Explain the importance of transport in lndia​

Answers

Answer 1
Don’t click the link!! Also the answer is because of oil transportations

Related Questions

Why did the United States enter World War II?​

Answers

Answer:

the United States did not enter the war until after the Japanese bombed the American fleet in Pearl Harbor, Hawaii, on December 7, 1941.

Answer:

they didnt enter until after the Japanese bombed the American troops i  pearl harbor

Explanation:

The term minority group is potentially ambiguous and confusing, particularly for sociologists, because: the relative proportions of minority and majority groups change over time. they often disagree about the percentage of the population that is nonwhite. sociology is a dynamic discipline that has difficulty with a static concept such as minority group. they use the term to mean disadvantaged, not necessarily a group of less than 50 percent of the population.

Answers

Answer:

The term minority group is potentially ambiguous and confusing, particularly for sociologists, because:

D. they use the term to mean disadvantaged, not necessarily a group of less than 50 percent of the population.

Explanation:

When people in general use the term "minority", they are referring to less the fifty percent of a group, whatever that group is. If we say, for instance, that the minority of the class voted for a longer break, we know that less than 50% of the students thought a longer break was necessary. However, when it comes to sociology, minority does not necessarily refer to a group that forms less than 50% of the population. Any group whose individuals are treated unequally due to cultural or physical characteristics is a minority. For instance, women are considered a minority, even though it is common for them to constitute a greater part of the population in several countries.

Which statement best completes the diagram?culture of northern africa
A. Most people live in rural towns.
B. Most people speak French or German.
C. Arts are based largely on Muslim culture.
D. Foreign immigration is not allowed.

30 POINTSS

Answers

The answer is C. Arts are based largely on Muslim culture

Sorry if it’s wrong

Answer:

c

Explanation:

big up a p e x

what are the answers?

Answers

Answer:

1. D.

2. A.

Explanation:

Explain how even a renewable resource can run out, and give examples.
Please Help!!!

Answers

Answer:

Nonrenewable resources are depleted more quickly than they can be replenished. They're gone for all practical purposes until they're gone. Renewable supplies are so plentiful or are supplemented so quickly that they cannot theoretically run out. Solar, wind, hydro, and (possibly) biomass are examples of renewable energy.

Explanation:

Hope this helps!

Please mark me as Brainliniest.

Even certain naturally occurring resources that are renewable resources could run out if they are all depleted or abused. Additionally, we must guard against the pollution of our natural resources. When individuals release toxic chemicals and other materials into the environment, pollution happens.

What are renewable and non-renewable resources?

Natural resources come in two different categories: Renewable and non-renewable.

Solar, wind, water, biomass—organic matter derived from plants and animals—and geothermal energy are the top five sources of renewable energy. Although renewable energy sources have an endless supply, in the long run, their availability at any particular time is constrained.

Non-renewable energy sources are in short supply, typically because it takes time for them to regenerate. These non-renewable resources have the benefit of allowing the power plants that employ them to produce additional power on demand.

Learn more about renewable and non-renewable sources, from:

brainly.com/question/3831884

#SPJ2

When a state tries to prevent or regulate monopolies, it acts within:_________

Answers

When a state tries to prevent or regulate monopolies, it acts within the realm of antitrust laws . These laws are designed to promote fair competition in market.

Antitrust laws are a set of legal measures that aim to foster competition and prevent the formation or maintenance of monopolies. These laws are designed to promote fair competition, prevent the abuse of market power, and protect consumer interests. They are enacted by governments to ensure that businesses operate in a competitive marketplace, free from anti-competitive practices such as price-fixing, collusion, and unfair trade practices. The laws typically provide guidelines and restrictions on mergers and acquisitions, market dominance, and the abuse of market power. By enacting antitrust laws, a state can actively intervene to promote competition and prevent the concentration of economic power in the hands of a few dominant players. These laws encourage a level playing field for businesses, foster innovation, and protect consumer choice and welfare.

Learn more about monopolies:

brainly.com/question/10441375

#SPJ11

what are the most important changes hinduism has undergone over the centuries?

Answers

The statement "Piaget would argue that as an adolescent, Mildred is better able to understand calculus because she is in the sensorimotor stage" is False.

Jean Piaget is a Swiss psychologist who is famous for his theory on cognitive development. Piaget proposed that children's cognitive development depends on their level of physical, social, and biological maturity. He developed four phases of cognitive development. They are:Sensorimotor: This stage occurs from birth to two years of age. Infants in this stage use their sensory experiences to understand the world.

