Find 48.9% of 264.Round to the nearest hundredth

Answers

Answer 1

Step-by-step explanation:

Simply divide the percent by 100 and multiply by the number. For example, 48.9 /100 x 264 = 129.096 or 0.489 x 264 = 129.096

Rounded to nearest hundredth

= 129.10

Answer 2

Answer:129.10

Step-by-step explanation:

Simply, the equation for the percentage value of a number is:

x*(z%/100%)=y

where x is your initial value, z is your percentage value, and y is the resultant value

for this question, the equations gives us as follows

264*(48.9%/100%)=129.096=129.10


Related Questions

Why is the slope the same on a line when different points are used to identify the slope?

Answers

Different points are used to identify the line, this can mean that both points lie on the same line.
Therefore the slope is the same because the line passes through both those points.

Different points can be used to identify the slope as follows -

We have a straight line.

We have to investigate why is the slope same on a line when different points are used to identify the slope.

What is Slope of a Line ?

The slope of a line is denoted by m and is defined as the change in y coordinate with respect to the change in x coordinate.

According to question -

Different points can be used to identify the slope provided that they all lie on the same straight line. Line is a collection of points and these set of points can be used top determine the rate of change of y with respect to x. The slope of a line can also be found out using y - intercept of the line using the general equation of straight line -

y = mx + c.

Hence, the slope is same on a line provided that they all lie on the same straight line

To solve more questions on Slope of lines, visit the link below -

https://brainly.com/question/10623813

#SPJ2

completing the square: x^2+2x-7=8x

Answers

Answer: x = 7, x = -1

Step-by-step explanation: Move the term to the left side

x^2 + 2x - 7 = 8x

x^2 + 2x - 7 - 8x = 0

Combine like terms

x^2 + 2x - 7 - 8x = 0

x^2 - 6x - 7 = 0

x^2 - 6x - 7 = 0

a = 1

b = -6

c = -7

x = -(-6) + (-6)^2 - 4 x 1(-7)/ 2 x 1

Evaulate the Exponent

Multiply the numbers

Add the numbers

Evaluate the square root

Multiply the numbers x = 6 ± 8/2

To solve for the unknown variable, separate into two equations: one with a plus and the other with a minus.

x = 6 + 8/2

x = 6 - 8/2

Rearrange and isolate the variable to find each solution

x = 7

x = -1

Write as an equation/inequality: "The product of four and a number is the sum of the number and twelve."​

Answers

Answer: 4x = x+12

Step-by-step explanation:

I have to mach the special of angles​

Answers

There is no picture for me to see

please help with this

Answers

i think the answer is -24

Ms. Lee takes out a loan to start a business. She borrows $5,000 at a simple annual interest rate of 6.5% for 5 years. What is the total amount of interest Ms. Lee must pay?

Answers

Answer:

6625

Step-by-step explanation:

We know that:  P = 5000

                          R = 6.5%

                          T = 5

Formulate and substitute: I = 5000rt

Calculate the product or quotient: 5000 x (1 + 0.325)

Calculate the sum or difference: 5000 x 1.325

Calculate the product or quotient: 6625

Jamie and Hudson took a road trip to the beach. Their total distance traveled after getting on the highway can be found using the function d(h)=55h+10, where h is the number of hours they have been driving on the highway.

1) Explain why the relationship between total distance and hours is a function.

2) Is this function continuous or discrete? Explain how you know.

3) If the girls can drive a maximum of 8 hours, what is the domain for the function? Explain your answer.

4) If the girls can drive a maximum of 8 hours, what is the range for the function? Explain your answer.

5) Create a graph that models this function. Be sure to include a title and to label your x- and y-axis with the variable names, but just x and y.

6) What is the slope of the function? What does it represent?

7) What is the y-intercept? What does it represent?

Answers

The total distance is an illustration of a linear function.

(1) Why the relationship is a function

The relationship is a function because all input values of h, have exactly one corresponding output value of d

(2) The function type

The function is a discrete function, because the number of hours is an integer, and it cannot take decimal values (in this case)

(3) The domain for a drive of 8 hours

The domain is the set of time the girls drive.

So, the domain is: [0,8]

(4) The range

The function is given as:

[tex]d = 55h +10[/tex]

When h = 0,

[tex]d = 55(0) +10 = 10[/tex]

When h = 8,

[tex]d = 55(8) +10 = 450[/tex]

So, the range is: [10,450]

(5) The graph

See attachment

(6) The slope

A linear function is represented as:

[tex]y = mx + c[/tex]

Where:

m represents the slope.

So, by comparison:

[tex]Slope = 55[/tex]

The slope in this case represents the distance travelled per hour

(7) The y-intercept

In (6) above, c represents the y-intercept.

