During a storm, lightning strikes kill members of a population of insects in trees but not on the ground or in underbrush, changing the gene frequencies. Which of the following statement is most consistent with this change of gene frequencies being attributed to natural selection rather than genetic drift? A. The insects can change color to match the background on which they sit. B. The primary predators on the insects are birds C. The insects mate in trees and underbrush but not on the ground. D. The insects mate on the ground, but not in trees or underbrush E. The tendency to rest in trees, on the ground, or in underbrush is genetically based

Answers

Answer 1

The statement most consistent with the change in gene frequencies being attributed to natural selection rather than genetic drift is the tendency to rest in trees, on the ground, or in underbrush is genetically based. The correct answer is option E.

If the tendency to rest in trees, on the ground, or in underbrush is genetically based, then the insects that have a genetic predisposition to rest on the ground or in underbrush are more likely to survive the lightning strikes and pass on their genes to their offspring. Over time, this can lead to a change in the frequency of the alleles that control this behavior, resulting in a population that is better adapted to living on the ground or underbrush.

This is an example of natural selection, as the selective pressures created by the lightning strikes and the predation by birds are favoring certain traits or behaviors over others. Genetic drift could also be a factor in this scenario, but the fact that the tendency to rest in different locations is genetically based suggests that natural selection is the primary driver of the change in gene frequencies.

Learn more about natural selection:

https://brainly.com/question/23929271

#SPJ11


Related Questions


Hormones can also be used to treat infertility.
Explain how clomifene therapy and IVF can improve female fertility.

Answers

Clomifene is a drug used as a fertility drug to stimulate ovulation, the release of eggs. It works by blocking the action of oestrogen's negative feedback on LH. Therefore more LH is released in a surge.

Fertility drugs contain FSH and LH to artificially alter the menstrual cycle and increase the chance of pregnancy. The FSH stimulates eggs to mature in the ovary and the LH encourages ovulation to occur.

Gonadotropin medications include human menopausal gonadotropin or hMG and FSH. Another gonadotropin, human chorionic gonadotropin, is used to mature the eggs and trigger their release at the time of ovulation.

Learn more about ovulation:

https://brainly.com/question/25724530

#SPJ1

Upon successful completion of meiosis, a diploid cell would produce gametes with how many chromosomes, written in n-notation?
a) N
b) N-1
c) N and N-1
d) 2N

Answers

Upon successful completion of meiosis, a diploid cell would produce gametes with half the number of chromosomes as the parent cell, so the correct answer is (a) N, written in n-notation.

Meiosis is a process of cell division that produces gametes, which are reproductive cells such as sperm and eggs. This type of cell division involves two rounds of chromosome segregation, which result in the formation of four haploid daughter cells from a single diploid parent cell. In other words, each daughter cell contains half the number of chromosomes as the parent cell. Haploid cells are represented by "n" in n-notation, while diploid cells are represented by "2n". Therefore, upon successful completion of meiosis, a diploid cell with 2n chromosomes would produce gametes with n chromosomes.

The reduction in chromosome number during meiosis is crucial for sexual reproduction, as it allows for the combination of genetic material from two different individuals to create offspring with genetic diversity. This process ensures that each offspring has a unique combination of genes, which can increase its chances of survival and adaptation in a changing environment. Overall, the process of meiosis plays a critical role in the maintenance of genetic diversity in populations and the evolution of species.

Know more about meiosis here:

https://brainly.com/question/29383386

#SPJ11

What happens to matter in ecosystems?

Answers

Answer:

In ecosystems, matter is constantly cycled and recycled through biotic and abiotic components. Matter refers to the atoms and molecules that make up living and non-living things.

Producers, such as plants, take in inorganic matter from the environment, such as carbon dioxide, water, and nutrients, and convert it into organic matter through photosynthesis. Consumers, such as animals, eat the organic matter produced by the producers and break it down through cellular respiration to release energy and produce waste.

Decomposers, such as bacteria and fungi, break down the organic matter in waste and dead organisms into inorganic matter, which can then be reused by producers. This process of cycling and recycling matter through an ecosystem is known as biogeochemical cycling.

Overall, matter is not created or destroyed in ecosystems but rather transformed and recycled through various biotic and abiotic processes.

Answer:

See below.

Explanation:

Terms in question:

Matter: Physical or corporeal substance in general, whether solid, liquid, or gaseous, especially as distinguished from incorporeal substance, as spirit or mind, or from qualities, actions, and the like. Ecosystems: A system, or a group of interconnected elements, formed by the interaction of a community of organisms with their environment.