Preoperational: This stage occurs from age two to seven. The symbolic thinking of children in this stage is quite limited, and their understanding is based on their perception. They can not see things from different perspectives yet.

Concrete operational: This stage occurs between the ages of seven and twelve. Children become more logical in their thinking. They can comprehend the concept of conservation, for example, when pouring water from one container to another.

Formal operational: This stage occurs from age twelve and up. Adolescents can think logically and systematically. They can form and test hypotheses in this stage.Mildred's ability to understand calculus isn't determined by her stage of development. Instead, it is determined by her cognitive development, which is the product of her experiences and interactions with the world. Therefore, Piaget would not argue that Mildred's ability to understand calculus is influenced by her sensorimotor stage.

To know more about  Piaget

https://brainly.com/question/3648034

#SPJ11

In howell and colleagues’ (2011) trajectory models of gang activity, the t2 group represented cities with ____________________ t1 group.

Answers

In Howell and colleagues' (2011) trajectory models of gang activity, the t2 group represented cities with similar levels of gang activity as the t1 group. The term "t2" refers to the second time point or phase of data collection, while "t1" represents the first time point or phase.

The trajectory models aim to understand the patterns and trajectories of gang activity over time in different cities. By examining multiple time points, researchers can identify groups of cities that exhibit similar levels of gang activity at different stages.

In this context, the t2 group refers to cities that demonstrate comparable levels of gang activity to the t1 group. This grouping allows researchers to analyze and compare the changes in gang activity over time within and between these groups of cities, providing insights into the dynamics and factors influencing gang involvement and its variations across different urban settings.

To learn more about Gang activity : : brainly.com/question/32193519

#SPJ11

Why do you think countries choose to have a form of government

Answers

Answer:

Because if there was no government than chaos would take its place. Someone can rob from you and there would be no police to stop them. Serial killers wouldnt be caught. There would be no jails. The roads and other public things would be horrible because there would be no taxes. No one would pay for it if they dont have to.

1. The utilization factor is the ratio of the arrival rate to the service rate. TRUE/FALSE

2. In a nonpreemptive priority system, customers are served in the order in which they arrive in the queue. TRUE/FALSE

3. In a preemptive priority system, the lowest-priority customer being served is ejected back into the queue whenever a higher-priority customer enters the queueing system. TRUE/FALSE

Answers

1. The statement "The utilization factor is the ratio of the arrival rate to the service rate" is True.
A utilization factor is the percentage of time that a server is occupied. It is calculated by dividing the service rate by the arrival rate. The utilization factor is represented as a decimal number between zero and one.

2. The statement "In a non-preemptive priority system, customers are served in the order in which they arrive in the queue" is True.
A non-preemptive priority system is a queue management system in which each job is processed in the order in which it arrived, regardless of its priority level.

3. The statement "In a preemptive priority system, the lowest-priority customer being served is ejected back into the queue whenever a higher-priority customer enters the queueing system" is True.
In a preemptive priority system, whenever a new high-priority job arrives, the system preempts the low-priority job currently being executed and allocates the server to the high-priority job. The preempted low-priority job is put back into the queue to wait for its next execution cycle.

To know more about priority system

https://brainly.com/question/29352280

#SPJ11

in the context of the basic sources of power in a political system, when terrorists seize or bomb an embassy or assassinate a political leader, they are exercising:

Answers

In the context of the basic sources of power in a political system, when terrorists seize or bomb an embassy or assassinate a political leader, they are exercising coercive power.

Coercive power is one of the sources of power in a political system. It involves the use of force, threat, or violence to influence or control others. Terrorists employ coercive power through acts of violence and intimidation to create fear and exert influence over governments, institutions, or specific individuals. Seizing or bombing an embassy, as well as assassinating a political leader, are extreme examples of exercising coercive power to achieve their political objectives.

You can learn more about coercive power at

https://brainly.com/question/17167669

#SPJ11

which theory seeks to explain the specific actions taken by a leader? a. emotional intelligence b. behavioral theory c. trait theory d. leader-member exchange theory

Answers

It has since fallen out of favor as researchers have found that other factors, such as behavior and emotional intelligence, are also critical to effective leadership.

