to match other fleet vehicles + Sales tax = $34,750 + $1,470 + $1,590 + $4,600 = $42,410

One amoeba weighs about 1.5×10^-9
grams. About how many grams would a quantity of 5×10^12 amoebas weigh?

Answers

9514 1404 393

Answer:

  7.5×10^3 grams

Step-by-step explanation:

Your calculator can tell you the product of the weight of each times the number of them. It is ...

  (1.5×10^-9)(5.0×10^12) = 7.5×10^(-9+12) = 7.5×10^3 . . . grams

About 7.5 kg.

Fill in the blanks
will choose brain

Answers

5,20,45 I sure that’s the correct answer

How does the stimulus check impact society please help me please i really need help please

Answers

Answer:

The stimulus check impacts society because it helps people or rather encourages people to invest. Not only individuals but also businesses. It also shows how the stimulus check gives more than peoples incomes. Not everyone can get the stimulus check, only tax payers who pay taxes every year and have a public job. This impacts society because not everyone can get the stimulus check, and some people receive lots of money and other people might get just a little. At the end of the day, it all depends on how much taxes you are paying each year and which job you have.

Hope this helps! :)


Terrell ran around a track that was 100 yards long.
How many feet did he run?

Answers

Answer:

300ft

Step-by-step explanation:

Answer:

300 ft

Step-by-step explanation:

1 yd = 3 ft

100 yd = 100 * 1 yd = 100 * 3 ft = 300 ft

Answer: 300 ft

Is (4, 3) a solution to the inequality 7x + 5y = 15?
yes
no

Answers

Answer:

no

Step-by-step explanation:

7x+5y=15

(x,y)

(4,3)

put in 4 for x and 3 for y

7(4)+5(3)=15

43=15

This equation is impossible

Hope that helps :0

Step-by-step explanation:

7x+5y=15 (x=4,y=3)

7(4)+5(3)=15

28+15=15

43>15

they are no equal

follow me

For each of the following studies, say whether you would use a t test for dependent means or a t test for independent means.

a. A researcher randomly assigns a group of 25 unemployed workers to receive a new job skills program and 24 other workers to receive the stan- dard job skills program, and then measures how well they all do on a job skills test.
b. A researcher measures self-esteem in 21 students before and after taking a difficult exam.
c. A researcher tests reaction time of each member of a group of 14 individuals twice, once while in a very hot room and once while in a normal- temperature room.

Answers

Answer:

1. T test for independent means

2. T test for dependent means

3. T test for dependent means

Step-by-step explanation:

In number 1, the two groups are unrelated. The first group has 25 subjects and they're all unemployed. The second group has 24 subjects and their employment status is not stated and might not be the same all through. Also, the first group is receiving a new type of job skills program while the second group is taking the standard job skills program.

- The groups in the experiment are unrelated

- The tests in the research are unrelated

- The purpose of the research is unreasonable - the researcher seeks to measure how well all 49 subjects perform on 'a' job skills test! No comparison between the scores or mean scores of the two groups.

In number 2, the researcher uses the same subjects and also measures the same variable but twice. This is a good example of a study where the t test for dependent means can be taken. Same applies in case 3.

Which of the equations below could be the equation of this parabola?

Answers

Answer:

The correct answer is C

Your welcome:)

The equation below could be the equation of this parabola is y = -5x².

Option A is the correct answer.

What is a parabola?

A parabola is an equation of a curve, such that any point on the curve is equidistant from a fixed point called the focus and a fixed line called the directrix of the parabola.

The equation of a parabola:

y = a(x - h)² + k

We have,

Since the parabola vertex is at (0,0) and is open to the left, the equation of the parabola must be of the form:

y = a x², where a is a positive constant.

Now,

The only equation that fits this form is y = -5x².

Thus,

The equation below could be the equation of this parabola is y = -5x².

Learn more about parabola here:

https://brainly.com/question/21685473

#SPJ7

Write and solve an equation to determine the height of a rectangular prism
with a width of 6 millimeters, a length of 20.5 millimeters, and a volume
of 984 cubic millimeters.

PLEASE HELP

Answers

Answer/Step-by-step explanation:

H = V/lw

H = 984/20.5*6

H = 984/128

H = 8

ANSWER:

H = 8

if GameStop buys a video game for $35.00 and sells it with a 15% markup. How much does it cost the customer?