The matter cycle in an ecosystem refers to the way that various forms of matter, such as water, carbon, and nutrients, move through the different living and nonliving components of the ecosystem. This cycling of matter is essential for the survival and functioning of the ecosystem as a whole. For example, in a forest ecosystem, water is taken in by plants through their roots and is then released into the atmosphere through the process of transpiration. Carbon is taken in by plants through photosynthesis and is then released back into the atmosphere through respiration. Nutrients, such as nitrogen and phosphorus, are taken in by plants and animals and are then returned to the soil through the process of decay. Overall, the cycling of matter in an ecosystem is a continuous process that helps to maintain the balance of the ecosystem, and allows for the production of energy and materials needed for the survival of all organisms.

Energy and Ecosystems

All living things need energy to survive. Almost all organisms on Earth get their energy from the Sun, either directly or indirectly. Organisms that are able to generate their own food, such as plants, are called autotrophs. Auto- means “self” and -troph means “to feed” or “to nourish.” Through photosynthesis, autotrophs combine sunlight, water, and carbon dioxide to make glucose (a type of sugar) and oxygen. The glucose is used by the autotroph either for energy or to build cellular structures. Organisms that are not able to make their own food are called heterotrophs. Hetero- means “other.” Heterotrophs must feed on other organisms to get energy. Energy moves through an ecosystem in a single direction. First, it flows from the Sun to autotrophs, or producers. Then, it flows from producers to heterotrophs, or consumers. Energy never flows backward from consumers to producers. For example, a plant cannot consume and get energy directly from a mouse. But, when a mouse dies, decomposers break down its body and return the nutrients to the ecosystem. Nutrients from the dead mouse may indirectly return to the plant through the soil.

These organisms are also known as autotrophs because they obtain their energy directly from the sun. Through the process of photosynthesis, autotrophs are able to rearrange the elements in CO2 and H2O obtained from the environment to produce the energy-rich carbohydrate, glucose, by using energy from the Sun to power the reaction. Autotrophs can then use the elements in glucose directly to make their own cellular energy in the form of ATP through the process of cellular respiration

Two plants with the following genotypes are crossed: AArrSs x aarrSS. What are not possible or normal genotypes in a plant of the next generation?AArrss AarrSS AaRRS AarrSs Aarrss aaRrSs AarrSss

Answers

The genotypes that are not possible or normal in a plant of the next generation of crossing two plants: AArrSs x aarrSS are AArrss, AarrSS, AaRRS, Aarrss, and aaRrSs.

First, identify the possible genotypes from the given cross: AArrSs x aarrSS.

The gametes produced by each parent are:
Parent 1: ARS, ArS
Parent 2: arS, arS

Now, let's examine the possible genotypes for the offspring:

1. ARS x arS = AaRrSs
2. ArS x arS = AarrSs

These are the only possible genotypes for the next generation. Any other genotype combinations, such as AArrss, AarrSS, AaRRS, Aarrss, or aaRrSs are not possible from this cross.

Learn more about genotypes here: https://brainly.com/question/30460326

#SPJ11

given that the carbohydrate reserve in humans is so small, why is it so important?

Answers

Carbohydrate reserves may be small in humans, but they are still essential for maintaining blood sugar levels and providing energy during periods of physical activity or when food is not readily available. This is because carbohydrates are the body's primary source of fuel and play a vital role in energy production.

When carbohydrate reserves are depleted, the body may start to break down protein and fat for energy, which can lead to muscle loss and other negative health consequences. Therefore, even though carbohydrate reserves may be small, they are still crucial for human health and wellbeing.

Furthermore, carbohydrates are an important part of a healthy and balanced diet, providing essential nutrients and fiber that are beneficial for overall health. Therefore, even though the carbohydrate reserve in humans is small, it is still critical for maintaining optimal health and well-being.

Learn more about the functions of carbohydrates, at: https://brainly.in/question/5860486

#SPJ11

Step 7-Multiple Use: Describe TWO popular ways your forest is used recreationally (Tourism, Hiking, Biking, ATV's,
4X4, Camping, Photography, etc.) and TWO other uses (Logging, Mining, Education, Research, Agriculture, Flood Cont.)
1.
2.
Step 6-Conservation: Describe what is being done to help protect OR prevent the following in your forest. You must
choose THREE of the following or provide examples specific to your forest that are NOT LISTED below.
(Deforestation, Overharvesting, Erosion, Pollution, Invasive Species, Habitats, Climate Change, Air, Soil, or Water Quality)
3.
Step 8-Resource Management: Describe how the following management practices are OR can be used to provide
humans with necessary resources (logging, mining, hunting, agriculture, etc.) while still protecting the forests ecosystem.
Adaptive Management (Using Data and Research, allows change!) -
Ecosystem Based Management (Protects ALL Abiotic and Biotic Factors)-
1.
Maximum Sustainable Yield (Can be harvested seasonally without damaging the population or ecosystem) -
2.
3.
Step 9 - What's Next? Look up or create ONE future "Project or Plan" for the forest and describe its purpose.
Step 10 - Additional Research: Research 3 OTHER interesting, "Fun Facts" about the forest (ex: landforms, history, etc.)