Behavioral theory seeks to explain the specific actions taken by a leader. The behavioral theory of leadership is built on the concept that leaders are made, not born. This theory suggests that people can acquire the necessary skills and qualities required to become successful leaders through instruction, observation, and practice.

a. Behavioral theory is a leadership theory that emphasizes the actions of leaders, not their internal traits or their intellectual makeup. According to this theory, leaders can be successful by focusing on their conduct and behavior rather than their inherent characteristics, such as intelligence and personality traits

Emotional intelligence refers to the ability to recognize and control one's emotions, as well as the emotions of others. Leaders with strong emotional intelligence can identify and manage their own emotions while also recognizing and responding to the emotions of those around them. This helps leaders create a positive and productive work environment and build strong relationships with their team members.

b. Emotional intelligence is a crucial aspect of leadership, as leaders who are aware of their emotions and those of others are more likely to make better decisions and communicate more effectively.

c. Leader-member exchange theory, or LMX, proposes that leaders develop unique and individualized relationships with each of their followers. According to this theory, the quality of the leader-member exchange relationship can impact employee job satisfaction, motivation, and performance.

d. Trait theory suggests that certain inherent characteristics, such as intelligence, charisma, and personality traits, can make someone more likely to become an effective leader. This theory was popular in the early years of leadership research, but it has since fallen out of favor as researchers have found that other factors, such as behavior and emotional intelligence, are also critical to effective leadership.

to know more about leadership visit:

https://brainly.com/question/31906311

#SPJ11

The theory that seeks to explain the specific actions taken by a leader is behavioral theory (option b).

What is behavioral theory?

Behavioral theory focuses on the observable behaviors of leaders and examines how their actions and behaviors influence their effectiveness in leading others. This theory emphasizes that leadership is not solely determined by inherent traits or characteristics but can be learned and developed through specific behaviors and actions.

It examines different leadership styles, such as task-oriented and people-oriented behaviors, and how these behaviors impact the leader's effectiveness in achieving organizational goals and influencing followers.

Learn more about behavioral theory at https://brainly.com/question/25570565

#SPJ9

does anyone, ANYONE have the answer key for this? it's do at 12, please help me​

Answers

Answer:

I found it!

quizletcom/79475963/world-history-chapter-11-rome-republic-to-empire-lesson-2-flash-cards/

This might seem like a virus like the other answer, but if you look at the link you can see it's a quizIet link

Also, remember to put a "." inbetween "quizIet" and "com", I had to remove it because it is not allowed by Brainly

Goodluck! :D

hi please help me. you can answer it in the comments too ')

1. It is difficult for you to decide what to have when you are in a restaurant? Why? / Why not?

2. Do you like to taste new things? Why? / Why not?​

Answers

Answer:

1. No, it is not difficult for me to decide what to have when I am in a restaurant be cause I just order the food that I like or longed to eat.

2. Yes, I surely like to taste some new foods because this allows me to know about the taste variety.

hope it helps:D

mark me as brainliest plz.

ECONOMICS QUESTION
How can you describe examples of pure competition even though there are no pure competitive markets?

Answers

Answer:

ok

Explanation:

Pure or perfect competition is a theoretical market structure in which a number of ... In a perfectly competitive market, however, such moats do not exist. ... As such, it is difficult to find real-life examples of perfect competition but there are ... the model is still helpful because of its ability to explain many real-life behaviors.

2. why is understanding sport economics important for someone working in sport finance

Answers

Understanding sports economics is important for someone working in sport finance because of the following reasons: Sports finance is the financial aspect of sports, and its objective is to generate revenue from sporting events, teams, and athletes, among other things.

In essence, sport finance involves the application of economic principles to sport-related activities. The sports industry is a multibillion-dollar industry with diverse sectors and significant financial implications. As a result, understanding sports economics is crucial for anyone working in sports finance, including athletes, sports marketers, and other sports-related professionals.

Here are some reasons why understanding sports economics is important for individuals working in sports finance:

The study of sports economics enables individuals working in sports finance to gain an understanding of the principles of microeconomics that govern sports-related activities. This knowledge helps individuals in the field of sports finance make informed decisions and maximize profits for their organizations.

Individuals in sports finance can use economics to understand how supply and demand affect ticket sales, merchandise sales, and other sporting events that generate revenue.

Understanding sports economics enables individuals in sports finance to analyze consumer behavior and how it relates to their respective organizations. They can use this knowledge to create marketing campaigns that resonate with consumers.

Understanding sports economics can also help individuals working in sports finance to predict changes in the market and take measures to prevent losses or exploit new opportunities as they arise.