So, by comparison:

[tex]c = 10[/tex]

The y-intercept in this case represents the initial distance

Read more about linear functions at

https://brainly.com/question/15602982

can someone help with another question i posted 5 minutes ago

Answers

Answer:

Awnser

what is the question

Which function is represented by the graph?
The parent absolute value function is translated
3 units and Y 1 unit.
The function that is graphed is f(x) =

Answers

The parent absolute value function is translated  3 units left and 1 unit up.

The function that is graphed is [tex]f(x) = |x + 3| +1[/tex]

The parent absolute function is given as:

[tex]y =|x|[/tex]

When a function is translated 3 units left, the rule of transformation is:

[tex](x,y) \to (x + 3,y)[/tex]

So, we have:

[tex]y = |x + 3|[/tex]

When a function is translated 1 unit uo, the rule of transformation is:

[tex](x,y) \to (x,y+1)[/tex]

So, we have:

[tex]y = |x + 3| +1[/tex]

Express as a function

[tex]f(x) = |x + 3| +1[/tex]

Hence, the function that is graphed is [tex]f(x) = |x + 3| +1[/tex]

Read more about transformation at:

https://brainly.com/question/1548871

Answer:

left,up, lx+3l+1

Have fun

A new health drink has 180% of the recommended daily allowance (RDA) for a certain vitamin. The RDA for this vitamin is 20 mg. How many milligrams of the vitamin are in the drink?

Answers

Multiply the percentage by the allowable amount:

180% = 1.80

20 x 1.80 = 36

Answer: 36 mg

Reflect parallelogram EFGH with E(-4,5), F(3,6), G(2,3) and H(-5,2) in the x-axis. what are the coordinates of F?

Answers

The answer should be (3,-6)

1+2+3+4+5+6+7+8+9+10+11+!2+13=?

Answers

Answer:

91

Step-by-step explanation:

1+2+3+4+5+6+7+8+9+10+11+12+13 = (14 * 6) + 7 = 91

1+2+3+4+5++7+8+9+10+11+12+13=91

What is the y-value of the vertex of the function f(x)=â’(xâ’3)(x 11)?.

Answers

Answer:

What is the y-value of the vertex of the function f(x)=â’(xâ’3)(x 11) 1060 by cata

Kim performed a transformation on rectangle ABCD to create rectangle A'B'C'D', as shown in the figure below: Rectangles ABCD and A prime B prime C prime and D prime are shown. A is at negative 1, 2. B is at negative 1, 5. C is at negative 3, 5. D is at negative 3, 2. A prime is at 2, 1. B prime is at 5, 1. C prime is at 5, 3. D prime is at 2, 3. What transformation did Kim perform to create rectangle A'B'C'D'? Rotation of 270 degrees counterclockwise about the origin Reflection across the line of symmetry of the figure Reflection across the yâ€axis Rotation of 90 degrees counterclockwise about the origin.

Answers

Rotation of 270 degrees counterclockwise about the origin.

The transformation rule for Rotations of 270 degrees counter clockwise is (x, y) —> (y, -x).

Kim performs to create rectangle A'B'C'D' Transformation, ''Rotation of 270 degrees counterclockwise about the origin'' and it can be determined by using the rules of transformation.

Given that,

Kim performed a transformation on rectangle ABCD to create rectangle A'B'C'D', as shown in the figure below:

Rectangles ABCD and A prime B prime C prime and D prime are shown.

We have to determine,

What transformation did Kim perform to create rectangle A'B'C'D'?

According to the question,

Kim performed a transformation on rectangle ABCD to create rectangle A'B'C'D', as shown in the figure below:

Rectangles ABCD and A prime B prime C prime and D prime are shown.

Transformation involves changing the position of the given shape.

The transformation on rectangle ABCD to A'B'C'D' is (a) rotation of 270 degrees counterclockwise.

The coordinates of ABCD are given as:

A (1, -2),

B (-1, 5)

C (-3, 5)

D (-3, 2)

The coordinates of A'B'C'D' are given as:

A (2, 1),

B (5, 1)

C (5, 3)

D (2, 3)

The transformation from ABCD to A'B'C'D is 270 degrees counterclockwise about the origin.

And the proof is as follows.

The rule of 270 degrees counterclockwise about the origin is:

The given coordinates;

A (2, 1) - (-1, 2)

B (5, 1) - (-1, 5)

C (5, 3) - (-3, 5)

D (2, 3) - (-3, 2)

Hence, Kim performs to create rectangle A'B'C'D' Transformation, ''Rotation of 270 degrees counterclockwise about the origin''.