Answers

Answer:

what is the mitochondria

Please help!
The presence of tiny hairs, called setae, on the toe pads of some geckos is associated with the ability to adhere to smooth surfaces. This ability allows geckos to climb in areas where many predators cannot. Scientists studying the evolution of setae have identified three closely related species of gecko, only one of which can adhere to smooth surfaces. A model of the evolutionary relatedness between these species is represented in the figure.

Which of the following statements is an accurate description of the evolutionary relationships shown in the model?

A. G. concinnatus is more closely related to G. antillensis than G. humeralis.

B. G. antillensis had more DNA and protein sequences in common with G. humeralis than G. concinnatus.

C. G. concinnatus and G. humeralis share the most recent common ancestor, as compared to G. antillensis.

D. G. humeralis is more closely related to G. concinnatus than G. antillensis.

Answers

The right response is D. G. humeralis resembles G. concinnatus more than G. antillensis. This is due to the fact that the model of evolutionary relatedness demonstrates a closer relationship between G. humeralis, G. concinnatus, and G. antillensis on the tree.

This suggests that G. antillensis and G. humeralis have a more distant common ancestor than G. concinnatus. This is further confirmed by the fact that the nearest species in the tree are the two species that can attach to smooth surfaces, G. concinnatus and G. humeralis.

This shows that the two species have recently gained the capacity to stick to smooth surfaces, and that this ability was probably passed down from a common ancestor.

Learn more about setae at:

https://brainly.com/question/20392483

#SPJ1

A 48 year old woman presents with malaise, weakness and jaundice. A liver bx. reveals fatty liver, and perivenular and pericellular fibrosis. Which one of the following is MOST likely diagnosis?
Hemochromatosis
Reye’s syndrome
Primary biliary cirrhosis
Alcoholic cirrhosis
Hepatocellular carcinoma

Answers

Based on the information provided, a 48-year-old woman with malaise, weakness, jaundice, fatty liver, and perivenular and pericellular fibrosis, the MOST likely diagnosis is Alcoholic cirrhosis.

Based on the presentation and liver biopsy findings, the most likely diagnosis for this 48 year old woman is alcoholic cirrhosis. The symptoms of malaise, weakness, and jaundice are common in individuals with liver disease. The liver biopsy revealing perivenular and pericellular fibrosis is a common finding in alcoholic cirrhosis, which is caused by long-term alcohol consumption. Hemochromatosis is a genetic disorder that causes iron overload, Reye's syndrome is typically seen in children following a viral illness and is characterized by liver damage, while primary biliary cirrhosis is an autoimmune disease that affects the bile ducts in the liver. Hepatocellular carcinoma is a type of liver cancer that can develop in individuals with chronic liver disease such as cirrhosis. However, the presentation and liver biopsy findings in this case are more indicative of alcoholic cirrhosis.

Learn more about jaundice here:

https://brainly.com/question/28200110

#SPJ11

In general, fossilization requires an organism to have ___ and to be ___.
A. soft parts / buried quickly
B. soft parts/ buried slowly
C. hard parts / buried quickly
D. hard parts / buried slowly

Answers

Answer: D

Explanation: The correct answer is D. Fossilization generally requires an organism to have hard parts, such as bones or shells, and to be buried slowly under sediment, which can help preserve the remains over time. Soft parts, such as flesh or skin, are less likely to be preserved as they are more susceptible to decay and are often consumed by scavengers before they can be buried.

How many questions you got bro :/

in diploid species like humans what is the relatedness of a niece to her aunt assuming they share the same grandparents

Answers

Answer:

Relatedness is represented by Coeff

Explanation:

hope this help

VETERINARY SCIENCE!!!
In the last year, Scarlett's old tom cat has begun to move around a little more slowly. She's noticed lately, though, that he seems to be limping, favoring his left hind leg. Scarlett takes her cat to see a veterinary scientist, who does an examination. He tells Scarlett that it looks as if the cat has developed osteoarthritis. Scarlett is confused. Which statement BEST describes the tom cat's condition in layman's terms?

A bone has fractured and caused swelling in his hind leg.

An infection has caused pain to the tissue on his leg.

His joints have rubbed together so much that they are causing pain.

There is nerve damage to his leg, so he has lost feeling in it.

Answers

The tom cat's joints have rubbed together so much that they are causing pain, which is known as osteoarthritis.