In summary, understanding sports economics is crucial for individuals working in sports finance. It enables them to make informed decisions and take appropriate measures to maximize profits for their organizations.

Learn more about economics:

https://brainly.com/question/17996535

#SPJ11

The Pope was part of the First Estate in the Middle Ages.
1. True
2. False​
Edit: Took too long the answer is True

Answers

Answer:

True

Explanation:

P.S. It doesn't matter if you give me credit even if I answered because you already figured it out.

Answer:

True

Explanation:

The Pope became important in European society and strengthen the feudal structure in western Europe. The upper sections of the society had greater representations in the clergy. The Pope held a superior position in the Church. The Church did not pay taxes instead collected most of its income from the tithe.

giving brainliest!!!!!!

The _______ Trail made it possible for large groups to move west. The trail was _______ and _________.

Answers

Answer:

The Oregon Trail made it possible for large groups to move west. The trail was _______ and _________.

I dont know about the last two. Maybe dangerous and unsaintray? I am not so sure; we haven't learned this yet in calss

Explanation:

Why are the concepts of residents important in the taxation
system? In what circumstances are individuals treated as a resident
of Australia?

Answers

The concept of residency is important in the taxation system as it determines an individual's tax obligations, including worldwide income taxation and eligibility for tax benefits. In Australia, individuals can be treated as residents if they meet the residency or domicile tests, considering factors such as physical presence, intention to reside, and connection to the country.

Residency status determines whether an individual is subject to taxation on their worldwide income or only on income sourced within the country. It also determines eligibility for certain tax benefits, deductions, and exemptions. In the case of Australia, individuals are treated as residents for taxation purposes if they meet the criteria of either "residency" or "domicile" tests. The residency test considers factors such as physical presence, intention to reside, and connection to Australia. If an individual resides in Australia permanently or has a significant presence over a specific period, they are typically considered an Australian resident for tax purposes.

Learn more about ”domicile” here:

brainly.com/question/31935537

#SPJ11

what must a pizza delivery service accomplish so that you are reasonably satisfied?

Answers

For me to be reasonably satisfied with a pizza delivery service, there are a few key aspects that need to be accomplished. First and foremost, the pizza should arrive in a timely manner, ideally within the estimated delivery time. Punctuality is crucial to ensure that the pizza is still hot and fresh upon arrival. Additionally, the pizza should be accurately prepared according to my order, with the correct toppings, crust type, and any requested modifications.

The pizza should also be well-packaged and presented in a neat and hygienic manner. Friendly and professional customer service is also important, including polite and efficient interactions with the delivery person. Lastly, the delivery service should handle any issues or concerns promptly and effectively, such as resolving order mistakes or addressing any quality concerns. Overall, a pizza delivery service that meets these criteria of timely delivery, accurate order fulfillment, good packaging, excellent customer service, and prompt issue resolution would ensure my reasonable satisfaction.

To learn more about  reasonably click on the link below:

brainly.com/question/15580541

#SPJ11

Which of the following statements regarding team size is CORRECT?
Multiple Choice
Members of larger teams feel more engaged in teamwork.
Teams should be larger than necessary in case members drop out.
Smaller teams have less process loss.
The ideal team size is between 5 and 20 members.

Answers

The correct statement regarding team size is:

C. Smaller teams have less process loss.

What is process loss?

Process loss refers to the inefficiencies or difficulties that can arise within a team due to coordination, communication, and collaboration challenges.

Smaller teams typically experience less process loss compared to larger teams. With fewer members, it becomes easier to coordinate efforts, communicate effectively, and make decisions efficiently.

Learn more about team size at

https://brainly.com/question/29580215

#SPJ4

Which Substance is a natural land resource used in construction

A.steel

B.bedrock

C.clay

D.salt​

Answers

Answer:

Bedrock is your answer

ronald reagan's philosophy was most similar to that of which of the following presidents?

Answers

Ronald Reagan's philosophy was most similar to that of Calvin Coolidge, among the following presidents.

Ronald Reagan, an American politician and actor, held the position of the 40th President of the United States from 1981 to 1989. Before his presidency, he was the 33rd governor of California from 1967 to 1975 and served in the Screen Actors Guild trade union presidency from 1947 to 1952.