Answers

Answer:

40.25$

Step-by-step explanation:

40 POINTS !! 40 POINTS !!

PLEASE HELP , DONT SKIP !

NO LINKS OR FILES.

Answers

Don’t mind the equation above the plot. Hope this helps:)

Answer:

2 0 4 3 1.

Step-by-step explanation:

u mean 10 points

Select the quadrant or axis where each ordered pair is located on a coordinate plane.

Answers

Answer:

(-5,7) 2nd          (8.5,-4) 4th       (0,5) y-axis

Step-by-step explanation:

PLEASEEEE HELP I WILL MAKE YOU BRAINIEST

Answers

Answer:

14

Step-by-step explanation:

Because right angles are 90 degrees, we need to subtract 34 from 90 which gets us 56. That means 56 = 4x, so 56/4 = 14, therefore X = 14.

Hope this helps!

Both angles form a right angle which is 90 degrees.

Angle 2 would equal 90 degrees - angle 1

Angle 2 = 90 -34 = 56

So now we know 4x = 56

To find x divide both sides by 4

X = 14

You need two bottles of fertilizer to treat the flower garden that has a perimeter of 42 feet. How many bottles do you need to treat a similar garden with a perimeter of 105 feet?

Answers

Answer:

5

Step-by-step explanation:

i think the answer is 5

PLS HELP THIS IS TRIGONOMETRY!!!! PLS SHOW STEPS

Answers

Answer:

third side =√{30²+16²)=34

sin theta/2=16/34

theta/2=sin-¹(16/34)

theta=28.07×2=56.14

Jason built a model of the Pentagon for a social studies project. He made each outside wall 33 centimeters long. What is the perimeter of Jason’s model pentagon?

Answers

Answer:

165 centimeters

Step-by-step explanation:

A pentagon has 5 sides

Each side is 33 centimeters long

5 x 33 = 165

You work and your hourly wage is $12.25 if you work 40 hours this week ,how much money would you make before taxes?

Answers

Answer:

$490

Step-by-step explanation:

Since one hour of work is $12.25, 40 hours is $490.

12.25 x 40 = 490

------------------

John 8:12 - Jesus spoke to the people once more and said, “I am the light of the world. If you follow me, you won’t have to walk in darkness, because you will have the light that leads to life.”

Philippians 2:7-8 - but emptied Himself, taking the form of a bond-servant, and being made in the likeness of men. Being found in appearance as a man, He humbled Himself by becoming obedient to the point of death, even death on a cross.

NANDARIINI RINNERIE MIRANI INDONESIA NOUTATI x2 - 7 when x = 8 mundo​

Answers

Answer: 57

Step-by-step explanation:

x² - 7

When x = 8

= x² - 7

= 8² - 7

= 64 - 7

= 57

jawabannya adalah 57

In ΔUVW, w = 11 cm, ∠W=8° and ∠U=132°. Find the area of ΔUVW, to the nearest square centimeter.

Answers

These boys r annoying frfr like stop

Answer:

208

Step-by-step explanation:

Delta math

Which is the graph of x - y = 1?
y
y
5
5
4
4
3
3
3
2
2
2
1
1
4
3
1 2
5
5
4-3-2-1,
1 2 3 4 5 X
4
1 2 3
5-4-3-2-11
5-4-3-2-1
2
-2
2-
-3
3
4
4
5
5
ly
5
4
3

Answers

Answer:

the 3rd graph

Step-by-step explanation:

The graph which represents x-y = 1 is; The 3rd graph.

Graph of a straight line

From the task content, the given equation of the line is; x - y = 1.

By rearranging the equation to take the slope-intercept form;.

y = x - 1.

Hence, slope of the graph is 1 and the y-intercept of the graph is -1.

On this note, only the 3rd graph satisfies the conditions above.

Read more on graph of a straight line;

https://brainly.com/question/14323743

What is the simplified value of the expression below?

StartFraction 7 times 8 + 20 (4.5) over 16 times 0.5 EndFraction
18.25
21.38
110.25
119.50

Answers

Answer:

C: 110.25

Step-by-step explanation:

The simplification form of the provided expression is 18.25 option (A) is correct.