Some bacteria survive in the
absence of oxygen. Which of
the following environments
could they survive in?
A. on the stems of plants
B. on the skin of animals
C. on a table top
D. deep soil

Answers

Answer:

deep soil is the correct answer as their is lack of oxygen their

Answer:

deep soil is the correct answer as their is lack of oxygen their

cooking an egg (application of heat and/or agitation) destroys its physiological property by the process termed ________.

Answers

Cooking an egg (application of heat and/or agitation) destroys its physiological property by the process termed denaturation.

When an egg is heated, the proteins in the egg begin to denature, which means they lose their structure and become less functional. This is because the heat breaks down the bonds that hold the protein in its specific shape, causing the protein molecules to unravel and expose their hydrophobic regions. This exposes the protein's reactive side chains, causing them to become more reactive and able to bind to other molecules, such as water, which causes the protein to change shape and lose its function. Agitation, such as whisking or beating, can also denature the proteins in an egg by breaking down their structure and exposing their reactive side chains.

Denaturation of egg proteins during cooking can result in changes in texture, color, and flavor. For example, when an egg is fried, the proteins on the surface of the egg coagulate and form a crust, while the proteins in the yolk coagulate and thicken, resulting in a solid and opaque appearance. Similarly, when an egg is boiled, the proteins in the egg white and yolk coagulate and thicken, resulting in a firm texture. Denaturation of egg proteins can also result in the development of new flavors, such as the Maillard reaction, which occurs when amino acids in the egg react with reducing sugars during cooking to produce browned, complex flavors. Overall, denaturation of egg proteins during cooking is a complex process that results in changes in texture, color, and flavor, and is responsible for transforming the raw egg into a cooked, flavorful food.

Know more about denaturation here:

https://brainly.com/question/31044258

#SPJ11

For the reaction, ADP+ phosphate ⇌ATP,ΔG∘=30.50 kJ mol−1 . What is the value of the equilibrium constant, K , for this process under physiological conditions of 37.5∘C? ? A 4.5×10−6 B 7.4×10−6 C 1.3×105 D 2.2×105

Answers

The value of the equilibrium constant is 4.5 × 10⁻⁶. The answer is A)

The value of the equilibrium constant (K) for the reaction ADP + phosphate ⇌ ATP at physiological conditions of 37.5°C can be calculated using the equation ΔG° = -RT ln(K), where R is the gas constant, T is the temperature in Kelvin, and ln is the natural logarithm.

We know ΔG° = 30.50 kJ mol⁻¹, and R = 8.314 J K⁻¹ mol⁻¹. To convert the temperature to Kelvin, we add 273.15 to 37.5°C to get 310.65 K.

Plugging in the values, we get:

30.50 kJ mol⁻¹ = -8.314 J K⁻¹ mol⁻¹ × 310.65 K × ln(K)

Simplifying the equation, we get:

ln(K) = -(30.50 × 10³ J mol⁻¹) / (8.314 J K⁻¹ mol⁻¹ × 310.65 K)

ln(K) = -12.39

Taking the exponential of both sides, we get:

[tex]K = e^{(-12.39)[/tex] = 4.5 × 10⁻⁶

To know more about  equilibrium constant, refer here:
https://brainly.com/question/29253884#
#SPJ11

how does the change in the cross-sectional area of a test specimen in a compression test differ from its counterpart in a tensile test specimen?

Answers

The change in the cross-sectional area of a compression test specimen differs from a tensile test specimen as compression causes the area to increase, while tensile causes it to decrease.

In a compression test, the specimen is subjected to compressive forces, causing it to contract in the longitudinal direction and expand in the transverse direction, increasing the cross-sectional area. Conversely, in a tensile test, the specimen is subjected to tensile forces, stretching it longitudinally and causing a reduction in the cross-sectional area.


1. Compression test: apply compressive forces to the specimen.
2. Observe the specimen contracting longitudinally and expanding transversely.
3. Result: increased cross-sectional area.

1. Tensile test: apply tensile forces to the specimen.
2. Observe the specimen stretching longitudinally and contracting transversely.
3. Result: decreased cross-sectional area.

To know more about compression test click on below link:

https://brainly.com/question/22170796#

#SPJ11

5. use img to find the locus tags of the genes that encode atp synthase in the bacterium lactococcus lactis subsp. cremoris sk11. why is this organism important?

Answers

IMG can find the locus tags of the genes that encode atp synthase in the bacterium lactococcus lactis subsp. cremoris sk11. This organism important for production of lactic acid during milk fermentation

The locus tags of the genes encoding ATP synthase in the bacterium Lactococcus lactis subsp. cremoris SK11 can be identified using the IMG (Integrated Microbial Genomes) database, this database allows researchers to access genomic information for various microorganisms, including Lactococcus lactis subsp. cremoris SK11, and locate specific genes, such as those encoding ATP synthase, through locus tags. This organism is important for several reasons, primarily in the dairy industry.