For more details about Rotation refer to the link given below.

https://brainly.com/question/10624834

What is the least angle measure by which this figure can be
rotated so that it maps onto itself?

O 45°

O 90 °

O 180°

O 360°

Answers

Answer:

Step-by-step explanation:

360° degrees

The least angle measure by which this figure can be rotated so that it maps onto itself is 360 degrees option (D) 360° is correct.

What is geometric transformation?

It is defined as the change in coordinates and the shape of the geometrical body. It is also referred to as a two-dimensional transformation. In the geometric transformation, changes in the geometry can be possible by rotation, translation, reflection, and glide translation.

It is given that:

The two-dimensional figure is shown in the picture.

As we know from the definition of the geometric transformation; the change in coordinates and the shape of the geometrical body and geometric transformation, changes in the geometry can be possible by rotation, translation, reflection, and glide translation.

The least angle measure by which this figure can be rotated so that it maps onto itself is 360 degrees

Because the rotation of 45, 90, and 180 degrees cannot map the figure onto itself.

Thus, the least angle measure by which this figure can be rotated so that it maps onto itself is 360 degrees option (D) 360° is correct.

Learn more about the geometric transformation here:

brainly.com/question/16156895

#SPJ2

(4z^7+1/z^7)^2 how do i solve this?

Answers

Answer:

if i am correct this is the formula you asked?

[tex](4z^7+\frac{1}{z}^7)^2[/tex]

Step-by-step explanation:

the answer is

[tex](\frac{(4z^{14} +1)^2}{z^{14} } )[/tex]

if i put the wrong equation tell me so i can do it again

:)

Just gonna attach a picture of the problem so it’s easier

Answers

Answer:

You have to find the intercept hope this helps

Step-by-step explanation:

I really tend this answer fast

Answers

Answer:9.1 units

Step-by-step explanation: Hope you get it right :D

What is the percent of change from 46 to 69?

Answers

Answer:

A change from 46 to 69 represents a positive change (increase) of 50% Use the formula found below on this webpage to find the percent change by replacing the given values: Percent change = New - Old |Old| × 100% Percent change = 69 - 46 |46| × 100% =

Step-by-step explanation:

Used my brain (Lol brain)

31.74%
I hope it’s help

Find the measure of y.
• 110°
• 100°
• 103°
• 93°

Answers

Answer:

110°

Step-by-step explanation:

Alternate angles are equal.

Hope this helps and have a good day!

Measure of y is [tex]103^0[/tex]

What is quadrilateral ?

A quadrilateral is a plane figure that has four sides or edges, and also has four corners or vertices. The angles are present at the four vertices or corners of the quadrilateral. If ABCD is a quadrilateral then angles at the vertices are ∠A, ∠B, ∠C and ∠D. The sides of a quadrilateral are AB, BC, CD and DA.

110 + Z =180 ......................(Linear pair)

So, the measurement of angle z is 70.

Since,  Sum of all interior angles of quadrilateral = 360°.

then...

Y = 360 - (100 + 87 + 70)

Y = 360 - 257

   = 103

Hence, measure of y is [tex]103^0[/tex]

To learn more about the  quadrilateral here:

https://brainly.com/question/29269424

#SPJ7

what is 2244 divided by 51 show work

Answers

Answer:

44 Step-by-step explanation:

                                 

first you want to put the Question like this in the calculator

2244÷51=44

PLEASE HELP
In 2010, the population of a city was 167,000. From 2010 to 2015, the population grew by 6.3%. From 2015 to 2020, it fell by 4.6%. To the nearest whole number, by what percent did the city grow from 2010 to 2020?

Answers

6.3-4.6=1.7%. You subtract the percentages to find the total percentage after the percentage dropped 4.6 from 6.3

Answer:

1%

Step-by-step explanation:

Two shops, Waitroze and Budgins sell the same brand of cans of soup but with different offers.
Calculate the price for 24 tins at each shop.
Waitroze = 8 for £3.35
Budgins = 6 for £2.89

Answers

Answer:

24 cans at Waitrose would be £10.05.

24 cans at Budgins would be £11.56.