What is an expression?

It is defined as the combination of constants and variables with mathematical operators.

We have a mathematical expression:

[tex]= \rm \dfrac{7\times8+20(4.5)}{16\times0.5}[/tex]

= (56 + 90)/8

= 146/8

= 18.25

Thus, the simplification form of the provided expression is 18.25 option (A) is correct.

Learn more about the expression here:

brainly.com/question/14083225

#SPJ2

The manager of the customer service department of an e-commerce company wants to know the average hold time for customers who call the department. The department receives about 850 calls each hour. The following data set shows the hold time, in minutes, for 10 calls picked at random. 2,1,4,5,3,3,7,4,3,2. Calculate the approximate hold time for all customers who call the customer service department.
The approximate hold time for all customers who call the customer service department is A 4 minutes. B 3 minutes. cannot be calculated from the given data. d 7 minutes​

Answers

Answer:

The answer is approximately 3.

Step-by-step explanation:

You add all the numbers and then divide by 10

The approximate hold time for all customers who call the customer service department is 3 minutes.

What is a mean?

Mean is the average of the given numbers and is calculated by dividing the sum of given numbers by the total number of numbers.

For the given situation,

The department receives about 850 calls each hour.

The data set shows the hold time, in minutes, for 10 calls picked at random. 2,1,4,5,3,3,7,4,3,2.

The approximate hold time for all customers who call the customer service department is calculated by mean as

⇒ [tex]\frac{sum of number of data sets}{Total number of data sets}[/tex]

⇒ [tex]\frac{2+1+4+5+3+3+7+4+3+2}{10}[/tex]

⇒ [tex]\frac{34}{10}[/tex]

⇒ [tex]3.4[/tex] ≈ [tex]3[/tex]

Hence we can conclude that the approximate hold time for all customers who call the customer service department is 3 minutes.

Learn more about mean here

https://brainly.com/question/24130817

#SPJ2

Model with mathematics. Abbi has decided to
offer a 2-hour computer gaming party for her
students. She can rent the student center for $45
per hour, and she can have the technology team set
up a network for up to 10 computers for a total of
$200 for the evening. Compose function p(x) such
that x is the number of students and p(x) is the
price per student for her to break even on the cost.
Note any appropriate restrictions on the domain x.

Answers

Answer:

180,000

Step-by-step explanation:

You got to multiply all the numbers and then divide by 600 and then you het your anwser

110 calories
5 gummy bears
What is the unit rate per gummy bear?

Answers

Answer:

348.7 Calories (per 100 g)Step-by-step explanation:

Answer:

it is 22 because if you divide 110 ÷ 5=22

PLEASE HELP ME W THIS

Answers

9514 1404 393

Answer:

  (b)  C = dπ

Step-by-step explanation:

The irrational value π is the ratio between the circumference of a circle and its diameter. That is ...

  π = C/d

Rearranging to get a formula for the circumference, we have ...

  C = dπ

6-4x+6(x-2) solve for x

Answers

6-4x+6x-12=0

2x-6=0

X= 3

Answer:

x=3

Step-by-step explanation:

6-4x+6(x-2)

6-4x+6x-12

-4x+6x=12-6

2x=6

x=3

Suppose an experiment is done with criminals released from prison in a certain state where the recidivism rate is 37​%; that​ is, 37​% of criminals return to prison within three years. One hundred random prisoners are made to attend a​ "boot camp" for two weeks before their​ release, and it is hoped that​ "boot camp" will have a good effect. Suppose 32 of those prisoners return to prison within three years. The null hypothesis is that those attending boot camp have a recidivism rate of

Answers

This question is incomplete, the complete question is;

Suppose an experiment is done with criminals released from prison in a certain state where the recidivism rate is 37​%; that​ is, 37​% of criminals return to prison within three years.