Lactococcus lactis subsp. cremoris SK11 is a lactic acid bacterium, responsible for the production of lactic acid during milk fermentation. It plays a crucial role in the manufacturing of dairy products such as cheese and yogurt, as it helps in the formation of the desired taste, texture, and overall quality of the final product. Additionally, Lactococcus lactis subsp. cremoris SK11 has potential applications in biotechnology, as its genetic information can help improve our understanding of bacterial metabolism and other processes.

Learn more about genes at:

https://brainly.com/question/29762819

#SPJ11

greenbelts can provide vital ecosystem services, such as .group of answer choicespublic transportation to the central cityabsorption of co2 and other air pollutantsprotection from precipitationproduction of all the food needed in the cityenergy production

Answers

Greenbelts can provide vital ecosystem services, such as the absorption of CO₂ and other air pollutants.

Greenbelts, which are areas of protected open space surrounding urban areas, offer multiple ecosystem services. Among these services, one of the most important is the absorption of carbon dioxide (CO₂) and other air pollutants. This is primarily due to the presence of trees and vegetation in greenbelts, which absorb CO₂ through the process of photosynthesis, converting it into oxygen. Additionally, greenbelts help to filter air pollutants, improving air quality for nearby residents. While greenbelts may not provide services such as public transportation, energy production, or complete food production for a city, their role in mitigating air pollution and maintaining environmental quality is significant and essential.

Learn more about ecosystem here:

https://brainly.com/question/13979184

#SPJ11

Explain Whether Or Not Is Beneficial To Have Unequal Blood Flow Through The Different Organ Of The Body
Table 14.3 | Estimated Distribution of the Cardiac Output at Rest Organs Blood Flow Milliliters per Minute Percent total
Gastrointestinal tract 1400 24
and liver
Kidneys 1100 19
Brain 750 13
Heart 250 4
Skeletal muscles 1200 21
Skin 500 9
Other organs 600 10
Total organs 5800 100

Answers

Explanation:

It is actually beneficial to have unequal blood flow through the different organs of the body. This is because each organ has a different metabolic rate and nutrient requirement, and therefore requires a different amount of blood flow to function optimally. For example, the gastrointestinal tract and liver require a significant amount of blood flow in order to digest and absorb nutrients from food, while the kidneys require blood flow to filter waste products from the blood.

The unequal distribution of blood flow is largely regulated by the body's autonomic nervous system and hormones, which help to redirect blood flow to where it is needed most. During times of physical activity, for example, blood flow is redirected to the skeletal muscles, which require more oxygen and nutrients than they do at rest.

Thus, the unequal distribution of blood flow allows for efficient organ function and helps to meet the metabolic demands of the body as a whole.

Certain human cell types, such as skeletal muscle cells, have several nucli per coll. Based on your understanding of mitosis, how could this happen? A The coll undergoes anaphase twice before entering telophase Ok. b. The coll undergoes repeated cytokinesis but not mitosis, OC c. The cell goes through multiple S phases before entering mitosis. D. The coll undergoes repeated mitotic divisions but not cytokinesis. La Moving to another question will save this response.

Answers

Certain cell types, such as skeletal muscle cells, can have multiple nuclei per cell due to the process of endoreduplication, where the cells undergo repeated mitotic divisions but not cytokinesis. Hence correct answer is option D

This results in cells with multiple copies of the genome and multiple nuclei. Endoreduplication is common in cells that require high levels of gene expression or cell function, such as muscle cells, liver cells, and megakaryocytes (which produce platelets).

During mitosis, the replicated chromosomes are separated and distributed to each daughter cell. In the case of endoreduplication, the chromosomes are replicated but do not undergo cell division.

As a result, the cells contain multiple copies of the genome and multiple nuclei. This process can occur multiple times, resulting in cells with more than two nuclei. The correct answer is option D

Know more about chromosomes here:

https://brainly.com/question/30993611

#SPJ11

Dr. alvarez studies how the degeneration of nerve cells in the brain might contribute to the development of multiple sclerosis. dr. alvarez’s work best exemplifies the ________ subfield of psychology.
biological experimental developmental cognitive

Answers

Dr. Alvarez’s work best exemplifies the biological subfield of psychology.

Dr. Alvarez's research focuses on the degeneration of nerve cells in the brain and its potential role in the development of multiple sclerosis, which is a disease with a biological basis.