He was a Republican, who was known for his conservative politics. Calvin Coolidge, famously referred to as "Silent Cal," assumed the role of the 30th President of the United States, holding office from 1923 to 1929. He was known for his laissez-faire economic philosophy, which emphasized small government and individual liberty. Coolidge preferred limited government intervention in business matters and relied on the free market to regulate the economy, which was similar to Reagan's philosophy. As a result, Ronald Reagan's philosophy was most similar to that of Calvin Coolidge, among the following presidents.

Learn more about philosophy here:

https://brainly.com/question/3818064

#SPJ11

*
Which ISN'T a moon phase?

-Gibbous

-Full

-Crescent
-
Sliver

Answers

Answer:

Sliver

Explanation:

which of the following schools is most likely to have an open admissions policy

Answers

Nashville community college

Answer:

Nashville Community College

Explanation:

it was right

What action do the authors suggest that workers should take to improve their conditions? win reforms through peaceful strikes and protests hide their views from the public, and plot in secret band together and revolt against their governments run for office at the local and national levels

Answers

Answer:

C Band together and revolt against their governments

Explanation: I’m in AP Wrld so yeah I got it correct

The author suggests that workers should band together and revolt against their government take to improve their conditions. Thus, the statement "band together and revolt against their governments" is the correct statement.

How did the Industrial Revolution change working conditions for people?

Employment opportunities increased as a result of the Industrial Revolution. Compared to what people were paid as farmers, factory wages were higher. As factories spread, more managers and workers were needed to run them, which increased the number of jobs available and overall wages.

As a result of the Industrial Revolution's incentive to boost profits, factory working conditions declined. Working long hours for little pay with few breaks became the norm. Child labor was a serious problem. Many of the factory workers experienced health problems, which sparked the U.S. labor movement.

Learn more about revolt from workers, here:

https://brainly.com/question/11390508

#SPJ2

What is the political situation in denmark as the play begins?

Answers

As the play begins, the political situation in Denmark can be described as one of uncertainty and tension. The country may be experiencing political turmoil or undergoing significant changes in its leadership or governance. This could be due to various factors, such as elections, power struggles, or societal unrest.

The specific details of the political situation in Denmark at the beginning of the play would depend on the context and plot of the play itself, as well as the author's intent. However, it is possible to speculate on some general scenarios:

1. Transition of Power: The play may depict a transition in government, with a new leader or ruling party taking office. This could result in shifts in policies, ideologies, and power dynamics, leading to tension and uncertainty among the political class and the general population.

2. Social Unrest: The play might explore a period of social or political upheaval, with protests, demonstrations, or movements challenging the existing power structures. This could reflect wider societal issues, such as inequality, corruption, or dissatisfaction with the status quo.

3. International Relations: The play could focus on Denmark's relations with other countries, highlighting diplomatic tensions, negotiations, or conflicts. This could involve themes of national security, alliances, or geopolitical dynamics.

In summary, the political situation in Denmark at the beginning of the play is characterized by uncertainty, tension, and possibly significant changes in leadership or governance. The specific details would depend on the plot and context of the play.

To know more about political turmoil, refer to the link below:

https://brainly.com/question/2616861#

#SPJ11

_____ percent of older people living in their own homes have lived there 20 years or longer.

Answers

According to the Aging in Place report by AARP, approximately 75 percent of older people living in their own homes have lived there 20 years or longer.

This implies that older people tend to own their homes longer. It is evident that older people are reluctant to move out of their homes and prefer to age in place as much as possible.

to know more about  Aging in Place report visit :

https://brainly.com/question/32231934

#SPJ11

plz i need an answer

Answers

Answer: I say c

Explanation:

Sorry if wrong

Both used Americam landscapes to tell a story

According to research by Agarwal et al (2010), communication inefficiencies in healthcare result in:
A) time wasted
B) costly errors
C) Inefficient use of resources
D) all of these are correct

Answers

A) Time wasted: Communication inefficiencies can lead to delays in conveying important information, resulting in wasted time for healthcare professionals and potentially impacting patient care.

B) Costly errors: Poor communication can increase the likelihood of errors, such as misinterpretation of instructions or medication errors. These errors can have financial implications due to the need for additional treatments, corrective actions, or legal consequences.

C) Inefficient use of resources: Ineffective communication can lead to inefficient allocation of resources, such as unnecessary tests or duplicate procedures, which can strain healthcare resources and increase costs.

Therefore, the correct answer is D) all of these are correct.
Other Questions
In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis. Hi 123-123+123+123=???? Which of the following expressions are equivalent to 10 12? Choose all answers that apply: . 2.5 - 6 B.2(5 - 6) C.None of the above