One hundred random prisoners are made to attend a​ "boot camp" for two weeks before their​ release, and it is hoped that​ "boot camp" will have a good effect. Suppose 32 of those prisoners return to prison within three years. The null hypothesis is that those attending boot camp have a recidivism rate of  37%.  

a) what is p. sample proportion of successes?

b) what is p0, the hypothetical proportion of success under the null hypothesis

c) what is the value of test statistic  

Answer:

a) sample proportion of successes is 0.32

b) the required value of p₀ is 0.37

c) the required test statistics value is -1.0356

Step-by-step explanation:

Given the data in the question

100 prisoners attend boot camp and 32 of them return to prison within three years

x = 32

n = 100

recidivism rate for the whole state = 37% = 0.37

a)

what is p. sample proportion of successes

p" = x / n

we substitute

p" = 32 / 100

p" = 0.32

Therefore, sample proportion of successes is 0.32

b)  

what is p₀, the hypothetical proportion of success under the null hypothesis

given that;

the population recidivism rate for the whole state is 37%;

p₀ = 37%

p₀ = 0.37

Therefore, the required value of p₀ is 0.37

Null hypothesis             H₀ : p₀ = 0.37

Alternative hypothesis Hₐ : p₀ ≠ 0.37

c)

what is the value of test statistic  

Z = (p" - p₀) / √([tex]\frac{p_0(1-p_0)}{n}[/tex])

so we substitute

= (0.32 - 37) / √([tex]\frac{0.37(1-0.37)}{100}[/tex])

= -0.05 / √0.002331

=  -0.05 / 0.04828

= -1.0356

Therefore, the required test statistics value is -1.0356

Y=1/4 x + 2 which is the equation of a line parallel to the line with the equation

Answers

The answer is y=1/4x

what is the radius of a sphere whose surface area is 100cm²?

Answers

Answer:

r≈2.82

Step-by-step explanation:

Hope this helps and have a great day!!!

Step-by-step explanation:

that can help you

Other Questions
In 12 sentences, describe the relationship between heat and thermal insulators.(2 points)A baker uses oven mitts to open an oven, take a loaf of bread out, and place it on a plate. In 34 sentences, identify three examples of thermal energy transfer in the scenario.(4 points) why is yhe greatest amoug of eergy soted in a molecyle of atp The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1 number of different selections of r hotdogs of 4 types generating function Liquidity Ratio Method Current Ratio Current Assets/Current Liabilities Quick Ratio (Current Assets - Inventory) Current Liabilities 0.82 2018 2019 2020 2021 0.76 1.893557 1.6400389 1.67789 0.76 1.695909 1.42623 1.46755 0.82 Financial Leverage Ratio Method Total debt ratio (Total Assets - Total Equity) Total Assets Long term debt ratio Long-term debt/(Total debt + total equity) Times interest earned EBIT/Interest Cash coverage (EBIT + depreciation) Interest 2017 0.251 0.11 278.36 296.1 2018 0.24 0.099 269.67 283.6 2019 2020 0.299 0.43 0.16 0.298 110.64 35.26 118.98 42.47 2021 0.42 0.27 51.62 57.66 Asset Management Ratios Inventory turnover Day sales in inventory Receivable turnover Days sales in receivables Fixed assets turnover Total assets turnover Formula COGS/Inventory 365/Inventory turnover Sales/Accounts Receivable 365/Receivables turnover Sales/Net Fixed Assets Sales Total Assets 2017 2018 2019 2020 2021 20.341 22.034 11.88 8.265 3.29 17.944 16.57 30.7 44.165 110.63 11.401 14.23 13.224 10.121 2.79 33.290 25.62 26.3744.548 65.32 1.319 1.53 1.26 0.713 0.285 0.899 0.99 0.83 0.450 0.171 Profitability Ratios Profit margin Return on assets (ROA) Return on equity (ROE) Formula Net income Sales Net income/Total assets Net income/Total equity 2017 2018 2019 2020 2021 0.28 0.031 0.27 0.21 0.27 0.26 0.031 0.222 0.096 0.047 0.345 0.041 0.316 0.167 0.083 You can focus on 2019-2021 and - Liquidity Ratios: Current ratio, Quick ratio - Asset Management Ratios: Inventory turnover, Days sales outstanding, Fixed asset turnover, Total asset turnover - Debt Management Ratios: Debt ratio, Times interest earned - Profitability Ratios: Profit Margin, Return on Assets, Return on Equity Because these tables include some ratios that are not needed for the report. 1. What are the risk factors that the company may face? 2. How do the ratios you analyze change in three years? 3. Based on these, in what ways is the firm strong or weak? 4. What are your suggestions for the company you are examining to be stronger in the future?