The biological subfield of psychology studies the biological and physiological processes that underlie behavior, including the structure and function of the nervous system, genetics, and the effects of drugs and hormones on behavior. This subfield encompasses a wide range of research areas, including neuroscience, genetics, psychopharmacology, and behavioral endocrinology.

The other subfields of psychology include experimental, developmental, cognitive, and others. Experimental psychology focuses on understanding basic psychological processes through experimentation, while developmental psychology examines human development across the lifespan.

Cognitive psychology studies mental processes such as perception, attention, and memory, while other subfields include social psychology, personality psychology, and clinical psychology.

To know more about psychology, refer here:
https://brainly.com/question/30123296#
#SPJ11

Need to help on this

Answers

The process of burning fossil fuels is called combustion.

Cellular respiration is like combustion because they both burn a Carbon Compound with Oxygen and make energy.

What is the process of burning called?

The process of burning fossil fuels is called combustion, and it is most like the process of burning a carbon compound with oxygen and producing energy.

Cellular respiration and combustion are similar in that they both involve the breaking down of carbon-based molecules with oxygen to produce energy.

In cellular respiration, glucose and other organic molecules are broken down in the presence of oxygen to produce ATP, carbon dioxide, and water. In combustion, fossil fuels are burned with oxygen to produce energy, carbon dioxide, and water.

Learn more about fossil fuels at: https://brainly.com/question/79954

#SPJ1

which of the following statements about the hyphae of ectomycorrhizal fungi are correct? i. they provide plants with minerals and water from the soil. ii. they obtain sugars that plants produce by photosynthesis. iii. they grow between root cells.

Answers

Statement ii is correct. They obtain sugars that plants produce by photosynthesis. Ectomycorrhizal fungi form mutualistic associations with the roots of many trees and other woody plants.

The hyphae of these fungi grow around the roots of the host plant and penetrate the outer layers of root cells, forming a dense sheath called the mantle. However, unlike arbuscular mycorrhizal fungi, the hyphae of ectomycorrhizal fungi do not grow between root cells or directly penetrate the cell wall of the root cells to form arbuscules. Instead, the hyphae grow around the root cells and form a network of fungal filaments called the Hartig net, which are located within the intercellular spaces of the root cortex.

The hyphae of ectomycorrhizal fungi absorb sugars and other organic compounds produced by the plant through photosynthesis and transport them to the fungal mycelium, where they are used as a source of energy for growth and metabolism.

To know more about Ectomycorrhizal fungi visit :-

https://brainly.com/question/31631887

#SPJ11

The JCVI is challenging which part of cell theory?Choose one:A. The JCVI challenges the idea that every living organism is composed of one or more cells.B. The JCVI challenges neither major idea posed by cell theory.C. The JCVI challenges both major ideas posed by cell theory.D. The JCVI challenges the idea that all cells come from preexisting cells.

Answers

The JCVI (J. Craig Venter Institute) challenges neither major idea posed by cell theory. Therefore, option (B) is correct.

The JCVI, as a research institute specializing in genomics and synthetic biology, does not challenge the fundamental principles of cell theory. Cell theory states that all living organisms are composed of one or more cells (option A), and that cells arise from preexisting cells (option D).

The JCVI's work primarily focuses on studying and manipulating cellular systems at the molecular level, including the creation of synthetic cells, but it does not dispute or challenge the core principles of cell theory.

Learn more about cell theory, here:

https://brainly.com/question/4695161

#SPJ12

What does it mean about the food available in its natural environment if a microbe evolved the ability to survive on citrate as a sole carbon source?

Answers

If a microbe has evolved the ability to survive on citrate as a sole carbon source, it suggests that citrate is present in its natural environment as a potential food source.

How does the ability to survive on citrate a competitive advantage?

This ability may give the microbe a competitive advantage over other microbes that cannot utilize citrate, especially in environments where other carbon sources are scarce. However, it's important to note that not all microbes that can survive on citrate are necessarily pathogenic (i.e., disease-causing) - some are beneficial or even neutral to their host organisms. Pathogens are a specific type of microbe that can cause harm to their hosts, often by using virulence factors to invade host cells and tissues.

The microbe adapted to utilize citrate in order to survive and thrive in its environment, which may be rich in citrate but scarce in other nutrients. This adaptation allows the microbe to exploit a niche in its environment where other microbes or pathogens may not be able to compete as effectively.

To know more about competitive advantage, visit:

https://brainly.com/question/22083936

#SPJ11

What is the answer for AP Bio Unit 7 question?

Answers

The answer would be b
Final answer:

The question refers to an AP Biology Unit 7 concept, but lacks specificity. This unit typically includes topics like Cells, Cellular Respiration, Photosynthesis, and Mitosis/Meiosis. More details are needed to provide a specific answer.