Step-by-step explanation:

Times the waitrose offer by 3

Times the budgins offer by 4

Hope that helped. x

A company has two warehouses that are 360 miles apart. A truck leaves Warehouse A and heads towards Warehouse B traveling at 45 miles per hour. At the same time, a truck leaves Warehouse B and heads towards Warehouse A traveling at 60 miles per hour. How long will the trucks be driving before they meet each other on the road?
between 1 and 2 hours
between 2 and 3 hours
between 3 and 4 hours
between 4 and 5 hours

Answers

Answer:

Between 3 and 4 hours

Step-by-step explanation:

Let's turn the sentence into an equation, suppose that both trucks will be traveling at a constant rate, let x be the number of hours truck A has been traveling, and let y be the number of hours truck B has been traveling. Then we can set up the equation:

[tex]45x+60y=360[/tex]

Both of these terms must add up to 360 since that will be the point where both trucks will meet. To solve this, we can use a graphing calculator:

(see picture)

Since both trucks left the warehouses at the same time, we need that:  [tex]x=y[/tex]

And the point in the graph that x=y is around 3.42 and 3.44, so we can conclude that both trucks must be traveling for 3-4 hours for them to meet on the road.

I hope this helps.

If the average volume flow of blood through the aorta is 8.5 × 10-5 m 3/s and the cross-sectional area of the aorta is 3.0 × 10 -4 m2, what is the average speed of blood in the aorta?

Help me:)

Answers

The average speed of blood in the aorta is 0.2833 m/s

Speed is the ratio of distance travelled to time taken. It is given by:

Speed = distance  / time

From the question, to calculate the average speed:

Average speed = Volume rate / cross sectional area

Average speed = 8.5 * 10⁻⁵ / (3 * 10⁻⁴) = 0.2833 m/s

The average speed of blood in the aorta is 0.2833 m/s

Find out more on average speed at: https://brainly.com/question/680492

A line with the slope of -4 passes through the point (8,-3). What is the equation in point slope form

Answers

Y=Mx + c
The slope is given already so it will be :
Y=-4x+c
Now you can find C by replacing the given points

-3=-4(8)+c

C=9

Final answer is :

Y= -4x+9

PLEASE HELP AS SOON AS POSSIBLE I NEED TO SUBMIT THIS IN 10 MINUTES!!!!


IT GIVES 20 points!!!

Answers

Answer:

1. A. falling asleep

2. D. taking more time to wind down before bedtime

3. B. There is more than one reason that people have trouble sleeping.

4. C. The problem of falling asleep has been around for a long time and affects many people

5. A. why kids have trouble falling asleep and what they can do about it

6. A. something done over and over

Step-by-step explanation:

5. Identify the type of function and the degree of the function: f(x)=6x +3x² -11
A. Quadratic, degree 3
B. Quadratic, degree 2
C. Cubic, degree 6
D. Quartic, degree 11

Answers

Answer:

B. Quadratic, degree 2

Step-by-step explanation:

ALl you have to see is the degree. The degree is the largest exponent of the expression. The largest exponent here is 2 and since there is only one answer with a degree of two, the answer is b.

Answer:

B

Step-by-step explanation:

the largest exponent is 2 i.e the degree is 2

I need the answers to these please

Answers

a) 7 × (-4)

= -28

b) (-6) × 8

= -48

c) (-5) × (-9)

= 45

[tex]\mathbb{MIREU} [/tex]

What the time in your region ?​

Answers

Answer:

Step-by-step explanation:

2:33pm

Answer:

11:35 pm here in Dubai.....Hehe.......
Other Questions
a group of 3 people are sharing chocolates each person wants 8 chocolates and each box has 4 chocolates 5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How manybagels can they bake in 15 hours? What was that rate per hour? David created a shoe box model of a grassland. He placed biotic factors in first but needs to add some abiotic factors. Which two abiotic factors could he add? A. Trees, B. Sunlight, C. Insects, D. Flowers, E. Humans, F. Water. There is an array under. what is the last number?1 2 4 7 13 24 ? in any chemical reaction or physical change the mass of the product is ___ The mass of the reactanta. The relationship cannot be determined by the amount of information givenb. equal to or the samec. twice is greater thand. twice as less than The degree of coldness or hotness is different for different objects. Explain with an example 1. in a biogeochemical cycle, a chemical element spends time in different places, called . Your skeleton enables you to move.True False Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT Plz Answer this its 25 points plz answer and i will mark u as brainlist its a easy question but i need explanation no random writing only if u know the answer plz help me ASAP ! how con normal fault formed How many moles are there in 10 dm3 of sulfur dioxide gas Which of the following equations contains the point (8, 5) and is perpendicular to the line y = 2x 3? Help me out plz Ill mark pls help it is math for 7th grade. 108 is what percent of 72 The boys and the Darling children.... A rectangle with a width of 4.6 inches has an area of 23 inches squared. What is the length? The Later Middle Ages7Which of the following was the site of the only victory achieved by the Crusaders in the Second Crusade?OA. ConstantinopleOB. LisbonOC. EphesusODDamascus Johnny has a box filled with 10 black marbles and 5 purple marbles.What are the odd he pulls two purple marbles in a row without replacemnet