Explanation:

Unfortunately, without the specific question for AP Biology Unit 7, it's difficult to give a precise answer. AP Biology Unit 7 typically covers topics such as Cells, Cellular Respiration, Photosynthesis, and cell division processes like Mitosis and Meiosis. You could be asking about anything ranging from the structure of the cell, details about the cell cycle, or even intricacies of energy generation. Please provide more specifics to your question and I'll gladly assist in a more targeted way.

Learn more about AP Biology Unit 7 here:

https://brainly.com/question/34789261

#SPJ6

Where does a developing fetus stay to be protected and sustained?

Answers

During pregnancy, a developing fetus stays inside the uterus of the mother. The uterus is a muscular organ located in the pelvis, and it is designed to protect and nourish the growing fetus. The inner lining of the uterus, called the endometrium, thickens and becomes richly supplied with blood vessels in preparation for the implantation of a fertilized egg. Once the egg implants in the endometrium, the placenta develops to provide the fetus with oxygen and nutrients from the mother's bloodstream. The amniotic sac, which is filled with amniotic fluid, surrounds and cushions the fetus, protecting it from injury and allowing it to move freely.

One part of the cell theory states that all living things are made up of one or more cells. Scientists had to find ways to test this theory. Which investigation could scientists use to test this part of cell theory?

Choose the correct answer.

heat plant or animal tissue on a hot plate

test plant or animal tissue with a pH meter

examine plant or animal tissue with a microscope

measure the mass of plant or animal tissue with a scale

Answers

Answer:  examine plant or animal tissue with a microscope.

Explanation:

wehat teo anatomicalfeatures allow ferns to grow arger than bryophytes?

Answers

Ferns are able to grow larger than bryophytes due to two anatomical features - vascular tissue and true roots.

Anatomical features in ferns:

Vascular tissue in ferns allows for efficient transportation of water and nutrients throughout the plant, while bryophytes lack true vascular tissue and rely on diffusion for nutrient uptake. Additionally, true roots in ferns enable them to anchor firmly in the soil and absorb nutrients more efficiently, while bryophytes only have rhizoids which serve for anchorage but not nutrient absorption. These two features allow ferns to grow larger and more complex than bryophytes.
The two anatomical features that allow ferns to grow larger than bryophytes are vascular tissue and a well-developed root system. Vascular tissue, which includes the xylem and phloem, helps in the transportation of water, minerals, and nutrients throughout the plant, allowing ferns to grow taller. A well-developed root system provides anchorage and absorbs water and nutrients from the soil, supporting the growth of larger plants compared to bryophytes.

To know more about bryophytes, visit:

https://brainly.com/question/12375814

#SPJ11

originally how many kingdoms were there why

Answers

Answer: Aristotle was the first to introduce two kingdom systems Animalia and Plantae and this can be attributed to their lack of knowledge. Today we follow the five-kingdom classification.

Explanation: Aristotle first introduced two kingdom classifications in ancient times- Animalia and Plantae. The lack of knowledge about other classes (living and non-living) was one of the reasons for this.

As more and more information was gained, these classifications became more and more elaborate. Today, we generally follow the five-kingdom classification consisting of Monera(including Eubacteria and Archaeobacteria), Protista, Fungi, Plantae, and Animalia.

To learn more about five-kingdom classification:

https://brainly.in/question/4986844

Glucose synthesis can derive carbons from a variety of sources including [ Select] [ Select] [ Select) and [ Select] [ Select glycerol fatty acids Select amino acids cholesterol [ Select] lactate NADH Select, oxidative phosphorylation carbon dioxide, photosynthesis

Answers

Glucose synthesis, also known as gluconeogenesis, is the process by which the body produces glucose from non-carbohydrate sources. This process occurs mainly in the liver and kidneys, and it is important in maintaining blood glucose levels during periods of fasting or low carbohydrate intake.


The carbons used in glucose synthesis can come from a variety of sources, including glycerol, fatty acids, amino acids, lactate, and even cholesterol. Glycerol, which is released from triglycerides in adipose tissue, can be converted to glucose through a series of enzymatic reactions.

Similarly, fatty acids can be broken down to acetyl-CoA, which can then be converted to glucose through the citric acid cycle and the gluconeogenic pathway.

Amino acids, which are derived from protein breakdown, can also provide carbons for glucose synthesis. Different amino acids can be used as substrates for different steps in the gluconeogenic pathway, with alanine and glutamine being particularly important.

Lactate, which is produced by anaerobic glycolysis in muscle cells, can also be converted to glucose through the gluconeogenic pathway.

Finally, in certain situations, carbon dioxide can also be used as a substrate for glucose synthesis. This occurs through a process called photosynthesis, which is used by certain bacteria and plants to produce glucose from carbon dioxide and water using energy from sunlight.

Overall, glucose synthesis is a complex process that involves the use of various substrates and pathways to produce glucose from non-carbohydrate sources. Understanding the different sources of carbons for glucose synthesis is important in understanding how the body maintains glucose homeostasis and adapts to different metabolic conditions.

For more such questions on gluconeogenesis

https://brainly.com/question/9192661

#SPJ11

Other Questions
percent deviation from real value (0.385 j/g c for cu and 0.902 j/g c for al): .. b) unknown metal Suppose that two threads have several critical sections, protected by different mutexes. The following are two of those critical sections, with their protection code. code segment 1 lock(m1); ... /* code protected by m1 */ lock(m2); ... /* code protected by m2 */ unlock(m2); unlock(m1) code segment 2 lock(m2); ... /* code protected by m2 */ lock(m1); ... /* code protected by m1 */ unlock(m1); unlock (m2). Is that a sensible way to protected this critical code? Select one: O True O False Match the following. Match the items in the left column to the items in the right column.1. set builder notation2. element3. set4. line graph5. inequality6. real numbera shorthand way to write a set(less than), (greater than), (less thanor equal to), (greater than or equal to)visual tool used to illustrate solutionsetsa collection or group of objectsindicated by braces, (a member of a setpositive or negative, rational orirrational numbers including zero The addition of concentrated nitric acid to each standard solution... Select all that are True. O results in a relatively constant ionic strength across the standard solutions. O results in the required amount of excess nitrate ion. O changes the potential of the reference electrode. O results in an ultraviolet digestion to ensure sample dissolution. O results in a wet acid digestion to ensure sample dissolution. Unit 9 lesson1 7th grade math math nation pt.2 Can somebody do this, please?! 10. describe three similarities between mitosis and meiosis. a. 11. describe three ways the outcome of mitosis and meiosis differ. a first order reaction has a rate constant of 1.10 x 10-4 s-1 at 470oc, and 5.70 x 10-4 s-1 at 500oc. what is the activation energy for the reaction?a. 260 kJ/mol b. 46 kJ/mo c. 110 kJ/mol d. 380 kJ/mol The French experience in New France was similar to the Spanish experience in New Mexico in all of the following ways, EXCEPT...Group of answer choicesImperial influence was expanded by conquering native peoplesLow level immigrationDependence upon the native peoplesInter-racial marrying and social integration Express cos M as a fraction in simplest terms. Multiple energy storage methods are in use around the world. Pumped hydroelectric is a common energy storage method in the United States that pumpswater into a storage pond raised above another water source and then allows the water to flow downhill through a turbine to generate electricity. How is theenergy stored in pumped hydroelectric facilities?O as kinetic rotational energyO as stored chemical energyO as thermal energyO as gravitational potential energy When light enters and leaves the prism, its path is changes because the light is _____ at the boundary between the glass and the airA. Absorbed B. DiffractedC. ReflectedD. Refracted Sheridan Company is considering an investment that will return a lump sum of $929,000 6 years from now. CWhat amount should Sheridan Company pay for this investment to earn an 8% return? (Round answer to 2 decimal places, eg. 25.25.)Lincoln Company should pay $ ___Wildhorse Co.earns 8% on an investment that pays back $87,000 at the end of each of the next 6 years.What is the amount Wildhorse Co. invested to earn the 8% rate of return? (Round answer to 2 decimal places, eg. 5,275.25.) Wildhorse Co. invested $ ___ compare and contrast the expansionist policies of the russian state with those pursued by the british and french regimes during this period. let x have the following cumulative distribution function (cdf): f(x)={0,x Gary deposited $9,000 in a savings account with simple interest. Four months later, he had earned $180 in interest. What was the interest rat (conservation of mass) for a certain incompressible flow field it is suggested that the velocity components are given by the equations is this a physically possible flow field? Please help me with this (9/4x+6)-(-5/4x-24) A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 55 C. If an RNA duplex oligonucleotide of identical sequence, substituting U for T, is constructed, how will its melting temperature compare to that of its DNA counterpart? - The tm will be higher. - The effect on tm of replacing U for T cannot be predicted. - The tm will be lower. - The tm will be unchanged. The time it takes a mechanic to change the oil in a car is exponentially distributed with a mean of 5 minutes. (Please show work)a. What is the probability density function for the time it takes to change the oil?b. What is the probability that it will take a mechanic less than 6 minutes to change the oil?c. What is the probability that it will take a mechanic between 3 and 5 minutes to change the oil?d. What is the variance of the time it takes to change the oil?